Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

ניתוח מועיל אפקטים של תוספי תזונה על פונקציות מעיים אפיתל מכשול במהלך ניסיוני קוליטיס

doi: 10.3791/55095 Published: January 5, 2017

Summary

טיפולים עכשוויים של מחלות מעי דלקתיות (IBD) מכוונים להקל תסמיני מחלה אך הוא עשוי לגרום לתופעות לוואי חמורות. לכן, אסטרטגיות חלופיות נחקרות במודלי קוליטיס חיה. הנה, נסביר כיצד את ההשפעות המיטיבות של תוספי תזונה על סימנים קליניים IBD מנותחים כגון מודל קוליטיס.

Abstract

מחלות מעי דלקתיות (IBD), כולל מחלת קרוהן וקוליטיס כיבית, הן הפרעות relapsing כרונית של המעיים. הם לגרום לבעיות חמורות, כגון התכווצויות בבטן, שלשול דמי, וירידה במשקל, בקרב אנשים מושפעים. למרבה הצער, אין תרופה עדיין, וטיפולים רק שואפים להקל על התסמינים. טיפולים שוטפים כוללים תרופות אנטי דלקתיות אימונוסופרסיבי שעשויות לגרום לתופעות לוואי חמורות. זה מצדיק את החיפוש אחר אפשרויות טיפול אלטרנטיביות, כגון תוספי תזונה, כי לא לגרום לתופעות לוואי. לפני היישום שלהם במחקרים קליניים, תרכובות כאלה חייבים להיבדק בקפדנות עבור יעילות וביטחון במודלים של בעלי חיים. דגם ניסיוני אמין הוא נתרן גופרתי dextran (DSS) מודל קוליטיס בעכברים, אשר מתרבה רבי הסימנים הקליניים של קוליטיס כיבתה בבני אדם. לאחרונה הוחל במודל זה כדי לבחון את ההשפעות המיטיבות של תוסף תזונה המכילויטמינים C ו- E, L-arginine, וחומצות שומן רב בלתי רווי-ω3 (PUFA). ניתחנו פרמטרים מחלה שונים ומצאו כי תוספת זו הצליח לשפר היווצרות בצקת, נזק לרקמות, חדירת לויקוציטים, עקה חמצונית, ואת הייצור של ציטוקינים פרו-דלקתיים, שמוביל שיפור כללי במדד פעילות המחלה. במאמר זה, נסביר בפירוט את היישום הנכון של תוספי תזונה באמצעות מודל קוליטיס DSS C57BL / 6 עכברים, כמו גם כיצד פרמטרים המחלה כגון היסטולוגיה, סטרס חמצוני, ודלקת מוערכים. ניתוח ההשפעות המיטיבות של תוספי תזונה שונים עשוי אז בסופו של דבר לפתוח אפיקים חדשים לפיתוח אסטרטגיות טיפול אלטרנטיביים כי להקל על תסמיני IBD ו / או כי להאריך את השלבים כפרה בלי לגרום לתופעות לוואי חמורות.

Introduction

קוליטיס היא מצב דלקתי של המעי הגס שיכול לגרום שלשולים וכאבי בטן. קוליטיס יכולה להיות חריפה, בתגובה לזיהום או ללחץ, או שזה יכול להתפתח מחלה כרונית, כגון קוליטיס כיבית (UC), השייכת לקבוצת מחלות מעי דלקתיות (IBD). למרות הסימנים הקליניים של UC תוארו היטב, בפתוגנזה עדיין לא ידוע ולא מובן 1. מקובל בין מומחי UC היא מחלה מולטיפקטוריאלית, עם מוטציות גנטיות ותגובות חיסון סוטות משחקת תפקיד מרכזי 2. עם זאת, גורמים סביבתיים, כגון סגנון החיים והתזונה, גם לתרום להתפתחות המחלה והתקדמות 3.

למרבה הצער, IBD אינה ניתנת לריפוי, אך ישנן אפשרויות טיפול רבות שמטרתן להקל על סימפטומים קליניים. טיפולים שוטפים כוללים תרופות אנטי דלקתיות, כגון sulfasalazine ו סטרואידים; כשמה כן היא, כמו azathioפריין; נוגדנים חד שבטיים כי ציטוקינים פרו-דלקתיים ללכוד, כגון-α tumor necrosis factor (TNF-α), או מולקולות הדבקה לחסום, כגון integrins, להפחית גיוס לויקוציטים מוגזם; ומעכבים כי למקד קינאזות המפעילות מסלולים פרו-דלקתיים, כגון קינאז יאנוס (JAK) 4. לא כל המטופלים מגיבים לכל הטיפולים, כך אסטרטגיות טיפוליות חייבות להיות אינדיבידואלי 5. יתר על כן, רוב התרופות טיפוליות אלו להפריע במטבוליזם תגובות חיסוניות, לעתים קרובות גורמים לתופעות לוואי חמורות. מסיבה זו, נחקרו אפשרויות טיפול אלטרנטיביות.

טיפולים אלטרנטיביים לכלול פרוביוטיקה ותוספי תזונה, אשר הוחלו במודלים של בעלי חיים וניסויים קליניים עם רמות שונות של הצלחה 6,7. מצאנו לאחרונה כי היישום של תוספי תזונה יחידים שונים, כגון ויטמינים אנטי-חמצונים או ω3-רב בלתי רוויות וחומצות שומן (PUFAs), הוא נחות היישום של שילוב של תוספים כאלה בהקלת קוליטיס הסימפטומים למחלה קרדיווסקולרית 8,9. מחקרים אלו בוצעו בעכברים, כך מחקרים קליניים חייבות להתבצע בבני אדם כדי לקבוע האם ממצאים אלו יחולו גם על בני אדם. לפני מחקרים קליניים מבוצעים, את היעילות והבטיחות של אפשרויות טיפול חדשות יש לבחון אותה במודלים של בעלי חיים.

עבור IBD, נתרן גופרתי dextran (DSS) מודל כבר בשימוש נרחב כדי לחקור את המנגנונים של התפתחות המחלה ואת ההשפעות החיוביות של תרופות ותוספי תזונה 6,10. במרבית המחקרים, רק מחלה חריפה על פני פרק זמן של שבעה ימים מושרים; בכל זאת, הסימנים הקליניים בניסויים בבעלי חיים אלה דומים לאלה שנצפו בחולים במחלות מעי דלקתיות (כלומר, שלשול דמי, ירידה במשקל, חוסר תפקוד אפיתל, וחדירה תא החיסון) 10. DSS גורם ארוזיות הרירית,וכתוצאה מכך תפקוד מחסום בחדירות אפיתל במעי מוגבר 11. המנגנון המדויק אינו ידוע. עם זאת, מחקר חדש כי DSS אינטראקציה עם שרשרת חומצות שומן באורך בינוני כדי ליצור ננו-lipocomplexes כי הם מסוגלים להיכנס לתאי האפיתל וכדי לגרום אותות דלקתיים מסלולי 12. במאמר זה נתאר בפירוט כיצד קוליטיס מושרה ונותח בעכברים, איך תזונתי תוספים מוחל על ידי gavage כדי להבטיח מינון קבוע כל חיה, ואיך את ההשפעות של תוספים כאלה על סימפטומים קוליטיס שונים נבחנות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל הניסויים בבעלי החיים אושרו על ידי ועדת הטיפול בבעלי החיים המוסדיים שימוש Cinvestav.

1. הכנת מי שתייה DSS ואת אינדוקציה של קוליטיס

  1. הכן נתרן גופרתי 3.5% w / v dextran פתרון (DSS) במי השתייה autoclaved. DSS מתמוסס בקלות וזה אינו נדרש לסנן את הפתרון הסופי.
    הערה: 7 ימי טיפול DSS גורמים קוליטיס חמור. אם גרימת קוליטיס קלה, 3 - 4 ימים של טיפול מומלץ. כל עוד מי השתייה DSS נשאר ברור, זה לא הכרחי כדי להחליף את המים. עם זאת, אם יתברר עכורים, יש להחליפו.
  2. רשום את המשקל הבסיס של עכברים זכרים. ודא כי הם 8 - 12 שבועות של גיל בטווח של 21 - משקל גוף 25 גרם.
    הערה: ריכוז DSS המתאים חייב להיות מותאם בכל מעבדה. תוצאות יכולות להשתנות במידה רבה, בהתאם לתנאי הדיור. ריכוזים בין 2.5 - 5% בדרך כלל מדווחים להשרות ג חזקolitis ב C57Bl / 6J WT עכברים 10. DSS מחברות שונות והרבה שונים צריכה להיבדק, כמו תוצאות עשויות להשתנות גם עם מקורות שונים של DSS.
  3. ספק כרצונך מים ולהחליף אותו עם מי DSS 3.5% טריים במידת צורך.

2. יישום של תוספי תזונה על ידי Gavage

  1. כן פתרון "feedable" של תוספי תזונה הרצוי כממס מתאים. במחקר זה, השתמשנו תערובת המכילה 200 מ"ג / ק"ג L-arginine, 83 מ"ג / ויטמין C ק"ג, 46 מ"ג / ויטמין E ק"ג, 77 ​​מ"ג / ק"ג חומצה eicosapentaenoic (EPA), ו -115 מ"ג / ק"ג חומצה docosahexaenoic (DHA ) ביחס של 1: 1 פתרון של מים ושמן חריע.
  2. ממלאים מזרק 1 מ"ל מחובר מחט gavage (15 G x 50 מ"מ) עם תערובת תוסף תזונה. נגב את החלק החיצוני של מחט gavage כדי להסיר כל מתחם החיצוני של המחט על מנת להבטיח יישום מינון נכון.
  3. לרסן את העכבר ידי אחיזה בבסיס הזנב עםמחד גיסא ועל ידי לפת את ידו בתקיפות קפל עור בחלק האחורי של הצוואר עם האגודל והאצבע של היד השנייה. מניח את הזנב בין האצבע השלישית ואת בסיס האגודל של אותה היד שמחזיקה את הצוואר.
  4. תוך שמירה על העכבר בתנוחה זקופה, הכנס את המחט לתוך הצד השמאלי של הפה של החיה ובזהירות אחרי הגג של הפה כדי לאתר את הוושט. אם אין התנגדות הוא נתקל, לקדם את המחט לכיוון הבטן.
    הערה: ודא כי בעל החיים הוא נושם כמו שצריך לפני שאתה ממשיך.
  5. נהל את התערובת לאט, להסיר את הצינור על ידי תלישת המזרק לאט, שחרר את העכבר. החל תוספי תזונה פעם ביום על ידי gavage במהלך הניסוי קוליטיס.

3. קביעת מדד פעילות המחלה

הערה: מדד פעילות המחלה הוא שילוב של עשרות לירידה במשקל, דימום פריאנליות, צואה עקביות, שהן obמזרקה יומית 13.

  1. מדדו את משקל היומי ולהקצות ציון של 0 עד 4 בהתאם לשיעור הרזיה (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, ו -4:> 20 %).
    הערה: הפסד Bodyweight נקבע על ידי חישוב ההפרש באחוזים בין המשקל הבסיסי לפני אינדוקציה של קוליטיס DSS ואת המשקל בפועל.
  2. כדי לקבוע את רמת דימום פריאנליות, לאסוף דגימת צואה טרייה ולהשתמש אפליקטורים הניתנים להחיל למרוח דק בשקופית מתוך ערכת בדיקת דם guaiac סמויה. השתמש מוליך טרי עבור כל דגימה.
    1. סגור את המכסה על חלקו הקדמי לפתוח את החלון בצד האחורי של השקופית. החל שתי טיפות של הפתרון מפתח לחלק האחורי במיקום המדגם.
    2. קראו את התוצאות לאחר 30 שניות. כל עקבות של צבע הכחול הן חיוביות עבור דם סמוי. הקצאת ציון של 0 עד 4 (0: כלום, 0.5 - 2.5: בדיקת דם סמוי בצואה guaiac חיובית (תלוי את עוצמת האות), ו -3 - 4: Groדימום ss).
      הערה: אם דם בצואה גלוי, המבחן guaiac סמוי דם לא צריך להתבצע, ציון של 3, 3.5, או 4 מוקצה, בהתאם לכמות של דם גלוי.
  3. לקבוע עקביות צואה על ידי התבוננות דגימת צואה טרייה. הקצאת ציון של 0 עד 4 (0: רגיל / מוצק, 0.5 - 2.5: שרפרף בצק, ו -3 - 4: שלשול).

4. קביעת חדירות אפיתל במעי in vivo על ידי Assay הכחול אוונס

  1. להרדים את בעלי החיים באמצעות הזרקת אותם intraperitoneally בתערובת של קטמין (100 מ"ג / ק"ג של משקל גוף) ו xylazine (13 מ"ג / ק"ג של משקל גוף) מדולל תמיסת מלח (0.9% NaCl), ולהעריך את עומק ההרדמה על ידי ניטור קמצוץ רפלקס הנסיגה.
  2. מניח את החיות הרדימו בעמדת פרקדן ולבצע פיום בטן לחשוף את המעיים.
  3. אתר את cecum ולעשות חתך קטן במגזר הפרוקסימלי של הנקודותscendens (אידיאלי, סמוך ביותר cecum).
  4. הכנס מחט האכלה (G22) לאבטח אותו עם ליגטורה באמצעות חוט משי משותף. בזהירות סומקת בשפע PBS דרך הצינור כדי לשטוף החוצה את הצואה מהמעי. להנחיל פתרון אוונס כחול (1.5% w / v ב PBS) לתוך המעי הגס עד שהוא מגיע אל פי הטבעת.
  5. דגירת אוונס הכחול במשך 15 דקות. יש לשטוף היטב את הצבע על ידי שטיפה בצינור עם PBS בשפע עד כשלון פריאנליות ברור.
  6. להרדים את בעלי החיים באמצעות פריקה צוואר הרחם.
  7. ובלו המעי הגס ולשטוף אותו שוב עם PBS בשפע. יש לשטוף מיד עם 1 מ"ל של 6 מ"מ N -acetylcysteine ב PBS לחסל כל צבע דבק ריר הגס.
  8. חותכים את המעי הגס longitudinally ולשטוף אותו שוב עם PBS 1 מ"ל של 6 מ"מ N -acetylcysteine.
  9. רשום את המשקל ואורך. כדי לחלץ את הצבע הכחול אוונס, למקם את המעי הגס ב 2 מ"ל של N, N -dimethylformamide הלילה בטמפרטורת החדר עם agitatio עדיןn. למדוד את ריכוז לצבוע spectrophotometrically ב 610 ננומטר.

אוסף רקמות 5.

  1. להרדים את בעלי החיים באמצעות הזרקת אותם intraperitoneally בתערובת של קטמין (100 מ"ג / ק"ג של משקל גוף) ו xylazine (13 מ"ג / ק"ג של משקל גוף) מדולל תמיסת מלח (0.9% NaCl), ולהעריך את עומק ההרדמה על ידי ניטור קמצוץ רפלקס הנסיגה.
  2. להרדים את בעלי החיים באמצעות פריקה צוואר הרחם.
  3. מניחים את החיות במצב שכיבה ולבצע פיום בטן כדי לחשוף את חלל הבטן.
  4. בעזרת מספריים, לנתח את המעי הגס כולו ולהקליט אורכו.
  5. שטוף את המעי הגס בזהירות כמה פעמים עם PBS קר כדי להסיר את הצואה. רשום את משקל הרקמות להתכונן בניסויים הבאים, כמתואר בשלבי 5.6 - 5.8.
  6. עבור בידוד RNA ו myeloperoxidase (MPO) מבחנים, מנותקי מדגם רקמות בגודל מתאים (100 מ"ג בדרך כלל מספיק), ומניח אותו בתוך צינור, SNAp-להקפיא אותו בחנקן נוזלי. אחסן את הרקמות ב -80 ° C לשימוש עתידי.
  7. עבור מכתים immunofluorescence ונחישות סטרס החמצונים (ראה להלן), לחתוך מדגם מעי גס קטן (0.5 - 1 סנטימטר) ו submerse זה בכוסות אלומיניום קטנות מלאות מתחם טמפרטורת חיתוך אופטימלי (אוקטובר). מניחים את הספלים על קרח יבש ולתת להם להקפיא לאט, כדי למנוע היווצרות בועה. ניתן לאחסן דגימות רקמה קפואות ב -80 ° C לשימוש עתידי.
  8. עבור השוויצרי מגלגל 14, לפתוח את המעי הגס longitudinally ובזהירות להסיר צואת באמצעות מלקחיים. מרדדים אותו, עם רירית מול פנימה, באמצעות מלקחיים קנס שקצהו או מקל עץ דק, עגול. בזהירות למקם אותה בתוך קלטת הטבעה ולהמשיך עם צעד 6.1.
    הערה: DSS גורם נזק במעי הגס. עם זאת, חלוקת הנזק משתנה מן הפרוקסימלי מעי גס דיסטלי, עם רוב הנזק בדרך כלל לראות את המעי הגס והרקטום דיסטלי. לפיכך, אנו ממליצים לנתח את היסטולוגיה בין אם col דיסטליאו בתפקידים שויצריים של המעי הגס כולו.

6. ניתוח של היסטולוגיה קולון ידי מכתים Hematoxylin-eosin

  1. הכנת הרקמה
    1. לניתוח היסטולוגית, לצלול או לחמניות השויצריות או חתיכות רקמה הקטנות מאזורי מעי גסים מסוימים של שליטה ואת העכברים שטופלו ב 5 מיליליטר של פורמלדהיד 10% במשך 48 שעות בטמפרטורת חדר (RT) כדי להשיג קיבעון הולם.
      הערה: כל צעדים נוספים בשלב 6 מתבצעות ב RT, אלא אם צוין אחרת.
    2. לשטוף אותם במי ברז במשך 18 שעות.
    3. מייבשים אותם עם 15 מ"ל של אתנול 70% במשך שעה 1, 96% עבור H 1, ואתנול מוחלט במשך 1 שעה. חזור על כל שלב עם אלכוהול טרי לפני שתמשיך הריכוז הבא.
    4. המשך התייבשות בתערובת של 7.5 מ"ל של אתנול אבסולוטי ו -7.5 מ"ל של קסילן מוחלט במשך 1 שעה. חזור פעם אחת לפני שהיא עוברת את הדגימות 15 מיליליטר של קסילן המוחלט במשך 1 שעה. חזור על פעולה זו פעם עם קסילן טרי.
    5. Embedding דגימות רקמה קולון ב פרפין
      1. לטבול את דגימות ב 50 מ"ל של פרפין נוזלי במשך 17 שעות. חזור על פעולה זו פעם אבל רק 3 שעות.
      2. לטבול את דגימות קוביות (פלסטיק, עובש מרובע, גודל: 22 x 22 x 22 מ"מ) ב 810 מ"ל של פרפין נוזלי.
      3. אפשר פרפין עם דגימות רקמה המעי הגס כדי לחזק למשך 24 שעות ב RT.
    6. חיתוך רקמות בחתכים באמצעות microtome
      1. חותכים דגימות המעי הגס באמצעות microtome, על פי הוראות היצרן, בעובי של 5 מיקרומטר.
      2. אסוף הקיצוצים באמבט מים (1 ליטר) המכילים ג'לטין 0.3%. הדבר מונע את קיפול סעיפים נגדי רקמות. לשחזר את סעיפי הרקמות לעגן אותן על שקופיות זכוכית.
    7. Hematoxylin ו Eosin הכתמה של חתכי רקמות
      1. Deparaffinize דגימות במשך 18 שעות ב 60 ° C באינקובטור. לשם כך, השתמש כוס שלLIDE מתל עם ידית.
      2. לאחר deparaffinization, לטבול את השקופיות 70 מ"ל של קסילן מוחלט למשך 5 דקות. חזור על פעולה זו פעם עם קסילן טרי.
      3. העברת דגימות לתוך 70 מ"ל של אלכוהול מוחלט דקות 1. חזור על פעולה זו פעם עם אלכוהול טרי.
      4. דגירה דגימות רקמה המעי הגס ב 70 מ"ל של 96% אתנול דקות 1. חזור על פעולה זו פעם עם אלכוהול טרי.
      5. שטוף את הדגימות במים ברז פעמים עבור 2 s.
      6. דגירת רקמות hematoxylin האריס במשך 7 דקות.
      7. שטוף את הדגימות במים ברז פעמים עבור 2 s.
      8. דגירה דגימות אלכוהול חומצי (70 מ"ל של 70% אתנול ו 700 μL של 1 M חומצה הידרוכלורית) עבור 7 ים.
      9. שטוף את הדגימות במים ברז פעמים עבור 2 s.
      10. דגירה דגימות רקמה 70 מ"ל של ליתיום קרבונט (1 גרם של ליתיום קרבונט ב 100 מ"ל מים distillated) עבור 7 ים.
      11. שטוף את הדגימות במים ברז פעמים עבור 2 s.
      12. דגירה דגימות ב 70 מ"ל של אתנול 80% 1 דקות.
      13. העברת דגימות לתוך 70 מ"ל של Eosin-Y עבור 15 שניות.
      14. דגירה אותם 70 מ"ל של אתנול 96% דקות 1. חזור על פעולה זו פעם עם אלכוהול טרי.
      15. דגירת דגימות רקמת 70 מיליליטר של אתנול אבסולוטי (נטול מים מוחלטים כוהל אתילי) 1 דקות. חזור על פעולה זו פעם עם אלכוהול טרי.
      16. דגירה דגימות ב 70 מ"ל של תערובת של 35 מ"ל של אלכוהול מוחלט ו -35 מ"ל של קסילן מוחלט דקות 1.
      17. העברת דגימות לתוך 70 מ"ל של קסילן מוחלט דקות 1. חזור על פעולה זו במשך 5 דקות ב 70 מיליליטר של קסילן המוחלט הטרי.
      18. הוסף 80 μL של שרף סינתטי על דגימות רקמות המעי הגס, לכסות אותם עם coverslips, ולתת להם להתייבש במשך 24 שעות ב RT. לבסוף, לנתח את הדגימות באמצעות מיקרוסקופ שדה בהיר 8.

    7. הרכב צומת ניתוח על ידי Immunofluorescence

    1. מכינים את הרקמה כפי שמתואר בשלב 5.7 וחותכים 8 מיקרומטר בעובי בחתכיםבאמצעות cryostat.
    2. תיקון ו permeabilize בחתכי מעי גס עם אתנול 96% ב -20 ° C במשך 20 דקות.
      הערה: כל incubations הבא צריכה להתבצע ב RT, אלא אם כן צוין אחרת, בתוך קופסא כהה ולחה למנוע ייבוש fluorochrome דהייה.
    3. אוויר יבש דגימות, ולאחר מכן לשטוף אותם 3 פעמים במשך 5 דקות כל אחד עם 1x PBS
    4. דגירה דגימות עם פתרון חסימה (PBS המכיל Tween 0.01% ו BSA 2%) עבור 2 שעות.
    5. הסר את פתרון החסימה ולשטוף אותו עם PBS-0.01% Tween במשך 10 דקות.
    6. במהלך תקופה זו, לדלל את הנוגדנים הראשוניים הריכוזים הרצויים Tween% PBS-0.01.
    7. הסר את פתרון הכביסה, ליישם את פתרון הנוגדן מהשלב הקודם, דגירת הלילה ב 4 ° C בקופסא humidified.
    8. הסר את פתרון הנוגדן ולשטוף 3 פעמים עם PBS-0.01% Tween במשך 5 דקות כל אחד ופעם עם מים ללא יונים במשך 10 דקות, עם תסיסה עדינה מאוד.
    9. בעוד כביסה, פלואוריד צנטריפוגותochromeconjugated, מינים ספציפיים נוגדנים משני 14,000 XG במשך 20 דקות ב 4 ° C.
    10. לדלל את הנוגדנים משני ללא משקעים כפי שצוין על ידי הספק ב Tween PBS-0.01%, ליישם אותם, דגירה של 1 ש 'ב RT.
    11. חזור על שלב 7.8 ולהסיר פתרון הכביסה שלמה ככל האפשר.
    12. פיפטה 4 μL של נגד דהיית סוכנים לידי מדגם בשקופית.
    13. מכסה את הדגימות עם coverslip.
    14. אוויר יבש במשך 1 שעה.
    15. שקופית חותם עם לק. ניתן לאחסן שקופיות ב -20 ° C עד לניתוח נוסף.
    16. לנתח על מיקרוסקופ לייזר confocal 8.

    8. קביעת סטרס חמצוני על ידי חמצון של Ethidium

    1. לאחר 7 ימים של קוליטיס DSS, להכין רקמות כמתואר בשלב 5.7 וחותכים סעיפים במעי הגס בתוך cryostat בעובי של 5 מיקרומטר. בחתכי הר על גבי שקופיות זכוכית שטופלו פתרון פולי- L- ליזין דגירת שנינות הדגימותh 5 מיקרומטר של dihydroethidium (DHE) במים ב 37 מעלות צלזיוס למשך 30 דקות בחושך.
    2. שטוף את הדגימות עם PBS (pH 7.6) שלוש פעמים במשך 15 דקות כל אחד עם תסיסה עדינה ב RT. האוויר יבש הדגימות ולהוסיף טיפה של הרכבה בינונית להגן על הקרינה. שים את הקרינה של ethidium חמצון על מיקרוסקופ confocal לייזר סורק (בהגדלה 40X, 568 ננומטר אורך גל).

    9. ניתוח של גיוס ליקוציט ידי assay MPO

    1. לאחר 7 ימים של קוליטיס DSS, לאסוף רקמות המעי הגס homogenize דגימות (200 - 400 מ"ג) עם 1 מ"ל של hexadecyltrimethylammonium (HTAB) חיץ (0.5% HTAB ב 50 מ"מ חיץ פוספט, pH 6.0) באמצעות homogenizer על הקרח.
    2. יש לשטוף את קצה homogenizer פעמיים עם 1 מ"ל של חיץ HTAB לכלול את כל הרקמות lysate ו sonicate זה חמש פעמים ב משרעת 40% למשך 10 שניות כל אחד. להקפיא להפשיר בחנקן נוזל שלוש פעמים.
    3. צנטריפוגה ב 14,000 XG במשך 15 דקות לאסוף את supernatant.הכן 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic חומצה) (ABTS) פתרון על ידי ערבוב ABTS, 5 מ"ל של נתרן ציטרט (1 M במים), 0.1 מ"ל של מי חמצן, ו -45 מ"ל של דו -מים מזוקקים.
    4. מערבבים 0.1 מ"ל של כל supernatant עם 0.1 מ"ל של ABTS פתרון בצלחת 96-היטב עם תחתית שטוחה. לאחר 10 דקות, למדוד את הספיגה ב 460 ננומטר באמצעות ספקטרופוטומטר.

    10. הערכת הביטוי של ציטוקינים פרו-דלקתיים על ידי PCR

    1. המגון רקמות
      1. Homogenize 50 עד 100 מ"ג של דגימות רקמה המעי הגס ב 1 מ"ל של תערובת guanidinium חומצה thiocyanate-פנול, כלורופורם באמצעות homogenizer כוח.
      2. דגירה בטמפרטורת החדר למשך 15 דקות.
    2. הפרדת פאזות
      1. להוסיף 0.2 מ"ל של כלורופורם לנער במרץ למשך 30 שניות.
      2. דגירה על 4 מעלות צלזיוס למשך 30 דקות.
      3. צנטריפוגה XG ב 12,000 במשך 60 דקות ב 4 °.
      4. מעבירים את uשלב מימי pper לתוך צינור טרי (~ 500 μL).
    3. RNA משקעים Resuspension
      1. הוסף 0.5 מ"ל של אלכוהול איזופרופיל דגירה דגימות ב 4 מעלות צלזיוס במשך 60 דקות.
      2. צנטריפוגה XG ב 12,000 במשך 30 דקות ב 4 °.
      3. הסר את supernatant לחלוטין.
      4. הוסף 1 מ"ל של אתנול 75% ו מערבולת.
      5. צנטריפוגה XG ב 12,000 במשך 30 דקות ב 4 °.
      6. הסר את supernatant.
      7. אפשר אתנול הנותר לאוויר יבש במשך 3-5 דקות.
        הערה: חשוב לא לתת גלולת RNA להתייבש לחלוטין, כמו זה יהיה להקטין את מסיסותו מאוד.
      8. Re-לפזר את הגלולה ב 0.3 מיליליטר של diethylpyrocarbonate (DEPC) מי -treated. מיד לתמלל את דגימות רנ"א לתוך cDNA (יותר יציבה, ראה שלב 10.5) או בחנות ב -80 ° C.
    4. כימות RNA
      1. לדלל 1 μL של RNA עם 99 μL של מים DEPC שטופלו.
      2. קרא הOD דואר ב 260 ננומטר ו -280 ננומטר באמצעות UV / VIS ספקטרופוטומטר כדי לקבוע ריכוז וטוהר המדגם.
    5. סינתזת cDNA
      1. מערבב דגימות רנ"א (1-5 מיקרוגרם) עם 1 μL של אוליגו (DT) 12-18 (0.5 מיקרוגרם / μL) ומי DEPC שטופלו (נפח כולל של 12 μL) צינורות סטרילי RNase חינם.
      2. לדגור על 70 מעלות צלזיוס למשך 10 דקות.
      3. הוסף 2 μL של 10x הצפת PCR, 1 μL של 50 מ"מ MgCl 2, 1 μL של 10 תמהיל מ"מ dNTP, ו -2 μL של 0.1 M dithiothreitol (DTT).
      4. דגירה על 4 מעלות צלזיוס למשך 5 דקות.
      5. הוסף 1 μL של transcriptase הפוכה ו לדגור על 42 מעלות צלזיוס למשך 5 דקות.
      6. לדגור על 70 מעלות צלזיוס למשך 15 דקות.
      7. דגירה על 4 מעלות צלזיוס למשך 15 דקות. cDNA יכול להיות מאוחסן ב -20 ° C עד לשימוש נוסף.
    6. PCR
      1. מערבבים 2.5 μL של 10x הצפת PCR, 1.5 μL של 25 מ"מ MgCl 2, 0.5 μL של 10 מ"מ dNTP לערבב, 0.25 μL של פולימראז תקי DNA, 0.25 μL של כל צבע יסוד (10 מיקרומטר) cDNA (100 ng), מים סטריליים כדי בהיקף כולל של 25 μL.
      2. הפעל את הדגימות על Cycler תרמית 96-היטב. כדי למנוע הגברה של הדנ"א הגנומי, קדימה לאחור פריימרים צריך להיות ממוקם אקסונים שונים: IL1β-FW: GCAACTGTTCCTGAACTCAACT ו IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA ו IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT ו KC-RE: CCTGAGGGCAACACCTTCA; ו אקטין-FW: TATCCACCTTCCAGCAGATGT ו אקטין-RE: AGCTCAGTAACAGTCCGCCTA. השתמש תנאי PCR הבאות: 95 מעלות צלזיוס למשך 5 דקות ואחריו 30 מחזורים ב 95 מעלות צלזיוס למשך 15 שניות, 58 ° C למשך 30 שניות, ו -72 מעלות צלזיוס למשך 30 שניות, בתוספת סיומת סופית במשך 10 דקות ב 72 מעלות צלזיוס .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

תוספי תזונה יכול להגן מפני DSS קוליטיס

ואנטי דלקתי תוספי תזונה אנטי חמצונית, כגון ויטמין C, ויטמין E, תחמוצת החנקן (NO) -source L-arginine, וחומצות שומן רב בלתי רווי-ω3 (ω3-PUFAs), שימשו בהצלחה משתנה חיה מודלים כדי להקל סימני מחלות דלקתיות 3,6,15. תזונה, עקה חמצונית, ואת הייצור של ציטוקינים פרו-דלקתיים יכולים לעורר הוא קוליטיס אקוטי וכרוני 3. במחקר קודם, הוכחנו כי שילוב של חומרים מזינים הראו השפעות מגן נגד קוליטיס DSS-Induced in vivo. כאן, אנו מספקים פרוטוקולים מפורטים על איך השפעות אלו נמדדו 8. ראשית, ניתחנו את ההשפעות של תוספי תזונה על התקדמות המחלה על ידי קביעת מדד פעילות המחלה (דאי), המורכב משלושה פרמטרים של ירידה במשקל, עקביות צואה, ודימום פריאנליות. נציג התוצאות הראו כי טיפול DSS הובילה דאי הגדלת ברציפות, כצפוי, להגיע למקסימום של 8.2 ± 0.46 על שבעה ימים (איור 1 א). תוספי תזונה אנטי דלקתיים עכבו את תחילת קוליטיס, אבל בנקודות זמן מאוחר יותר, כאשר קוליטיס היה חזק מאוד, ההשפעה המגנה הייתה שולית כבר לא משמעותית מבחינה סטטיסטית, דבר המצביע על כך תוספי תזונה יעילים רק כאשר קוליטיס הוא עדיין לא חזק מדי. חשוב לציין, התערבות תזונתית יכולה למנוע עליית DSS-Induced בחדירות אפיתל במעי, אשר מהווה גורם חשוב של קוליטיס (איור 1B). קוליטיס DSS הוביל אורכי המעי הגס מופחת, וקיצור זה היה להשתפר גם על ידי תוספת תזונה אנטי דלקתית ואנטי-חמצוני (תרשים 1C). לפיכך, תסמינים קליניים של קוליטיס ניתן להקל אכן על ידי שינויים בהרכב דיאטה.

gether.within-page = "1"> נזק לרקמות קולון ופירוק של TJ ו AJ במהלך קוליטיס מוחלש על ידי תוספי דלקתיות אנטי ואנטי-חמצוני דיאט

כדי לנתח מדוע קוליטיס להתקדמות היה פחות חמור בבעלי חיים שקיבלו תוסף תזונה, מורפולוגיה רקמות נחקר לאחר hematoxylin / eosin (H / E) מכתים של רקמות מעי גס דיסטלי-מוטבע פרפין. דגימות בקרה הראו מורפולוגיה נורמלית (איור 2 א, הפאנל העליון), ואילו בעלי החיים שטופלו 3.5% DSS הראה סימנים אופייניים של קוליטיס (כלומר, חדירה לויקוציטים, היווצרות בצקת, דיספלזיה המערה כולה כיבים; איור 2 א, פאנל באמצע). מן ראוי לציין כי טיפול במקביל שינויים מורפולוגיים הנגרמת קוליטיס תוספי תזונה להקל בבירור, עם מורפולוגיה כוללת הייתה יותר דומה לקבוצת הביקורת (איור 2 א, פנל תחתון). תצפיות אלו היו מאוד דומות למה כברדיווחתי על-טיפולי שיתוף עם חיידקים פרוביוטיים 13 מראים בבירור ששינוי בתזונה יכול לנטרל את הפיתוח של קוליטיס.

ידענו כבר כי חדירות האפיתל במעי הנגרמת קוליטיס יכול להיות נוטרלה ע"י תוספת דיאטה. חדירות מוגברת היא סימן היכר של IBD, וזה במידה רבה נגרמת על ידי הפירוק של צמתי adherens ייצוב (AJ) וצומת חזקים (TJ). ערעור יציבות של קשר תא אפיתל על ידי הפנמת חלבוני junctional הוא מושרה על ידי ציטוקינים פרו-דלקתיים, אשר מיוצרים בשפע במהלך קוליטיס 16. מצאנו, דרך מכתים immunofluorescent של רקמת המעי הגס הדיסטלי, כי occludens-1 zonula מולקולה TJ (ZO-1) ואת AJ מולקולה E-cadherin הופנמו במהלך קוליטיס DSS-Induced, וששיתוף לוקליזציה של חלבונים אלה היה מתעלעלות ב הקריפטה קשר תא אפיתל (איור 2 ב). אניmportantly, הפנמה של E-cadherin ו ZO-1 הופחת כאשר העכברים שטופלו DSS היו שיתוף שטופלו תוספת תזונה אנטי דלקתית ואנטי-חמצוני (איור 2 ב). בסך הכל, מבנים הקריפטה וצומת היו דומים יותר לבקרות כאשר תוספת דיאטה יושמה, דבר המצביע על כך שהאפקט המגן שנצפה היה לפחות בחלקו בשל שימור מבנה רקמה.

התערבות תזונתית יכולה לנטרל דלקתיות נויטרופילים גיוס, סטרס חמצוני, ואת הייצור של ציטוקינים פרו-דלקתיים

סימן היכר נוסף של IBD הוא חדיר נויטרופילים בלתי מבוקר. נויטרופילים גייס תורמים נזק לרקמות ידי ייצור ושחרור (reactive oxygen species ROS) ו פרוטאזות 17. שימוש assay פעילות MPO, מצאנו גיוס נויטרופילים חזק במעי הגס בתגובה DSS, אשר נוטרלהע"י תוספת דיאטה (איור 3 א).

סטרס חמצוני הוא עוד תכונה חשובה של קוליטיס, נגרם כתוצאה משחרור של ROS מ נויטרופילים גייס. לכן, ניתחנו את הייצור של ROS בחיתוכים המעי הגס. איור 3B מוכיח כי טיפול DSS גדל מאוד סטרס חמצוני. מן הראוי לציין כי שינויים בתזונה למנוע לחלוטין DSS-Induced סטרס חמצוני (איור 3 ב), שהוא ככל הנראה תוצאה של גיוס נויטרופילים מופחת (איור 3 א).

ציטוקינים chemokines פרו-דלקתיים מיוצרים במידה רבה על ידי סוגי תאים שונים במהלך קוליטיס 18. מתווכים דלקתיים כגון לתרום-תכונות הפנמה בצומת חלבון גיוס נויטרופילים שאנחנו כבר ידענו יכולים להיות נחלשנו ידי שינויים בתזונה. ניתוח של ביטוי mRNA על ידי RT-PCR חשף כי DSSהגדילה את הביטוי של IL1β, IL-6, ו chemokine הנגזרות keratinocyte (KC), כצפוי (איור 3 ג), וכי תוספת תזונה אנטי דלקתית פחתה (איור 3 ג) DSS-Induced גידול זה. נתונים אלו מרמזים כי תוספי תזונה אכן יכול לשמש כדי לנטרל הסימנים הקליניים של מחלת מעי דלקתית.

איור 1
איור 1. תוספי תזונה יכול להקל על מדד פעילות המחלה, מעיים אפיתל חדירות, וקיצור קולון. (א) מדד פעילות המחלה (דאי, ערכים בין 0 - 12) מורכב משלושה פרמטרים של ירידה במשקל, עקביות שרפרף, ודימום פריאנליות ונרשם מדי יום קבוצות הניסוי השליטה (CTRL), קוליטיס, קוליטיס + תוסף תזונה (קוליטיס + לאספקה.). קבוצת הביקורת לא הראתה שום סימנים של קוליטיס, וכתוצאה מכך דאי של 0 throughout תקופת הניסוי. n = 5 לכל קבוצה. (ב) חדירות האפיתל במעי נמדדו על ידי דליפת אוונס כחולה בשתי הקבוצות הנ"ל והתבטאו כמו הקליטה ב 620 ננומטר לכל גרם של רקמה. n = 8 לכל קבוצה. כל הנתונים מוצגים כממוצע ± סטיית התקן של הממוצע (SDM). * P <0.05; ** P <0.01; *** P <0.001. סטטיסטיקה חושבו על ידי חד כיווני ANOVA. (ג) נציג תמונות של נקודות שלמות של קבוצות ניסוי בהתאמה לאחר 7 ימי הטיפול. הסולם מהשמאל בסנטימטר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. מורפולוגיה רקמות צומת אדריכלות השתמרו טובה יותר במהלך קוליטיס בעת החלה התזונתית סוpplements. (א) 5 מיקרומטר פרפין חתך של ביופסיות רקמות מן הנקודות דיסטלי של קבוצות ניסוי בהתאמה הוכתם hematoxylin / eosin ונותח עבור סימנים אופייניים של קוליטיס, כגון היווצרות בצקת (חיצים), חדירים לויקוציטים (ראשי חץ), וכיבים (*). מורפולוגיה רקמות כוללת של קוליטיס + לאספקה. הקבוצה היותר דומה לזו של שליטה מאשר קבוצת קוליטיס, להוכחת השפעה מגנה הכולל כנגד קוליטיס DSS. תמונות מייצגות 3 הכנות רקמות עצמאיות לכל קבוצה. תמונות צולמו באמצעות מטרת 10X. בר = 100 מיקרומטר. (ב) 8 מיקרומטר המעי הגס קריו-סעיפים של שתי הקבוצות הוכתמו נוגדנים נגד ZO-1 (ירוק) ו- E-cadherin (אדום). שיתוף לוקליזציה (צהובה בתמונות הממוזגת; חיצים) של E-cadherin ו ZO-1 ב קשר תא אפיתל הקריפטה, אשר הולכת לאיבוד במהלך קוליטיס, נשמרה בעיקר קוליטיס + לאספקה. קְבוּצָה. תמונות מייצגות 3הכנות רקמות עצמאיות. בר = 50 מיקרומטר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. נויטרופילים גיוס, סטרס חמצוני, ואת הייצור של ציטוקינים פרו-דלקתיים יכולים להיות מופחת על ידי תוספי תזונה. (א) Myeloperoxidase (MPO) פעילות נמדדה לנתח את כמות גיוס לויקוציטים לרקמות המעי הגס קבוצות הניסוי: שליטה (ctrl), קוליטיס, קוליטיס + תוסף תזונה (קוליטיס + לאספקת.). n = 5 לכל קבוצה; * P <0.05. הנתונים מוצגים כממוצע ± SDM. סטטיסטיקה חושבו על ידי חד כיווני ANOVA. (ב) הקרינה של ethidium חמצון, מתואר באדום כמדד של עקה חמצונית בסעיפים קריו 8-מיקרומטר של שיתוףרקמות לון, נרשמה על ידי מיקרוסקופ confocal לייזר. תמונות מייצגות 3 הכנות רקמות עצמאיות. בר = 100 מיקרומטר. (ג) ייצור של ציטוקינים פרו-דלקתיים IL1β ו- IL-6 ואת chemokine KC נקבע על ידי וכמותיות RT-PCR בתוך ג'ל agarose 1.5% (שחור ולבן הוחזרו למען הבהירות). β-תקטין שמש גן המשק. נציג תמונות של שלוש הכנות cDNA עצמאיות מוצגות. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

על מנת להשתמש תוספי תזונה במחקרים קליניים, את היתרונות והבטיחות של תוספים כאלה יש להעריך בזהירות in vivo במחקרים בבעלי חיים. במקרה של קוליטיס, מספר דגמים בעלי חיים מתאימים דומות הסימנים הקליניים של מחלת מעי דלקתי הוקמו, כוללים מודלים כימיים באמצעות DSS, TNBS, או חומצה אצטית; נוק-אאוט מודלים (KO) כגון-KO IL10; ו-תא חיסון בתיווך קוליטיס באמצעות תאי T העברה 19-21 מאמצת. המודל של קוליטיס DSS הוא שיטה מהירה ואמינה של גרימת קוליטיס דומה תסמיני מחלה רבים של IBD האדם נעשה שימוש שפע של מחקרים חוקרים את המנגנונים המולקולריים של קוליטיס 22. יתר על כן, קוליטיס DSS הפיך וכך גם מאפשר לחקר ריפוי רקמות לאחר הגירוי colitogenic הוסר. הפרוטוקול ספק מתאר בפירוט את מודל קוליטיס DSS כי כבר מותאם בעבר במעבדה שלנו 8.

23. בנוסף, DSS חייב להיות בתוך טווח משקל מולקולרי של 40 - 50 kDa לגרום קוליטיס. עבור החוקר שנמנה, זה יהיה חשוב לפתח עין תחת הערכה משוחדת של הפרמטרים דאי של עקביות צואה ודימום פריאנליות. אם ההערכה מתבצעת על ידי חוקר שנמנה, זה recommendable יש עמית לאשר את הערכה, אידיאלי באופן עיוור.

כדי לנתח את החדירות האפיתל במעי עבור מקרומולקולות, שלוש מתודות עיקריות שימשו לאורך כל הספרות: את assay כחול לצבוע אוונס, כפי שמתואר כאן; החדרה של 4-kDa FITC-dextran בלופ מעיים; ואת ההאכלה של 4-kDa FITC-dextran 13,24,25. ב assay האחרון,-dextran FITC ניזון gavage, ואת כמות dextran FITC שחצתה את האפיתל וגם דלף לתוך זרם הדם נמדד fluorometrically ממדגמים בסרום. ב assay זה, החדירות של כל מערכת העיכול נמדדו, מאז נותב עוברת כל הדרך מן הוושט אל הרקטום ורוב נותב יעברו לפני שהגיע המעי הגס. במודל הלולאה, חדירות נמדדו באזור מעי מרותק המשמש את הלולאה (בדרך כלל במעי הדק) 25. לעומת זאת, assay אוונס הכחול יש יתרון שרק חדירות אפיתל במעי הגס נמדדו, מאז נותב מוטמעת ישירות לתוך המעי הגס כולו. כך, באמצעות assay זה, אנו יכולים להסיק כי האפיתל הגס הוא מוגן על ידי תוספת הדיאטה.

זה תמיד חשוב כדי להקליט את משקל המעי הגס ואורכים לאחר מיצוי לפני השימוש ברקמות עבור מבחני אחרים, כי נתונים מסוימים (למשל, דלפו אוונס הכחול אסא החדירy) באים לידי ביטוי לכל גרם של רקמה. יתר על כן, יחס משקל ל-אורך הוא לקריאה מתוך עצמאית של נזק לרקמות 26. באופן כללי, מורפולוגיה רקמות מנותחת באמצעות רקמות מוטבעות פרפין מוכתמות hematoxylin ו eosin, כפי שמתוארת כאן. הטבעת פרפין יש יתרון כי מורפולוגיה הרקמות היא הרבה יותר טוב לעומת משומר לשיטות הטבעה אחרות. זה מאפשר זיהוי חד משמעי של תאים מסוגים שונים בתוך רירית (כלומר, תאי מערכת החיסון, אפיתל, תאי הגביע, וכו ') ועל ניתוח של שינויים רקמות במהלך קוליטיס, כגון היווצרות בצקת, חדירת לויקוציטים, ו ארוזיות הפסגה אפיתל. מצד שני, פרפין יש חיסרון, כי מכתים immunofluorescent יכול להתבצע רק לאחר התאוששות epitope גוזלת זמן. לכן, אנו תמיד להכין ביופסיות רקמה קפוא שונות מוטבעות במתחם OCT. יכול להיות מחולק כזה דגימות רקמה בקלות באמצעות cryostat ולהראות רמות נמוכות של AUTofluorescence. אנו משתמשים אתנול עבור קיבעון על ידי התייבשות כי לא עושה את זה להפריע סיבי אקטין (כמו מתנול עושה), ואין היא לעורר autofluorescence (כפי PFA עושה). שימוש בשיטות אלה, מצאנו כי תוספת תזונה אנטי דלקתית ואנטי-חמצונים יכולה לשפר מורפולוגיה רקמות ואדריכלות לצומת במהלך קוליטיס (השווה איור 2).

גיוס נויטרופילים מוגזם הוא אירוע קטלני במהלך קוליטיס כי נגרם עקב הייצור של chemoattractants בתגובה לדלקת 17. גיוס נויטרופילים הוא אירוע פיסיולוגי כי נויטרופילים לתרום הסרת קיו הדלקתית ריפוי פצע לאחר מכן. עם זאת, אם התגובה החיסונית המולדת זה אינו נשלט כראוי הסתיים, נויטרופילים ברירית יכול לתרום נזק לרקמות ידי פרוטאזות שחרור מינים חמצן תגובתי. נויטרופילים מכילים MPO, אשר ניתן למדוד בקלות לכמת באמצעותassay colorimetric, כאשר סכום MPO עומד ביחס ישר למספר של נויטרופילים. איור 3 א, עולה כי גיוס נויטרופילים במהלך קוליטיס וכי התערבות תזונתית יכול למנוע תגובה חיסונית מוגזמת ובלתי נשלט זה. בהתאם נוכחות נויטרופילים בשפע הרירי, סטרס חמצונים גובר במהלך קוליטיס (איור 3 ב).

תוספי התזונה שלנו בבירור מגן על רירית מלחץ חמצוני, שהוא ככל הנראה תוצאה של גיוס נויטרופילים מופחת. כאמור, נויטרופילים נמשכים כמוקינים ואת הייצור של כמוקינים הוא המושרה על ידי ציטוקינים פרו-דלקתיים מופרשים על ידי תאים מסוגים שונים במהלך קוליטיס. לפיכך, הנחנו כי גיוס נויטרופילים מופחת הוא תוצאה של ציטוקינים מופחת וייצור chemokine. איור 3 ג מדגים כי ציטוקינים פרו-דלקתיים IL-1β IL-6, כמו גם אתKC chemokine, הם שהוגברו במהלך קוליטיס DSS-Induced. תוספת הדיאטה הופכת את רמות IL-6 חזרה לשלוט רמות להשתפר הייצור המוגבר של IL-1β ו KC. ראוי לציין, KC הוא chemoattractant החשוב ביותר עבור נויטרופילים בעכברים.

לכן, זה מפתה המשערים כי השימור נצפה מורפולוגיה רקמות נובע חדיר נויטרופילים מופחתים, וזה, בתורו, תוצאה של הייצור המופחת של KC. ייצור RNA ניתוח ברקמות שטופלו DSS ידי RT-PCR הוא בעייתי כאשר DSS שיורית שוהה RNA הבודד. הסיבה לכך היא כי DSS מעכב שני transcriptases הפוכה-polymerases תקי. אם אין הגברה ניתן להשיג, יהיה צורך עוד לטהר את דגימות רנ"א על ידי משקעים בתיווך LiCl, כמתואר במקום אחר 27.

לסיכום, אנו מתארים שיטות שונות פרט לניתוח נזק לרקמות במהלך קוליטיס DSS וכיצד ד זהamage יכול להשתפר על ידי תוספי תזונה. ידע שנצבר בניסויים בבעלי חיים כזה יכול להצדיק את הקמת קבוצות המטופל לחקור את ההשפעות המגנות של התוספים לנתח אדם IBD. נתונים שהתקבלו ממחקרים קליניים עשויים אז לפתוח אפיקים חדשים כדי לפתח אסטרטגיות טיפול אלטרנטיביות לניהול IBD.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים אין לי מה לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי תרומות של המועצה מקסיקני למדע וטכנולוגיה (Conacyt, 207,268 ו 233,395 למיכאל שנור). KFCO היא כלת מלגה Conacyt (396,260) כדי להשיג תואר MSc.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
ניתוח מועיל אפקטים של תוספי תזונה על פונקציות מעיים אפיתל מכשול במהלך ניסיוני קוליטיס
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter