Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analyse wohltuende Wirkung von Nahrungsergänzungsmitteln auf Darmepithel Barrierefunktionen Während Experimental ulcerosa

doi: 10.3791/55095 Published: January 5, 2017

Summary

Aktuelle Behandlungen von entzündlichen Darmerkrankungen (IBD) zielen darauf ab, die Krankheitssymptome zu lindern, kann aber schwere Nebenwirkungen verursachen. Somit sind alternative Strategien in Tier Colitis-Modellen untersucht. Hier erklären wir, wie die positiven Wirkungen von Nahrungsergänzungsmitteln auf die klinische IBD Zeichen sind in einer solchen ulcerosa Modell analysiert.

Abstract

Entzündliche Darmerkrankungen (IBD), einschließlich Morbus Crohn und Colitis ulcerosa, chronische rezidivierende Erkrankungen des Darmes. Sie verursachen schwere Probleme wie Bauchkrämpfe, blutiger Durchfall und Gewichtsverlust, in den betroffenen Individuen. Leider gibt es noch keine Heilung, und Behandlungen zielen nur die Symptome zu lindern. Gegenwärtige Behandlungen schließen entzündungshemmende und immunsuppressive Medikamente, die starke Nebenwirkungen verursachen können. Dies garantiert, dass die Suche nach alternativen Behandlungsmöglichkeiten, wie zum Beispiel Nahrungsergänzungsmittel, die keine Nebenwirkungen verursachen. Vor ihrer Anwendung in klinischen Studien, müssen solche Verbindungen rigoros auf ihre Wirksamkeit und Sicherheit in Tiermodellen getestet werden. Eine verlässliche experimentelle Modell ist das Dextransulfat-Natrium (DSS) Colitis-Modell bei Mäusen, die bei Menschen viele der klinischen Symptome der Colitis ulcerosa wiedergibt. Wir wendeten dieses Modell vor kurzem die wohltuende Wirkung eines Nahrungsergänzungsmittel zu testen, enthaltendVitamine C und E, L-Arginin und ω3-mehrfach ungesättigte Fettsäuren (PUFA). Wir untersuchten verschiedene Parameter Krankheit und festgestellt, dass diese Ergänzung konnte Ödembildung, Gewebeschädigung, Leukozyteninfiltration, oxidativer Stress, und die Produktion von pro-inflammatorischen Zytokinen zu verbessern, was zu einer Gesamtverbesserung in der Krankheitsaktivitätsindex. In diesem Artikel erläutern wir ausführlich in der korrekten Anwendung von Nahrungsergänzungsmitteln, die DSS Colitis-Modell in C57Bl / 6-Mäuse, sowie wie Krankheitsparameter wie Histologie, oxidativen Stress und Entzündungen werden mit bewertet. die positiven Auswirkungen der verschiedenen Nahrungsergänzungen analysieren dann schließlich neue Wege für die Entwicklung alternativer Behandlungsstrategien öffnen kann, die IBD Symptome zu lindern und / oder dass die Phasen des Stillstands, ohne dass schwere Nebenwirkungen zu verlängern.

Introduction

Ulcerosa ist eine entzündliche Erkrankung des Dickdarms, die Durchfall und Bauchschmerzen verursachen können. Ulcerosa kann akut sein, in Reaktion auf eine Infektion oder Stress, oder es kann als eine chronische Erkrankung, wie beispielsweise bei Colitis ulcerosa (UC) zu entwickeln, die zur Gruppe der entzündlichen Darmerkrankungen (IBD) gehört. Obwohl die klinischen Symptome von UC sind gut beschrieben wurde, ist die Pathogenese noch schlecht 1 verstanden. Es wird unter den Experten angenommen , dass UC eine multifaktorielle Erkrankung, die mit genetischen Mutationen und anomale Immunreaktionen ist es, eine große Rolle spielen 2. Allerdings Umweltfaktoren, wie zum Beispiel Wohnstil und Ernährung, tragen auch zur Krankheitsentstehung und Progression 3.

Leider ist IBD nicht heilbar, aber es gibt viele Behandlungsmöglichkeiten, die klinischen Symptome zu lindern wollen. Aktuelle Behandlungen gehören entzündungshemmende Medikamente, wie Sulfasalazin und Kortikosteroide; Immunsuppressiva, wie azathioprine; monoklonale Antikörper, die Capture-pro-inflammatorische Zytokine wie Tumor-Nekrose-Faktor-α (TNF-α) oder Block Adhäsionsmoleküle, wie Integrine, übermäßige Rekrutierung von Leukozyten zu verringern; und Inhibitoren , die Kinasen angreifen , die pro-inflammatorischen Wege auslösen, wie Janus - Kinase (JAK) 4. Nicht reagieren alle Patienten auf alle Behandlungen, so therapeutische Strategien müssen 5 individualisiert werden. Darüber hinaus interferieren die meisten dieser therapeutischen Arzneimittel mit dem Stoffwechsel und Immunreaktionen, die oft schwere Nebenwirkungen zu verursachen. Aus diesem Grund wurden alternative Behandlungsmöglichkeiten untersucht.

Alternative Behandlungen umfassen Probiotika und Nahrungsergänzungsmittel, die in Tiermodellen und klinischen Studien mit unterschiedlichem Erfolg 6,7 angewendet wurden. Wir fanden vor kurzem, dass die Anwendung von verschiedenen Einzelnahrungsergänzungsmittel, wie zum Beispiel antioxidativen Vitamine oder ω3-mehrfach ungesättigte Fettsäuren (PUFAS), ist schlechter als die Anwendung einer Kombination solcher Supplemente in 8,9 ulcerosa und kardiovaskulären Krankheitssymptome zu lindern. Diese Studien wurden in Mäusen durchgeführt, so dass klinische Studien müssen in Menschen durchgeführt werden, um festzustellen, ob diese Ergebnisse auch auf den Menschen anwendbar. Bevor klinische Studien initiiert werden, muss die Wirksamkeit und Sicherheit der neuen Behandlungsmöglichkeiten in Tiermodellen untersucht werden.

Für IBD wurde verwendet , das Dextransulfatnatrium (DSS) Modell in großem Maße die Mechanismen der Krankheitsentwicklung und die positiven Wirkungen von Medikamenten und Nahrungsergänzungsmittel 6,10 zu studieren. In den meisten Studien nur eine akute Krankheit über einen Zeitraum von sieben Tagen induziert wird; doch die klinischen Symptome bei diesen Tieren beobachtet , die denen bei CED - Patienten beobachtet ähneln (dh, blutiger Durchfall, Gewichtsverlust, epithelialen Dysfunktion und Immunzellinfiltration) 10. DSS induziert Erosionen in der Schleimhaut,was zu einer Barrierestörung und einer erhöhten Darmepithel Permeabilität 11. Der genaue Mechanismus ist unbekannt. Allerdings schlägt eine Studie , dass DSS mit mittlerer Kettenlänge Fettsäuren interagiert Nano lipocomplexes zu bilden , die fähig sind an Epithelzellen eintreten und zu induzieren Entzündungssignalisierungs 12 Wegen. In diesem Artikel beschreiben wir ausführlich, wie bei Mäusen induziert und analysiert wird, Kolitis, wie Nahrungsergänzungsmittel mit der Schlundsonde angewendet werden eine konstante Dosierung bei jedem Tier zu gewährleisten, und wie die Auswirkungen dieser Ergänzungen auf verschiedene ulcerosa Symptome untersucht.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle Tierversuche wurden von der Institutional Animal Care und Use Committee von CINVESTAV genehmigt.

1. Herstellung von DSS Trinkwasser und die Induktion von Kolitis

  1. Bereiten Sie eine 3,5% w / v Dextransulfatnatrium (DSS) Lösung in autoklavierten Trinkwasser. DSS löst sich leicht und es ist nicht die endgültige Lösung zu filtrieren erforderlich.
    HINWEIS: 7 Tagen nach der DSS-Behandlung induziert schweren Colitis. Wenn milde Kolitis induzieren, 3 - 4 Tage der Behandlung empfohlen. Solange die DSS Trinkwasser klar bleibt, ist es nicht notwendig, das Wasser zu ändern. Wenn es jedoch trübe dreht, muß er ersetzt werden.
  2. Notieren Sie sich die Basisgewicht von männlichen Mäusen. Stellen Sie sicher, dass sie 8 bis 12 Wochen alt und in einem Bereich von 21 - 25 g Körpergewicht.
    Hinweis: Die entsprechende DSS Konzentration muss in jedem Labor optimiert werden. Die Ergebnisse können stark variieren, abhängig von den Haltungsbedingungen. Die Konzentrationen zwischen 2,5 bis 5% sind in der Regel berichtet starke c zu induzierenolitis in C57Bl / 6J WT - Mäusen 10. DSS aus verschiedenen Unternehmen und verschiedenen Chargen sollten getestet werden, da Ergebnisse auch mit anderen Quellen von DSS kann variieren.
  3. Geben Sie Wasser ad libitum und ersetzen Sie es mit frischem 3,5% DSS Wasser , wenn nötig.

2. Anwendung von Nahrungsergänzungsmitteln mit der Schlundsonde

  1. Bereiten Sie eine "zustellbaren" Lösung der gewünschten Nahrungsergänzungsmittel in einem geeigneten Lösungsmittel. Für diese Studie verwendeten wir eine Mischung, die 200 mg / kg L-Arginin, 83 mg / kg Vitamin C, 46 mg / kg Vitamin E, 77 mg / kg Eicosapentaensäure (EPA) und 115 mg / kg Docosahexaensäure (DHA ) in einem 1: 1-Lösung von Wasser und Safloröl.
  2. Füllen Sie eine 1-ml-Spritze mit einer Schlundsonde Nadel (15 G x 50 mm) mit dem Nahrungsergänzungsmittel-Gemisch. Wischen Sie die Außenseite der Sondennadel jede Verbindung außerhalb der Nadel zu entfernen und zu der richtigen Dosis Anwendung gewährleisten.
  3. Begrenze die Maus durch die Basis des Schwanzes Greifen miteinerseits und durch fest mit dem Daumen und Zeigefinger der anderen Hand eine Hautfalte an der Rückseite des Halses greift. Setzen Sie den Schwanz zwischen dem dritten Finger und der Basis des Daumen derselben Hand, die den Hals hält.
  4. Während die Maus in einer aufrechten Position zu halten, legen Sie die Nadel in die linke Seite des Mundes des Tieres und vorsichtig das Dach des Mundes folgen der Speiseröhre zu lokalisieren. Wenn kein Widerstand zu spüren ist, vorab die Nadel in Richtung Magen.
    HINWEIS: Stellen Sie sicher, dass das Tier atmet richtig, bevor Sie fortfahren.
  5. Verabreichen Sie die Mischung langsam, entfernen Sie das Rohr durch langsam die Spritze herausziehen, und die Maustaste loslassen. Nahrungsergänzungsmittel gelten einmal täglich per Schlundsonde während des Verlaufs des Experiments ulcerosa.

3. Bestimmung des Disease Activity Index

HINWEIS: Der Krankheitsaktivitätsindex ist die Kombination der Punkte für die Gewichtsabnahme, perianale Blutungen und Stuhlkonsistenz, die OBenthaltenen täglich 13.

  1. Messen Sie den Körpergewicht täglich und weisen einen Wert von 0 bis 4 nach dem Gewichtsverlust Prozentsatz (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20% und 4:> 20 %).
    HINWEIS: Gewichtsverlust wird durch Berechnung der Differenz in Prozent zwischen dem Basisgewicht vor der Induktion von DSS-Colitis und dem tatsächlichen Gewicht bestimmt.
  2. Um das Niveau der perianale Blutung zu bestimmen, eine frische Stuhlprobe zu sammeln und die mitgelieferten Applikatoren verwenden, um eine dünne Schicht auf einer Folie aus einem Guajak-Test auf okkultes Blut-Kit anzuwenden. Verwenden Sie einen neuen Applikator für jede Probe.
    1. Schließen Sie die Abdeckung auf der Vorderseite und öffnen Sie das Fenster auf der Rückseite der Folie. Zwei Tropfen der Entwicklerlösung am Probenort auf der Rückseite.
    2. Lesen Sie die Ergebnisse nach 30 s. Jede Spur von blauer Farbe ist positiv für okkultes Blut. Weisen Sie eine Punktzahl von 0 bis 4 (0: keine, 0,5 - 2,5: positive Guajak Test auf okkultes Blut (in Abhängigkeit von der Signalstärke) und 3 - 4: gross Blutungen).
      HINWEIS: Wenn Blut im Stuhl zu sehen ist, wird der Guajak-Test auf okkultes Blut nicht durchgeführt werden müssen, und eine Punktzahl von 3, 3,5 oder 4 zugeordnet ist, in Abhängigkeit von der Menge an sichtbarem Blut.
  3. Bestimmen Sie die Stuhlkonsistenz durch eine frische Stuhlprobe zu beobachten. Weisen Sie eine Punktzahl von 0 bis 4 (0: normal / Feststoff, 0,5 - 2,5: pastös Stuhl und 3 - 4: Durchfall).

4. Bestimmung Darmepithel Permeability in vivo durch Evans Blue Assay

  1. Anästhesieren die Tiere durch sie intraperitoneal mit einer Mischung aus Ketamin (100 mg / kg Körpergewicht) und Xylazin (13 mg / kg Körpergewicht), verdünnt in Kochsalzlösung (0,9% NaCl), und zu beurteilen, um die Tiefe der Anästhesie Injektion durch die Klemmüberwachungs Rückzug Reflex.
  2. Legen Sie die narkotisierten Tiere in Rückenlage und eine Laparotomie durchführen, um den Darm aus.
  3. Suchen Sie den Blinddarm und machen einen kleinen Schnitt im proximalen Segment des Dickdarms einscendens ( im Idealfall sofort auf den Blinddarm benachbarte).
  4. Legen Sie eine Zuführungsnadel (G22) und sichern Sie sie mit einer Ligatur ein gemeinsames Seidenfaden verwenden. Sorgfältig spülen reichlich PBS durch das Rohr aus dem Darm alle Kot auszuspülen. Instill Evans-Blau-Lösung (1,5% w / v in PBS) in den Dickdarm, bis er den Anus erreicht hat.
  5. Inkubieren Sie die Evans-Blau für 15 min. Waschen Sie den Farbstoff aus durch das Rohr mit reichlich PBS gespült, bis die perianale Auswaschen klar.
  6. Euthanize die Tiere durch Genickbruch.
  7. Excise den Darm und spülen Sie es wieder mit reichlich PBS. Spülen einmal mit 1 ml 6 mM N -acetylcysteine in PBS Jeder beliebige Farbstoff zu beseitigen zur colonic Schleim haftet.
  8. Schneiden Sie den Doppelpunkt in Längsrichtung und spülen Sie es noch einmal mit PBS und 1 ml 6 mM N -acetylcysteine.
  9. Das Gewicht und Länge. Zur Extraktion des Evans blauen Farbstoff, legen Sie den Doppelpunkt in 2 ml N, N - Dimethylformamid über Nacht bei Raumtemperatur unter leichtem Agitation. Messen der Farbstoffkonzentration spektrophotometrisch bei 610 nm.

5. Gewebeentnahme

  1. Anästhesieren die Tiere durch sie intraperitoneal mit einer Mischung aus Ketamin (100 mg / kg Körpergewicht) und Xylazin (13 mg / kg Körpergewicht), verdünnt in Kochsalzlösung (0,9% NaCl), und zu beurteilen, um die Tiefe der Anästhesie Injektion durch die Klemmüberwachungs Rückzug Reflex.
  2. Euthanize die Tiere durch Genickbruch.
  3. Legen Sie die Tiere in Rückenlage und eine Laparotomie durchführen, um die Bauchhöhle aus.
  4. Mit einer Schere zerschneiden den gesamten Dickdarm und notieren Sie die Länge.
  5. Spülen Sie den Doppelpunkt mehrmals vorsichtig mit gekühltem PBS den Kot zu entfernen. Notieren Sie sich die Gewebegewicht und die Vorbereitungen für die folgenden Versuche, wie in den Schritten von 5,6 bis 5,8.
  6. Für die RNA-Isolierung und Myeloperoxidase (MPO) Assays, geschnitten, um eine ausreichend große Gewebeprobe ab (100 mg ist in der Regel ausreichend), legen Sie sie in einem Rohr und snap-gefrieren sie in flüssigem Stickstoff. Lagern Sie die Gewebe bei -80 ° C für die zukünftige Verwendung.
  7. Für Immunfluoreszenzanfärbung und oxidativer Stress Bestimmung (siehe unten), schneiden Sie ein kleines Doppelpunkt Probe (0,5-1 cm) und es in kleinen Aluminiumbecher submerse mit optimalen Schnitttemperatur (OCT) Masse gefüllt. Legen Sie die Tassen auf Trockeneis und ließ sie langsam einfrieren, um eine Blasenbildung zu vermeiden. Gefrorenen Gewebeproben kann bei -80 ° C für die zukünftige Verwendung gespeichert werden.
  8. Für Swiss 14 rollt, öffnen Sie das in Längsrichtung Kolon und sorgfältig Kot mit einer Pinzette entfernen. Roll it up, mit der Schleimhaut nach innen gerichtet, mit feinen bestückte Zange oder einen dünnen, runden Holzstab. legen Sie sie vorsichtig innerhalb einer Einbettungskassette und fahren Sie mit Schritt 6.1.
    HINWEIS: DSS induziert Schäden im Dickdarm. Jedoch variiert Schadensverteilung von dem proximalen zu dem distalen Kolon, wobei die meisten Schäden meist im distalen Kolon und Rektum gesehen. Daher empfehlen wir die Analyse der Histologie entweder im distalen colauf oder in Schweizer Rollen des gesamten Dickdarms.

6. Analyse der Colon Histologie von Hämatoxylin-Eosin-Färbung

  1. Gewebepräparation
    1. Für die histologische Analyse, unterzutauchen entweder die Rouladen oder die kleinen Gewebestücke aus bestimmten Kolon Regionen der Kontrolle und der behandelten Mäuse in 5 ml 10% Formaldehyd für 48 Stunden bei Raumtemperatur (RT) korrekte Fixierung zu erreichen.
      HINWEIS: Alle weiteren Schritte in Schritt 6 werden bei RT durchgeführt, wenn nicht anders angegeben.
    2. Waschen Sie sie mit Leitungswasser für 18 Stunden.
    3. Dehydratisieren sie mit 15 ml 70% Ethanol für 1 h, 96% für 1 h und absolutem Ethanol für 1 h. Wiederholen Sie jeden Schritt mit frischem Alkohol, bevor zum nächsten Konzentration fortfahren.
    4. Weiterhin die Dehydratisierung in einem Gemisch von 7,5 ml absolutem Ethanol und 7,5 ml absolutem Xylol für 1 h. Einmal wiederholen, bevor die Proben zu 15 ml absolutem Xylol für 1 h übergeben. Wiederholen Sie diesen Schritt einmal mit frischem Xylol.
    5. Einbetten von Colon Gewebeproben in Paraffin
      1. Eintauchen der Proben in 50 ml flüssigem Paraffin für 17 h. Wiederholen Sie diesen Schritt nur einmal, sondern nur für 3 h.
      2. Tauchen Sie die Proben in Würfel (Kunststoff, quadratische Form, Größe: 22 x 22 x 22 mm) in 810 ml flüssigem Paraffin.
      3. Ermöglichen das Paraffin mit den Doppelpunkt Gewebeproben für 24 h bei RT zu verfestigen.
    6. Schneiden von Gewebe Querschnitte mit einem Mikrotom
      1. Schneiden Kolonproben ein Mikrotom verwendet, gemäß den Anweisungen des Herstellers bei einer Dicke von 5 um.
      2. Sammeln Sie die Schnitte in einem Wasserbad (1 l), die 0,3% Gelatine. Dies verhindert, dass die Faltung von Gewebequerschnitte. Gewinnen Sie die Gewebeschnitte und montieren sie auf Glasobjektträger.
    7. Hämatoxylin und Eosin - Färbung von Gewebequerschnitte
      1. Entparaffinieren die Proben für 18 h bei 60 ° C in einem Inkubator. Zu diesem Zweck verwenden, um ein Glas slide mit einem Griff Rack.
      2. Nach Entparaffinierung, für 5 min die Folien in 70 ml absolutem Xylol tauchen. Wiederholen Sie diesen Schritt einmal mit frischem Xylol.
      3. Übertragen Sie die Proben in 70 ml absolutem Alkohol für 1 min. Wiederholen Sie diesen Schritt einmal mit frischem Alkohol.
      4. Inkubieren der Kolon Gewebeproben in 70 ml Ethanol 96% für 1 min. Wiederholen Sie diesen Schritt einmal mit frischem Alkohol.
      5. Waschen Sie die Proben in Leitungswasser zweimal für 2 s.
      6. Inkubieren Sie die Gewebe in Harris Hämatoxylin für 7 min.
      7. Waschen Sie die Proben in Leitungswasser zweimal für 2 s.
      8. Inkubieren der Proben in saurem Alkohol (70 ml Ethanol 70% und 700 & mgr; l von 1 M Chlorwasserstoffsäure) für 7 s.
      9. Waschen Sie die Proben in Leitungswasser zweimal für 2 s.
      10. Inkubieren der Gewebeproben in 70 ml Lithiumcarbonat (1 g Lithiumcarbonat in 100 ml destilliertem Wasser) für 7 s.
      11. Waschen Sie die Proben in Leitungswasser zweimal für 2 s.
      12. Inkubieren der Proben in 70 ml Ethanol 80% Für 1 min.
      13. Übertragen Sie die Proben in 70 ml Eosin-Y für 15 s.
      14. Inkubieren sie in 70 ml 96% Ethanol für 1 min. Wiederholen Sie diesen Schritt einmal mit frischem Alkohol.
      15. Inkubieren Sie die Gewebeproben in 70 ml absolutem Ethanol (Ethylalkohol absolut wasserfrei) für 1 min. Wiederholen Sie diesen Schritt einmal mit frischem Alkohol.
      16. Inkubieren der Proben in 70 ml einer Mischung aus 35 ml absolutem Alkohol und 35 ml absolutem Xylol für 1 min.
      17. Übertragen Sie die Proben in 70 ml absolutem Xylol für 1 min. Wiederholen Sie diesen Schritt für 5 min in 70 ml frischem Xylol abs.
      18. In 80 & mgr; l aus Kunstharz auf die Kolon Gewebeproben, bedecken sie mit Deckgläsern, und lassen Sie sie für 24 h bei RT trocknen. Schließlich analysieren die Proben unter Verwendung von Hellfeldmikroskopie 8.

    7. Analyzing Junction Zusammensetzung von Immunofluoreszenz

    1. Bereiten Sie das Gewebe als 5,7 in Schritt beschrieben und geschnitten 8 um dicke Querschnitteunter Verwendung eines Kryostaten.
    2. Fix und Kolon Querschnitte mit 96% Ethanol bei -20 ° C für 20 min permeabilisiert.
      Hinweis: Alle nachfolgenden Inkubationen bei RT durchgeführt werden soll, wenn nicht anders in einer feuchten dunklen Kasten angegeben, Trocknen und Fluorochrom Verblassen zu verhindern.
    3. Air-trockene Proben und spülen Sie sie dann 3 mal für jeweils 5 min mit 1x PBS
    4. Inkubieren der Proben mit Blockierungslösung für 2 h (PBS 0,01% Tween und 2% BSA enthielt).
    5. Entfernen Sie die Blockierungslösung und spülen Sie ihn mit PBS-0,01% Tween 10 min.
    6. Während dieser Zeit, verdünne die primären Antikörper auf die gewünschten Konzentrationen in PBS-0,01% Tween.
    7. Entfernen Sie die Waschlösung, gelten die Antikörperlösung aus dem vorherigen Schritt, und Inkubation über Nacht bei 4 ° C in einem befeuchteten Box.
    8. Entfernen der Antikörperlösung und wäscht 3 mal mit PBS-0,01% Tween für jeweils 5 Minuten und einmal mit deionisiertem Wasser für 10 min, bei sehr vorsichtigem Rühren.
    9. Beim Waschen, Zentrifuge fluorochromeconjugated, artspezifischen Sekundärantikörper bei 14.000 xg für 20 min bei 4 ° C.
    10. Verdünnen Sie die sekundären Antikörper ohne Niederschläge, die vom Provider in PBS-0,01% Tween angegeben, gelten sie, und Inkubation für 1 h bei RT.
    11. Wiederholen Sie Schritt 7.8 und die Waschlösung zu entfernen so vollständig wie möglich.
    12. Pipette 4 ul Antiausbleichmittel über jede Probe auf der Folie.
    13. Decken Sie die Proben mit einem Deckglas.
    14. Luft trocknen lassen für 1 Stunde.
    15. Seal Schlitten mit Nagellack. Objektträger können bei -20 ° C bis zur weiteren Analyse gespeichert werden.
    16. Analysieren auf einem konfokalen Lasermikroskop 8.

    8. Bestimmung von oxidativem Stress durch Oxidation von Ethidium

    1. Nach 7 Tagen colitis DSS, bereiten Gewebe, wie in Schritt 5.7 und geschnitten colon Abschnitte in einem Kryostat in einer Dicke von 5 & mgr; m beschrieben. Berg Querschnitte auf Glasobjektträger mit Poly-L-Lysin-Lösung behandelt und die Proben unter with 5 uM Dihydroethidium (DHE) in Wasser bei 37 ° C für 30 min im Dunkeln.
    2. Waschen Sie die Proben mit PBS (pH 7,6), dreimal für jeweils 15 min unter leichtem Schütteln bei RT. Air die Proben trocknen und einen Tropfen Eindeckmedium hinzufügen, um die Fluoreszenz zu schützen. Beachten Sie die Fluoreszenz von oxidiertem Ethidium- auf einem Laser-Scanning-konfokalen Mikroskop (40-facher Vergrößerung, 568 nm Wellenlänge).

    9. Analyse von Leukozytenrekrutierung von MPO-Assay

    1. Nach 7 Tagen DSS Kolitis, Kolongewebe sammeln und die Proben homogenisieren (200-400 mg) mit 1 ml Hexadecyltrimethylammoniumbromid (HTAB) Puffer (0,5% HTAB in 50 mM Phosphatpuffer, pH 6,0) unter Verwendung eines Homogenisators auf Eis.
    2. Spülen Sie die Spitze des Homogenisator zweimal mit 1 ml HTAB Puffer alle Gewebe im Lysat enthalten und beschallen sie fünfmal bei 40% Amplitude für 10 s je. Frost-Tau in flüssigem Stickstoff dreimal.
    3. Zentrifuge bei 14.000 g für 15 min und sammeln den Überstand.Bereiten 2,2'-Azino-bis (3-ethylbenzothiazolin-6-sulfonsäure) (ABTS) -Lösung durch Mischen von ABTS, 5 ml Natriumcitrat (1 M in Wasser), 0,1 ml Wasserstoffperoxid und 45 ml bi -destilliertes Wasser.
    4. Mischungs 0,1 ml jeder Überstand mit 0,1 ml ABTS-Lösung in einer 96-Well-Flachbodenplatte. Nach 10 min messen die Absorption bei 460 nm mit einem Spektralphotometer.

    10. Die Bewertung der Expression von pro-inflammatorischen Zytokinen durch PCR

    1. Gewebehomogenisierung
      1. Homogenisieren 50 bis 100 mg von Dickgewebeproben in 1 ml eines sauren Guanidiniumthiocyanat-Phenol-Chloroform-Mischung, die ein Leistungs Homogenisator.
      2. Inkubieren für 15 min bei Raumtemperatur.
    2. phasen~~POS=TRUNC
      1. In 0,2 ml Chloroform und kräftig schütteln für 30 s.
      2. für 30 min bei 4 ° C inkubieren.
      3. Zentrifuge bei 12.000 xg für 60 min bei 4 ° C.
      4. Übertragen Sie die upper wässrige Phase in ein neues Röhrchen (~ 500 ul).
    3. RNA - Fällung und Resuspension
      1. Mit 0,5 ml Isopropylalkohol und inkubiere die Proben bei 4 ° C für 60 min.
      2. Zentrifuge bei 12.000 xg für 30 min bei 4 ° C.
      3. Entfernen Sie den Überstand vollständig.
      4. 1 ml Ethanol 75% und Wirbel.
      5. Zentrifuge bei 12.000 xg für 30 min bei 4 ° C.
      6. Entfernen Sie den Überstand.
      7. Lassen Sie die restlichen Ethanol an der Luft trocknen für 3-5 min.
        HINWEIS: Es ist wichtig, nicht das RNA-Pellet vollständig trocknen zu lassen, da dies stark die Löslichkeit abnimmt.
      8. Wieder aufzulösen, das Pellet in 0,3 ml Diethylpyrocarbonat (DEPC) -behandeltem Wasser. Unmittelbar transkribieren die RNA-Proben in cDNA (stabiler, siehe Schritt 10.5) oder bei -80 ° C.
    4. RNA - Quantifizierung
      1. Verdünne 1 & mgr; l RNA mit 99 & mgr; l DEPC-behandeltem Wasser.
      2. Lesen the OD bei 260 nm und 280 nm mit einer UV / VIS-Spektrophotometer unter Verwendung von Probenkonzentration und Reinheit zu bestimmen.
    5. cDNA - Synthese
      1. Mischungs RNA Proben (1-5 & mgr; g) mit 1 & mgr; l Oligo (dT) 12-18 (0,5 ug / ul) und DEPC-behandeltem Wasser (Gesamtvolumen von 12 & mgr; l) in RNase-freie sterile Tuben.
      2. für 10 min bei 70 ° C inkubieren.
      3. Fügen Sie 2 ul 10fach PCR - Puffer, 1 & mgr; l 50 mM MgCl 2, 1 & mgr; l 10 mM dNTP - Mix, und 2 ul 0,1 M Dithiothreit (DTT).
      4. Inkubieren bei 4 ° C für 5 min.
      5. 1 & mgr; l reverse Transkriptase und inkubieren bei 42 ° C für 5 min.
      6. für 15 min bei 70 ° C inkubieren.
      7. für 15 min bei 4 ° C inkubieren. cDNA kann bei -20 ° C bis zur weiteren Verwendung gelagert werden.
    6. PCR
      1. Mischungs 2,5 & mgr; l 10x PCR - Puffer, 1,5 ul 25 mM MgCl 2, 0,5 & mgr; l 10 mM dNTP Mix, 0,25 μL Taq-DNA-Polymerase, 0,25 & mgr; l von jedem Primer (10 uM) und cDNA (100 ng) und sterilem Wasser bis zu einem Gesamtvolumen von 25 & mgr; l.
      2. Führen Sie die Proben auf einem 96-Well-Thermocycler. Um zu verhindern, Amplifikation von genomischer DNA, Vorwärts- und Rückwärts-Primer sollten in verschiedenen Exons befinden: IL1β-FW: GCAACTGTTCCTGAACTCAACT und IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA und IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT und KC-RE: CCTGAGGGCAACACCTTCA; und Actin-FW: TATCCACCTTCCAGCAGATGT und Actin-RE: AGCTCAGTAACAGTCCGCCTA. Mit den folgenden PCR-Bedingungen: 95 ° C für 5 min, gefolgt von 30 Zyklen bei 95 ° C für 15 s, 58 ° C für 30 s und 72 ° C für 30 s, sowie eine abschließende Extension für 10 min bei 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Diät-Ergänzungen können von DSS Kolitis Schützen

Entzündungshemmende und anti-oxidative Nahrungsergänzungsmittel, wie Vitamin C, Vitamin E, die Stickstoffmonoxid (NO) -Quelle L-Arginin und ω3-mehrfach ungesättigte Fettsäuren (ω3-PUFAs), wurden mit unterschiedlichem Erfolg in der Tier verwendet Modelle Anzeichen von Entzündungskrankheiten 3,6,15 zu lindern. Malnutrition, oxidativer Stress, und die Produktion von pro-inflammatorischen Zytokinen können sowohl akute als auch chronische Kolitis 3 auslösen. In einer früheren Studie haben wir bewiesen , dass eine Kombination von Mikronährstoffen zeigte protektive Wirkung gegen DSS-induzierter Kolitis in vivo. Hier bieten wir detaillierte Protokolle, wie diese Effekte wurden 8 gemessen. Zunächst analysierten wir die Auswirkungen von Nahrungsergänzungsmitteln auf den Krankheitsverlauf durch die Krankheitsaktivitätsindex (DAI) zu bestimmen, die aus den drei Parametern der Gewichtsabnahme,Stuhlkonsistenz und perianale Blutung. Repräsentative Ergebnisse zeigten , dass DSS - Behandlung auf einen kontinuierlich steigenden DAI führte, wie erwartet, ein Maximum von 8,2 ± 0,46 an Tag sieben erreicht (1A). Entzündungshemmende Ernährung Ergänzung verzögert den Beginn der Colitis, aber zu späteren Zeitpunkten, wenn ulcerosa sehr stark war, war die Schutzwirkung marginal und nicht mehr statistisch signifikant, was darauf hindeutet, dass Nahrungsergänzungsmittel nur dann wirksam sind, wenn die Colitis noch nicht zu stark ist. Wichtig ist , könnte diätetische Intervention der DSS-induzierten Anstieg der intestinalen epithelialen Permeabilität zu verhindern, die ein wichtiges Merkmal von Colitis ist (1B). DSS Kolitis führte zu verringerten colon Längen und diese Verkürzung auch durch die anti-inflammatorische und anti-oxidative Nahrungsergänzungsmittel (1C) gelindert wurde. Somit kann in der Tat die klinischen Symptome von Colitis durch Änderungen in Diät-Zusammensetzung vermindert werden.

Um zu analysieren, warum Colitis war Progression weniger schwerwiegend in Tieren, die eine Ernährung zu ergänzen, wurde Gewebemorphologie nach Hämatoxylin / Eosin (H / E) Färbung von in Paraffin eingebetteten distalen Kolon Gewebe untersucht. Die Kontrollproben zeigten eine normale Morphologie (2A, oberes Feld), während mit 3,5% DSS behandelten Tiere typische Anzeichen von Colitis zeigte (dh Leukozyten - Infiltration, Ödembildung, Krypta Dysplasie und Ulzerationen; 2A, Mitte). Zu beachten ist , parallele Behandlung mit Nahrungsergänzung deutlich ulcerosa-induzierte morphologische Veränderungen gelindert, mit einer Gesamtmorphologie , die mehr vergleichbar mit der Kontrollgruppe (2A, Bodenplatte). Diese Beobachtungen waren sehr ähnlich, was gewesenberichtet für die Co-Behandlungen mit probiotischen Bakterien 13 und zeigen deutlich , dass Veränderungen in der Ernährung , die Entwicklung von Colitis entgegenwirken kann.

Wir wussten bereits, dass Colitis-induzierte Darmepithel-Permeabilität durch Nahrungsergänzung entgegengewirkt werden könnte. Erhöhte Durchlässigkeit ist ein Markenzeichen von IBD, und es ist zu einem großen Teil verursacht durch die Demontage der Adhärenzverbindungen (AJ) und Tight Junctions (TJ) zu stabilisieren. Destabilisierung der epithelialen Zellkontakte durch die Internalisierung von junctional Proteine wird durch proinflammatorische Zytokine induziert, die bei Colitis 16 reichlich produziert werden. Wir fanden, durch die Immunfluoreszenzfärbung des distalen Kolongewebe, dass die TJ-Molekül Zonula occludens-1 (ZO-1) und der AJ Molekül E-Cadherin bei der DSS-induzierte colitis internalisiert wurden, und dass die Co-Lokalisierung dieser Proteine ​​war teilweise verlorenen bei Krypta Epithelzelle Kontakte (2B). ichmportantly, Internalisierung von E-Cadherin und ZO-1 reduziert wurde , wenn DSS-behandelten Mäusen wurden gemeinsam behandelt mit einem entzündungshemmenden und anti-oxidative Nahrungsergänzungsmittel (2B). Insgesamt Krypta und Verbindungsstrukturen waren vergleichbar mit den Kontrollen, wenn die Nahrungsergänzungsmittel angewendet wurde, was darauf hindeutet, dass die beobachtete Schutzwirkung zumindest teil war aufgrund der Erhaltung der Gewebearchitektur.

Diätetische Intervention Entzündliche Counteract Neutrophilen Recruitment, oxidativer Stress und die Produktion von pro-inflammatorischen Zytokinen

Ein weiteres Markenzeichen von IBD ist eine unkontrollierte neutrophile Infiltration. Rekrutierten Neutrophile tragen zur Gewebeschädigung durch die Herstellung und Freisetzung reaktiver Sauerstoffspezies (ROS) und Proteasen 17. Mit einem MPO-Aktivitätstest fanden wir starke Neutrophilen-Rekrutierung im Darm als Reaktion auf DSS, der entgegengewirktdurch Nahrungsergänzung (3A).

Oxidativer Stress ist ein weiteres wichtiges Merkmal von Colitis, verursacht durch die Freisetzung von ROS von rekrutierten Neutrophile. Daher untersuchten wir die Erzeugung von ROS in colon Querschnitten. 3B zeigt , dass DSS Behandlung stark oxidativen Stress erhöht. Bemerkenswert ist , in der Ernährung Änderungen vollständig DSS-induzierten oxidativen Stress (3B) verhindert, was die meisten ist wahrscheinlich eine Folge der reduzierten neutrophilen Rekrutierung (3A).

Proinflammatorische Zytokine und Chemokine sind stark von verschiedenen Zelltypen während colitis 18 hergestellt. Solche Entzündungsmediatoren tragen zur neutrophilen Rekrutierung und Junction Protein Internalisierung-Funktionen, die wir durch Veränderungen in der Ernährung abgeschwächt werden bereits kannte, konnte. Analyse der mRNA-Expression durch RT-PCR zeigte, dass die DSSerhöht die Expression von IL1β, IL-6 und Keratinozyten stamm Chemokin (KC), wie erwartet (3C) und dass anti-inflammatory Diät - Ergänzung dieses DSS-induzierte Zunahme (3C) vermindert. Diese Daten implizieren, dass Nahrungsergänzungsmittel können in der Tat klinischen Anzeichen von IBD entgegenzuwirken dienen.

Abbildung 1
Abbildung 1. Nahrungsergänzung kann Disease Activity Index, Darmepithel Permeability Lindern und Colon Kürzen. (A) Der Krankheitsaktivitätsindex (DAI, Werte von 0 bis 12) besteht aus den drei Parametern von Gewichtsverlust, Stuhlkonsistenz und perianalen Blutungen und wurde täglich in den Versuchsgruppen der Kontrolle (ctrl), Colitis aufgezeichnet und Colitis + Nahrungsergänzungsmittel (Colitis + suppl.). Die Kontrollgruppe zeigte keine Anzeichen von Colitis, was zu einer DAI von 0 throughout die Versuchsdauer. n = 5 pro Gruppe. (B) Darmepithel - Durchlässigkeit wurde gemessen durch Evans Blau Leckage in den oben genannten experimentellen Gruppen und wurde als Absorption bei 620 nm pro g Gewebe ausgedrückt. n = 8 pro Gruppe. Alle Daten sind als Mittelwert ± Standardabweichung des Mittelwerts (SDM) gezeigt. * P <0,05; ** P <0.01; *** P <0,001. Statistiken wurden durch Einweg-ANOVA berechnet. (C) Repräsentative Bilder von ganzen Doppelpunkte der jeweiligen Versuchsgruppen nach 7 Tagen der Behandlung. Die Skala auf der linken Seite ist in cm. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Gewebemorphologie und Junction Architektur sind besser während ulcerosa Konservierte bei der Anwendung von Nahrungs Supplements. (A) 5 & mgr; m Paraffinquerschnitt von Gewebebiopsien von den distalen Doppelpunkte der jeweiligen Versuchsgruppen wurden mit Hämatoxylin / Eosin gefärbt und für typische Anzeichen für Colitis analysiert, wie Ödembildung (Pfeile), Leukozyten - Infiltration (Pfeilspitzen), und Ulzerationen (*). Insgesamt Gewebemorphologie der Colitis + suppl. Gruppe ähnelt mehr dem der Kontrolle als die Colitis Gruppe, eine Gesamtschutzwirkung gegen DSS Kolitis beweisen. Bilder sind repräsentativ für drei unabhängige Gewebezubereitungen pro Gruppe. Die Bilder wurden mit einem 10X-Objektiv genommen. Bar = 100 & mgr; m. (B) 8 um colon cryo Schnitte der jeweiligen Gruppen wurden gefärbt mit Antikörpern gegen ZO-1 (grün) und E-Cadherin (rot). Co-Lokalisation (gelb in den fusionierten Bildern; Pfeile) von E-Cadherin und ZO-1 in einer Krypta epithelialen Zell-Kontakte, die bei Colitis verloren ist, wird meist in der colitis + suppl erhalten. Gruppe. Bilder sind repräsentativ für 3unabhängige Gewebezubereitungen. Bar = 50 & mgr; m. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Neutrophile Recruitment, oxidativer Stress und die Produktion von pro-inflammatorischen Zytokinen kann durch Nahrungsergänzungsmittel reduziert werden. (A) Myeloperoxidase (MPO) -Aktivität wurde gemessen , um die Menge an Leukozyten - Rekrutierung in colon Gewebe in den Versuchsgruppen zu analysieren: Kontrolle (ctrl), Kolitis und Kolitis + Nahrungsergänzungsmittel (colitis + suppl.). n = 5 pro Gruppe; * P <0,05. Die Daten werden als Mittelwert ± SDM gezeigt. Statistiken wurden durch Einweg-ANOVA berechnet. (B) Die Fluoreszenz des Ethidium - oxidierte, in rot als Maß der oxidativen Stress dargestellt in 8 & mgr; m cryo Schnitte colon Gewebe wurde durch Laser-konfokale Mikroskopie aufgenommen. Bilder sind repräsentativ für drei unabhängige Gewebezubereitungen. Bar = 100 & mgr; m. (C) Die Herstellung der pro-inflammatorischen Zytokinen IL1β und IL-6 und das Chemokin KC durch semi-quantitative RT-PCR in einem 1,5% igen Agarosegel bestimmt wurde (schwarz und weiß wurden aus Gründen der Klarheit zurückgesetzt). β-Aktin diente als Housekeeping-Gen. Repräsentative Bilder von drei unabhängigen cDNA-Präparationen gezeigt. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Um Nahrungsergänzungsmittel in den klinischen Studien zu verwenden, müssen die Vorteile und die Sicherheit dieser Ergänzungen sorgfältig in tierexperimentellen Studien in vivo bewertet werden. Im Falle von Kolitis, mehrere geeignete Tiermodelle, die die klinischen Symptome von IBD ähneln wurden eingerichtet, einschließlich der chemischen Modellen DSS, TNBS oder Essigsäure; Knock-out (KO) Modelle wie IL10-KO; und immunzellvermittelte Kolitis Verwendung adoptive T-Zell - Transfer 19-21. Das DSS - Modell von ulcerosa ist eine schnelle und zuverlässige Methode der Colitis induzieren , die viele Krankheitssymptome menschlicher IBD ähnelt und hat in einer Vielzahl von Studien verwendet wurde 22 , die molekularen Mechanismen von ulcerosa zu untersuchen. Außerdem ist DSS Kolitis reversibel und ermöglicht somit auch für die Untersuchung von Gewebeheilung nach der colitogenic Stimulus wurde entfernt. Die zur Verfügung gestellten Protokoll beschreibt im Detail die DSS Colitis - Modell , das 8 in unserem Labor bereits optimiert wurde.

23 Krankheit Entwicklung und Progression beeinflussen. Zusätzlich müssen DSS 40 in einem Molekulargewichtsbereich - 50 kDa Kolitis zu induzieren. Für den unerfahrenen Forscher, wird es wichtig sein, ein Auge für eine objektive Beurteilung der DAI Parameter der Stuhlkonsistenz und perianale Blutung zu entwickeln. Wenn die Beurteilung durch eine unerfahrene Forscher durchgeführt wird, ist es empfehlenswert, ein Kollege die Beurteilung bestätigen zu haben, idealerweise in verblindet.

Um die Darm-Epithel-Permeabilität für Makromoleküle zu analysieren, drei Hauptverfahren wurden in der gesamten Literatur verwendet: der Evans-Blau-Farbstoff-Assay, wie hier beschrieben; das Einträufeln von 4-kDa FITC-Dextran in einer Darm-Schleife; und die Fütterung von 4-kDa-Dextran - FITC 13,24,25. Im letzteren Test wird FITC-Dextran mit der Schlundsonde gefüttertUnd die Menge von FITC-Dextran, die das Epithel und sickerte in den Blutstrom gekreuzt wird fluorometrisch von Serumproben gemessen. In diesem Assay wird die Durchlässigkeit des gesamten Magen-Darm-Trakt gemessen, da der Tracer von der Speiseröhre bis zum Rektum ganzen Weg verläuft und die meisten der Tracer vor dem Erreichen des Dickdarms passieren. In der Schleife Modell ist, die Permeabilität in einem geschlossenen Darmbereich gemessen für die Schleife verwendet ( in der Regel der Dünndarm) 25. Im Gegensatz dazu hat der Evans-Blau-Assay den Vorteil, dass nur epithelialen Permeabilität im Kolon gemessen wird, da der Indikator direkt in den gesamten Dickdarm instilliert wird. Somit diesen Test verwenden, können wir schließen, dass das Darmepithel durch die Ernährung zu ergänzen geschützt ist.

Es ist immer wichtig , um den Darm Gewicht und Länge nach der Extraktion und vor der Verwendung der Gewebe für andere Tests aufzuzeichnen, da einige Daten (zB Evans durchgesickert blau in der Permeabilität ASSAy) pro g Gewebe ausgedrückt. Darüber hinaus ist das Gewicht-zu-Länge - Verhältnis eine unabhängige Auslesung der Gewebeschädigung 26. Im allgemeinen wird Gewebemorphologie unter Verwendung von in Paraffin eingebettetem Gewebe, gefärbt mit Hämatoxylin und Eosin untersucht, wie hier beschrieben. Paraffineinbettung hat den Vorteil, dass die Gewebemorphologie ist viel besser konservierten Vergleich zu anderen Einbettungsverfahren. Dies ermöglicht die eindeutige Identifizierung verschiedener Zelltypen innerhalb der Schleimhaut (dh Immunzellen, Epithel, Becherzellen, etc.) und die Analyse von Gewebeveränderungen während Kolitis, wie Ödembildung, Leukozyteninfiltration und epithelialen apikalen Erosionen. Auf der anderen Seite hat den Nachteil, dass Paraffin Immunofluoreszenzfärbung erst nach zeitraubend Epitop Erholung durchgeführt werden. Deshalb bereiten wir immer verschiedene gefrorene Gewebebiopsien in OCT-Verbindung eingebettet. Solche Gewebeproben können einfach über einen Kryostaten und zeigen geringe Mengen an aut geschnittenFluoreszenz. Wir verwenden Ethanol zur Fixierung durch Austrocknung, weil es ist auch nicht mit Aktinfilamente stören (wie Methanol der Fall ist), noch Autofluoreszenz auslöst (wie PFA tut). Mit Hilfe dieser Techniken, fanden wir , dass ein entzündungshemmendes und antioxidativen Nahrungsergänzungsmittel können Gewebemorphologie und Verbindungsarchitektur bei Colitis verbessern (vergleiche Abbildung 2).

Übermäßige Rekrutierung von Neutrophilen ist ein kritisches Ereignis während ulcerosa , die durch die Produktion von Chemoattraktoren in Reaktion auf Entzündungs 17 induziert wird. Neutrophilen-Rekrutierung ist ein physiologisches Ereignis, weil Neutrophilen auf die Entfernung des Entzündungs ​​cue und anschließende Wundheilung beitragen. Wenn dies jedoch angeborene Immunantwort nicht richtig kontrolliert und beendet, Neutrophile in der Schleimhaut durch Lösen Proteasen und reaktive Sauerstoffspezies zu Gewebeschäden bei. Neutrophile enthalten MPO, die leicht gemessen und quantifiziert werden kann ein mitkolorimetrischen Test, wobei die Menge an MPO direkt mit der Anzahl von Neutrophilen proportional ist. 3A zeigt , dass neutrophile Rekrutierung steigt während ulcerosa und dass diätetische Intervention kann diese übermäßige und unkontrollierte Immunreaktion zu verhindern. In Übereinstimmung mit dem reichlich vorhandenen Neutrophilen Anwesenheit in der Schleimhaut erhöht oxidative Stress während Kolitis (3B).

Unsere Nahrungsergänzung schützt deutlich die Schleimhaut vor oxidativem Stress, der die meisten ist wahrscheinlich eine Folge der reduzierten neutrophilen Rekrutierung. Wie erwähnt, werden Neutrophile von Chemokinen und die Produktion von Chemokinen zogen wird durch proinflammatorische Zytokine induziert, die von verschiedenen Zelltypen während colitis sezerniert werden. So gingen wir davon aus, dass reduzierte neutrophilen Rekrutierung eine Folge der reduzierten Zytokin und Chemokin-Produktion ist. 3C zeigt , dass die pro-inflammatorische Zytokine IL-1β und IL-6, sowie dieChemokin KC, werden während der DSS-induzierten Colitis upregulated. Die Nahrungsergänzungsmittel umgekehrt die Höhe der IL-6 zurück Spiegel zu kontrollieren und verbessert die erhöhte Produktion von IL-1β und KC. Zu beachten ist, ist KC die wichtigste chemische Lockstoffe für Neutrophile bei Mäusen.

Somit ist es verlockend, zu spekulieren, dass die beobachtete Erhaltung der Gewebemorphologie reduzierte Neutrophilen-Infiltration zurückzuführen ist, der wiederum eine Folge der verringerten Produktion von KC. Analyse von RNA-Produktion in DSS-behandelten Gewebe mittels RT-PCR ist problematisch, wenn Rest DSS in der isolierten RNA ist. Dies liegt daran, DSS sowohl reversen Transkriptasen und Taq-Polymerasen hemmt. Wenn keine Verstärkung erreicht werden kann, wird es notwendig werden , um die RNA - Proben durch LiCl-vermittelte Präzipitation reinigen, wie an anderer Stelle beschrieben 27.

Zusammenfassend beschreiben wir im Detail verschiedene Methoden für die Analyse von Gewebeschäden während DSS Kolitis und wie dies dAmage kann durch Nahrungsergänzungsmittel gelindert werden. Die Erkenntnisse aus solchen Tierversuchen kann die Einrichtung von Patientengruppen rechtfertigen die protektive Wirkung der untersuchten Nahrungsergänzungsmittel in der menschlichen IBD zu untersuchen. Daten aus klinischen Studien ermittelt wurden, können dann öffnen neue Wege für das Management von IBD alternative Behandlungsstrategien zu entwickeln.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Diese Arbeit wurde durch Zuschüsse aus dem mexikanischen Rat für Wissenschaft und Technologie (CONACYT, 207268 und 233395 zu Michael Schnoor) unterstützt. KFCO ist ein Empfänger eines CONACYT Stipendiums (396.260) einen Master-Abschluss zu erhalten.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analyse wohltuende Wirkung von Nahrungsergänzungsmitteln auf Darmepithel Barrierefunktionen Während Experimental ulcerosa
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter