Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

실험 성 대장염 동안 장내 상피 장벽 기능에 영양 보조 식품의 유익한 효과 분석

doi: 10.3791/55095 Published: January 5, 2017

Summary

염증성 장 질환 (IBD)의 현재 치료는 질병의 증상을 완화 목표로하지만 심각한 부작용을 일으킬 수 있습니다. 따라서, 대안 전략은 동물 대장염 모델에서 연구되고있다. 여기서 우리는 임상 IBD 표지판에 다이어트 보조제의 유익한 효과는 이러한 대장염 모델에서 분석 방법에 대해 설명합니다.

Abstract

크론 병과 궤양 성 대장염을 포함한 염증성 장 질환 (IBD)는, 내장의 만성 재발 성 질환이다. 그들은 영향을받는 개인 이러한 복부 경련, 피 묻은 설사, 체중 감소 등의 심각한 문제를 일으킬. 불행하게도, 치료법은 아직없고, 치료는 증상을 완화하는 것을 목표로하고 있습니다. 현재 치료는 심각한 부작용을 일으킬 수 소염 및 면역 억제제를 포함한다. 이는 부작용을 일으키지 않는 등의 영양 보충제와 같은 다른 치료 옵션에 대한 검색을 보증한다. 임상 연구에의 응용하기 전에, 이러한 화합물은 엄격 동물 모델에서 효율성과 보안을 테스트해야합니다. 신뢰성있는 실험 모델은 인간에서의 궤양 성 대장염의 임상 징후의 많은 재생 마우스에서 덱스 트란 황산나트륨 (DSS) 대장염 모델이다. 우리는 최근에 들어있는 영양 보충의 유익한 효과를 테스트하기 위해이 모델을 적용비타민 C와 E, L 아르기닌, 및 ω3-고도 불포화 지방산 (PUFA). 우리는 다양한 질병 매개 변수를 분석하고이 보충 질병 활동 지수가 전반적으로 개선 선도, 부종 형성, 조직 손상, 백혈구 침윤, 산화 스트레스 및 염증성 사이토 카인의 생산을 개선 할 수 있었다 것으로 나타났습니다. 이 글에서, 우리는 구체적으로 올바른 C57BL / 6 마우스의 DSS 대장염 모델을 사용하여 영양 보충제의 응용 프로그램뿐만 아니라 방법 등 조직학, 산화 스트레스, 염증 등 질병 매개 변수가 평가됩니다 설명합니다. 다른 다이어트 보조제의 유익한 효과를 분석하는 것은 다음 결국 IBD의 증상을 완화 및 / 또는 그 심각한 부작용을 유발하지 않고 죄 사함의 위상을 연장 대체 치료 전략의 개발을위한 새로운 길을 열 수 있습니다.

Introduction

대장염은 설사와 복통을 일으킬 수있는 대장의 염증 상태이다. 대장염 감염 또는 스트레스에 응답하여, 급성이거나, 그러한 염증성 장 질환 (IBD)의 그룹에 속하는 궤양 성 대장염 (UC)와 같이 만성 질환으로 발전 할 수있다. UC의 임상 증상이 잘 설명되었지만, 병인은 여전히 좋지 1 이해된다. UC는 중요한 역할이 재생 유전 변이 및 비정상적인 면역 반응과 더불어, 인성 질병이라고 전문가들 사이에서 허용됩니다. 그러나, 생활 스타일 및 영양과 같은 환경 적 요인은 또한 질환의 발생 및 진행 (3)에 기여한다.

불행하게도, IBD는 경화 아니라, 임상 증상을 완화하는 것을 목표로 많은 치료 옵션이 있습니다. 현재의 치료법은 설파살라진 및 코르티코 스테로이드와 같은 소염제를 포함한다; 이러한 azathio과 같은 면역 억제제,prine; 이러한 인테그린과 같은 종양 괴사 인자 α (TNF-α), 또는 블록과 같은 부착 분자 캡처 염증성 사이토 카인, 과도한 백혈구 보충을 감소시키는 모노클로 날 항체; 이러한 야누스 키나제 (JAK) 4와 같은 염증성 경로를 트리거 키나제를 표적 억제제. 모든 환자가 모든 치료에 반응 때문에 치료 전략 (5)를 개별화해야합니다. 또한, 이들 치료제의 대부분은 종종 심각한 부작용을 일으키는 대사 및 면역 반응을 방해. 이런 이유로, 대안적인 치료 옵션이 조사되었다.

대체 치료는 프로 바이오 틱과 성공 6,7 다양한 수준의 동물 모델 및 임상 시험에 적용된 영양 보충제를 포함한다. 최근 발견되는 것과 같은 항산화 비타민 또는 ω3 - 불포화 지방산과 같은 다른 하나의 영양제의 애플리케이션 (PUFAs)는 대장염 및 심혈관 질환의 증상을 완화 8,9 그러한 보조제의 조합의인가 열등하다. 이러한 연구는 마우스에서 수행되었다 때문에 임상 연구이 연구 결과는 인간에 적용 가능할지 여부를 결정하기 위해 인간이 수행되어야한다. 임상 연구가 시작되기 전에, 새로운 치료 방법의 효능 및 안전성은 동물 모델에서 평가되어야한다.

IBD를 들어, 덱스 트란 황산나트륨 (DSS) 모델은 광범위 질병 발전의 메커니즘과 약물 및 영양제 6,10의 유익한 효과를 연구하기 위해 사용되었다. 대부분의 연구에서 유도 칠일의 기간 동안 만 급성; 그럼에도 불구하고, 이들 동물에서 관찰 된 임상 징후 밀접 IBD 환자에서 관찰 된 것과 유사한 (즉, 혈변, 체중 감소, 상피 장애, 및 면역 세포 침윤) 10. DSS는 점막에 미란을 야기장벽 기능 장애에 증가 장내 상피 투과성 (11)의 결과. 정확한 메커니즘은 알 수없는 남아 있습니다. 그러나, 연구는 DSS는 상피 세포를 입력하고, 염증성 신호 전달 경로 (12)를 유도 할 수있는 나노 lipocomplexes을 형성하는 중간 사슬 길이의 지방산과 상호 작용하는 것을 의미한다. 이 글에서, 우리는 유도와 각 동물에 일정한 용량을 보장하기 위해 위관 영양법으로 적용하는 방법을 영양 보충제 마우스에 분석 대장염 방법을 자세히 설명하고 다양한 대장염 증상에 같은 보충제의 효과는 방법을 조사하고 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

모든 동물 실험은 Cinvestav의 기관 동물 관리 및 사용위원회에 의해 승인되었습니다.

1. DSS 마시는 물 준비 및 대장염의 유도

  1. 멸균 된 마시는 물에 3.5 % w / V 덱스 트란 황산 나트륨 (DSS) 솔루션을 준비합니다. DSS 쉽게 용해하고 최종 용액을 필터링 할 필요는 없다.
    참고 : DSS 처리 7 일 심한 대장염을 유도한다. 가벼운 장염을 유발하는 경우 3 - 치료 4 일의 권장합니다. 만큼 DSS 식수 명확 유지로서, 상기 물을 변경할 필요가 없다. 이 혼탁 변한다면, 그것은 교체되어야한다.
  2. 수컷 마우스의 기본 무게를 기록한다. 12주 나이 21의 범위 내에서 - - 25g의 체중들은 8 있는지 확인합니다.
    주 : 해당 DSS 농도는 각각의 실험실에서 최적화되어야한다. 결과는 크게 주택 조건에 따라 다를 수 있습니다. 2.5 사이의 농도 - 5 %는 일반적으로 강한 C를 유도하는 것으로보고되고C57BL / 6J WT 마우스 10 olitis. 결과는 DSS의 다른 소스와 다를 수 있습니다 서로 다른 기업과 다른 많은에서 DSS는, 테스트해야합니다.
  3. 임의 량의 물을 제공하고 필요한 경우 신선한 3.5 % DSS 물로 교체합니다.

위관 영양 보조 식품 2. 응용 프로그램

  1. 적당한 용매에서 원하는 영양 보충제의 "급송"솔루션을 준비합니다. 이 연구를 위해, 우리는 200 밀리그램 / kg의 L- 아르기닌, 83 ㎎ / ㎏ 비타민 C 46 ㎎ / ㎏ 비타민 E 77 밀리그램 / kg 에이코 사 펜타 엔 산 (EPA) 및 115 ㎎ / ㎏ 도코 사 헥사 엔 산을 함유하는 혼합물 (DHA 사용 )를 1 : 물과 홍화 오일 (1) 솔루션입니다.
  2. 위관 바늘에 연결 1 ML의 주사기를 채우기 영양 보충 혼합물 (15 G 50 mm의 X). 바늘의 외부의 화합물을 제거하고 적절한 용량의 애플리케이션을 보장하기 위해 위관 바늘의 외부를 닦습니다.
  3. 꼬리의베이스를 잡고 마우스를 억제한 손으로 단단히 다른 손의 엄지 손가락과 집게 손가락으로 목 뒤쪽에 피부 배를 파지하여. 세 번째 손가락과 목을 보유하고 같은 손의 엄지 손가락의베이스 사이의 꼬리를 놓습니다.
  4. 수직 위치에 마우스를 유지하면서, 동물의 입의 왼쪽에 바늘을 삽입하고 조심스럽게 식도를 찾을 수 입의 지붕을 따릅니다. 어떠한 저항이 발생하지 않은 경우, 위 방향으로 바늘을 전진.
    참고 : 동물이 진행하기 전에 제대로 호흡되어 있는지 확인합니다.
  5. 천천히 혼합물을 관리 천천히 주사기를 잡아 당겨 튜브를 제거하고 마우스를 놓습니다. 대장염 실험의 과정 동안 위관 회 영양 보충제를 적용합니다.

디지 활동 지수 3. 결정

주 : 질병 활성 지수 OB있는 체중 감소, 항문 출혈 및 대변 일관성 점수의 조합매일 13 tained.

  1. 매일 체중을 측정하고, 중량 감량 율에 따라 0 내지 4의 점수를 할당 (0 : 0 %, 1 : 1-5% 2 : 5-10% 3 : 10~20%, 4 :> 20 %).
    주 : 체중 손실 DSS-대장염의 유도와 실제 중량 전에 기저 중량 % 사이의 차이를 계산함으로써 결정된다.
  2. 항문 출혈의 수준을 결정하기 위해, 신선한 분변 시료를 수집하고 guaiac 분변 잠혈 검사 키트 슬라이드에 얇은 스미어를 적용하도록 제공 어플리케이터를 사용한다. 각 샘플에 대한 새로운 어플리케이터를 사용합니다.
    1. 전면 커버를 닫고 슬라이드 뒷면에있는 창을 엽니 다. 샘플 위치에서 뒷면에 현상액의 2 방울을 적용합니다.
    2. 30 초 후 결과를 읽어보십시오. 블루 색상의 흔적은 잠혈에 대한 긍정적이다. 포지티브 guaiac 분변 잠혈 검사 (신호 강도에 따라), 3 - 4 - 2.5 없음 0.5 : 0~4 (0의 스코어를 할당 촉진제SS 출혈).
      참고 변에 혈액이 보이면 guaiac 분변 잠혈 검사를 수행해야하고, 3 점, 3.5, 4 가시 혈액의 양에 따라 할당하지 않는다.
  3. 신선한 대변 샘플을 관찰하여 대변의 일관성을 결정합니다. (설사 0 : 일반 / 고체 0.5 - : - 2.5 4 반죽 의자, 3) 4 0의 점수를 할당합니다.

에반스 블루 분석에 의해 생체 내에서 장내 상피 투수를 결정 (4)

  1. 생리 식염수 (0.9 % 염화나트륨)로 희석 케타민의 혼합물 (체중 100 밀리그램 / kg)과 자일 라진 (13 밀리그램 / 체중의 kg)으로 복강을 주입하여 동물을 마취하고, 핀치를 모니터링함으로써 마취 깊이를 평가할 철수 반사.
  2. 부정사 위치에 마취 동물을 놓고 장 노출하는 개복술을 수행합니다.
  3. 맹장을 찾아 콜론 (a)의 근위 부분에 작은 절개를scendens (맹장에 이상적으로, 바로 옆).
  4. 먹이 바늘 (G22)를 삽입하고 공통의 실크 스레드를 사용하여 합자로 고정합니다. 조심스럽게 튜브를 통해 풍부한 PBS 세척은 대장에서 모든 배설물을 씻어합니다. 이 항문에 도달 할 때까지 대장에 에반스 블루 용액 (1.5 % w / PBS에서 V)을 주입.
  5. 15 분 동안 에반스 블루를 품어. 항문 주위 유실가 선명해질 때까지 풍부한 PBS와 튜브를 세척하여 염료를 세척 할 것.
  6. 자궁 전위에 의해 동물을 안락사.
  7. 대장을 절제하고 풍부한 PBS로 다시 씻어. 대장 점액을 고집하는 염료를 제거하기 위해 PBS에서 6 밀리미터 N의 -acetylcysteine 1 mL로 한 번 씻어.
  8. 길이 방향으로 결장을 잘라 PBS 6 mM의 N의 -acetylcysteine 1 mL로 한 번 더 그것을 씻어.
  9. 무게와 길이를 기록한다. 부드러운 agitatio 실온에서 하룻밤, N 2 mL의 N 디메틸 포름 아미드를 콜론을 놓고 에반스 블루 염료를 추출하려면엔. 610 nm에서 분광 광도계 염료 농도를 측정한다.

5. 조직 컬렉션

  1. 생리 식염수 (0.9 % 염화나트륨)로 희석 케타민의 혼합물 (체중 100 밀리그램 / kg)과 자일 라진 (13 밀리그램 / 체중의 kg)으로 복강을 주입하여 동물을 마취하고, 핀치를 모니터링함으로써 마취 깊이를 평가할 철수 반사.
  2. 자궁 전위에 의해 동물을 안락사.
  3. 부정사 위치에 동물을 놓고 복강을 노출 개복술을 수행합니다.
  4. 가위를 사용하여 전체 결장 해부 길이를 기록한다.
  5. 대변을 제거하기 위해 냉장 PBS로 콜론을주의 깊게 여러 번 세척하십시오. 티슈 중량을 기록하여 단계 5.6에 기재된 바와 같이, 이하의 실험을 준비 - 5.8.
  6. RNA 분리 및 마이 엘 로퍼 옥시 다제 (MPO) 분석을 위해, (100 ㎎을 충분합니다), 튜브 내부에 배치하고, SNA 적절한 크기의 조직 샘플을 잘라액체 질소를 p는 동결. 나중에 사용하기 위해 -80 ° C에서 조직을 저장합니다.
  7. 면역 형광 염색 및 산화 스트레스 결정 (아래 참조)의 경우, 작은 대장 샘플 컷 (0.5-1 센티미터) 및 최적의 절삭 온도 OCT () 화합물로 채워진 작은 알루미늄 컵을 덮어서 가리다. 건조 얼음 컵을 배치하고 버블의 형성을 피하기 위하여 천천히 얼게. 냉동 된 조직 샘플은 나중에 사용하기 위해 -80 ℃에서 저장 될 수있다.
  8. 스위스 14 롤의 경우, 길이 방향으로 결장을 열고 조심스럽게 집게를 사용하여 대변을 제거합니다. 점막이 뾰족한 집게 또는 얇고 둥근 나무 막대기를 사용하여 안쪽으로 향하게하여, 그것을 롤. 조심스럽게 매립 카세트 내부에 배치 단계 6.1를 계속합니다.
    참고 : DSS가 대장에 손상을 유도한다. 그러나, 손상 분포는 일반적으로 원위 결장과 직장에서 본 가장 손상, 말초 결장의 근위부에 따라 다릅니다. 따라서, 우리는 원위 COL 어느 일방 조직학 분석 권장또는 전체 대장의 스위스 역할을한다.

헤 마톡 실린 - 에오신 염색에 의한 대장 조직학 6. 분석

  1. 조직 준비
    1. 조직 학적 분석을 위해 적절한 고정을 달성하기 위하여, 실온 (RT)에서 48 시간 동안 10 % 포름 알데히드를 5 ml의 스위스 롤이나 제어의 특정 결장 영역으로부터 작은 조직 조각을 처리 한 마우스를 잠수.
      주 : 달리 언급하지 않는 한 6 단계에서 상기 모든 단계가 실온에서 수행된다.
    2. 18 시간 동안 수돗물로 씻으십시오.
    3. 1 시간, 1 시간, 1 시간 동안 96 %, 및 무수 에탄올, 70 % 에탄올 15 mL로 이들을 탈수. 다음 농도를 진행하기 전에 신선한 알코올로 각 단계를 반복합니다.
    4. 무수 에탄올 7.5 mL를 1 시간 동안 절대 크실렌 7.5 mL를 혼합하여 탈수를 계속한다. 1 시간 동안 절대 자일 렌 15 mL의 샘플을 전달하기 전에 한 번 반복합니다. 신선한 크실렌 한 번이 단계를 반복합니다.
    5. 파라핀에 결장 조직 샘플을 포함
      1. 17 시간 동안 액체 파라핀 50 ㎖의 샘플을 담가. 한 번 만 3 시간 동안이 단계를 반복합니다.
      2. 액체 파라핀의 810 mL에 : 큐브 샘플 (22 X 22 X 22mm 플라스틱, 사각형 금형, 크기)을 빠져.
      3. 대장 조직 샘플 파라핀 실온에서 24 시간 동안 응고하도록 허용합니다.
    6. 마이크로톰을 사용하여 조직 단면을 절단
      1. 5 ㎛의 두께로, 제조자의 지시에 따라, 마이크로톰을 사용하여 결장 샘플을 잘라.
      2. 0.3 % 젤라틴을 포함하는 수조 (1 L)의 절단을 모은다. 이것은 조직 단면의 접힘을 방지한다. 조직 섹션을 복구하고 유리 슬라이드에 그들을 탑재합니다.
    7. 조직 간 부분의 헤 마톡 실린 및 에오신 염색
      1. 배양기에서 60 ° C에서 18 시간 동안 샘플을 Deparaffinize. 이를 위해, 유리 (S)을 사용하여LIDE는 핸들 랙.
      2. 탈 파라핀 한 후, 5 분 동안 절대 크실렌 70 ㎖의 슬라이드 젖어. 신선한 크실렌 한 번이 단계를 반복합니다.
      3. 1 분 동안의 무수 알코올 70 mL의에 샘플을 전송합니다. 신선한 알코올 번이 단계를 반복합니다.
      4. 1 분 동안 에탄올 96 %의 70 ㎖의 대장 조직 샘플을 품어. 신선한 알코올 번이 단계를 반복합니다.
      5. 2 초 동안 두 번 수돗물 샘플을 씻으십시오.
      6. 7 분 동안 해리스 헤 마톡 실린의 조직을 품어.
      7. 2 초 동안 두 번 수돗물 샘플을 씻으십시오.
      8. 산성 알코올 시료 (70 % 에탄올 70 mL의 1 M 염산 700 μL) 7 초 동안 부화.
      9. 2 초 동안 두 번 수돗물 샘플을 씻으십시오.
      10. 탄산 리튬 7 초 동안 (증류수 100ml에 탄산 리튬 1 g)을 70 mL의 조직 샘플을 인큐베이션.
      11. 2 초 동안 두 번 수돗물 샘플을 씻으십시오.
      12. 에탄올 (80) 70 mL에 샘플을 품어1 분 %.
      13. 15 초 동안 70 mL를 에오신-Y로 샘플을 전송합니다.
      14. 1 분 동안 96 %의 에탄올 70 mL에이를 부화. 신선한 알코올 번이 단계를 반복합니다.
      15. 1 분간 무수 에탄올 (에틸 알코올 절대 무수) 70 ㎖의 조직 샘플을 인큐베이션. 신선한 알코올 번이 단계를 반복합니다.
      16. 절대 알코올 35 mL를 혼합 1 분 동안 절대 자일 렌 35 mL를 70 mL에 샘플을 품어.
      17. 1 분 동안 절대 자일 렌 70 mL의에 샘플을 전송합니다. 신선한 절대 자일 렌 70 mL에 5 분 동안이 단계를 반복합니다.
      18. , 대장 조직 샘플에 합성 수지의 80 μL 추가 된 커버로 커버하고, 실온에서 24 시간 동안 그들을 건조 할 수 있습니다. 마지막으로, 명 시야 현미경 (8)를 사용하여 샘플을 분석한다.

    면역 형광에 의해 7. 분석 접합 구성

    1. 단계 5.7에 기재된 바와 같이 조직을 준비하여 8 ㎛의 두께의 단면을 절단그라 이오 스탯을 사용.
    2. 수정하고 20 분 동안 -20 ℃에서 96 % 에탄올로 대장 단면을 Permeabilize 하시려면.
      주 : 달리 명시되지 않는 한 모든 인큐베이션은 이후 건조 및 형광 색소 변색을 방지하기 위해 습기가 어둠 상자에서 RT에서 수행한다.
    3. 공기 건조 샘플, 다음 1X PBS로 5 분간 3 회 씻어
    4. 2 시간 동안 PBS (0.01 % 트윈, 2 %의 BSA를 함유) 용액을 차단하여 샘플을 인큐베이션.
    5. 블로킹 용액을 제거하고 10 분 동안 PBS-0.01 % 트윈으로 씻어.
    6. 이 시간 동안, PBS-0.01 % 트윈에서 원하는 농도 차 항체를 희석.
    7. 상기 세정액 ​​제거 이전 단계의 항체 용액을 적용하고, 습윤 상자에서 4 ℃에서 밤새 배양한다.
    8. 항체 용액을 제거하고 매우 온화한 교반과 함께 10 분 동안 탈 이온수로 한번 5 분마다 PBS-0.01 % 트윈으로 3 회 세척하고.
    9. 세척, 원심 분리기 불소 동안ochromeconjugated, 종 특이 4 ° C에서 20 분 동안 14,000 XG에 이차 항체.
    10. PBS-0.01 % 트윈 (Tween)의 제공자에 의해 나타낸 바와 같이, 석출물이없는 차 항체 희석을 적용하고, RT에서 1 시간 동안 배양한다.
    11. 단계를 반복 7.8 가능한 한 완전히 세척 용액을 제거.
    12. 의 피펫 4 μL 슬라이드에있는 각각의 샘플을 통해 에이전트를 안티 - 페이딩.
    13. 커버 슬립과 샘플을 커버.
    14. 1 시간 동안 공기 건조.
    15. 매니큐어와 인감 슬라이드. 슬라이드를 추가 분석 할 때까지 -20 ° C에 저장할 수 있습니다.
    16. 공 초점 레이저 현미경 (8)에 분석 할 수 있습니다.

    에티 디움의 산화에 의한 산화 스트레스의 8 결정

    1. 5 ㎛의 두께로 저온 유지 장치에 결장 섹션을 단계 5.7에서 설명한 절단으로 DSS 대장염 7 일 후 조직을 준비합니다. 유리 슬라이드 위에 마운트 단면은 폴리 -L- 라이신 용액으로 처리하고, 샘플 재치를 품어시간 5 어둠 속에서 30 분 동안 37 ° C에서 물에 dihydroethidium (DHE)의 μM.
    2. PBS (산도 7.6) RT에서 교반과 함께 15 분 각 3 회 샘플을 씻으십시오. 공기 샘플을 건조하고 형광을 보호하기 위해 매체를 장착 한 방울을 추가합니다. 산화 레이저 스캐닝 공 초점 현미경에 에티 디움 (40X 배율, 568 nm 파장)의 형광을 관찰한다.

    MPO의 분석에 의한 백혈구 모집 9. 분석

    1. DSS 대장염 7 일 후, 대장 조직을 수집하고 샘플을 균질화 - 얼음에 호모 게 나이저를 사용하여 헥사 1 ㎖ (HTAB) 버퍼 (50 mM의 0.5 %의 HTAB 인산 완충액, pH를 6.0)과 (200 400 mg)을.
    2. 10 초마다 40 % 진폭 다섯번 해물 모든 조직을 포함하고 초음파 처리하는 하나의 버퍼 용액 HTAB 회 균질화 끝을 헹군다. 액체 질소 세 번에 동결 해동.
    3. 15 분 동안 14,000 XG에 원심 분리기와 뜨는를 수집합니다.구연산 나트륨 (물 중 1 M), 과산화수소 수 0.1 ㎖를 ABTS, 5 mL를 혼합 한 2,2'- 아지노 - 비스 (3-ethylbenzothiazoline -6- 술폰산) (ABTS) 용액을 준비하고, Bi를 45 mL의 -증류수.
    4. 96 웰 평평한 바닥 플레이트에 0.1 mL의 ABTS 용액 각각의 상층 액 0.1 mL로 섞는다. 10 분 후 분광 광도계를 이용하여 460 nm에서 흡광도를 측정한다.

    (10) PCR에 의한 염증성 사이토 카인의 발현을 평가

    1. 조직의 균질화
      1. 전력 균질기를 사용하여 산 구 아니 디늄 티오 시아 네이트 - 페놀 - 클로로포름 혼합물을 1 mL의 결장 조직 표본을 50 내지 100 mg의 균질화.
      2. 실온에서 15 분 동안이를 부화.
    2. 상 분리
      1. 클로로포름 0.2 mL를 넣고 30 초 동안 격렬하게 흔들어.
      2. 30 분 동안 4 ° C에서 품어.
      3. 4 ℃에서 60 분 동안 12,000 XG에 원심 분리기.
      4. U 자 이동신선한 튜브 (~ 500 μL)에 pper 수상.
    3. RNA 침전 및 재 부유
      1. 이소 프로필 알코올 0.5 mL를 넣고 60 분 동안 4 ° C에서 샘플을 품어.
      2. 4 ℃에서 30 분 동안 12,000 XG에 원심 분리기.
      3. 완전히 뜨는을 제거합니다.
      4. 에탄올 75 %와 소용돌이의 1 ML을 추가합니다.
      5. 4 ℃에서 30 분 동안 12,000 XG에 원심 분리기.
      6. 뜨는을 제거합니다.
      7. 3 ~ 5 분간 자연 건조 나머지 에탄올을 허용합니다.
        참고 :이 크게 용해도를 감소로 RNA 펠렛이 완전히 건조하게하지 않는 것이 중요합니다.
      8. 디 에틸 피로 카보 0.3 ㎖ (DEPC) 처리 된 물에 펠렛을 다시 녹인다. 즉시 -80 ° C에서 또는 저장 (단계 10.5을 참조 안정적)의 cDNA에 RNA 샘플을 전사.
    4. RNA 정량
      1. DEPC 처리 된 물 99 μL와 RNA 1 μL를 희석.
      2. 제 읽기260 nm에서 샘플 농도 및 순도를 결정하기 위해 UV / VIS 분광 광도계를 사용하여 280 nm에서 OD 전자.
    5. cDNA를 합성
      1. 의 RNase없는 멸균 튜브 1 올리고의 μL (DT) 12-18 (0.5 μg의 / μL) 및 DEPC 처리 된 물 (12 μL의 총 부피)와 RNA 샘플 (1-5 μg의)를 섞는다.
      2. 10 분 동안 70 ℃에서 인큐베이션.
      3. 10 배 PCR 버퍼 2 μL,의 MgCl 2 50 mm의 1 μL, 10 mM의의 dNTP 믹스 1 μL, 0.1 M 디티 오 트레이 톨의 2 μL (DTT)를 추가합니다.
      4. 5 분 동안 4 ° C에서 품어.
      5. 역전사 효소 1 μL를 추가하고 5 분 동안 42 ° C에서 품어.
      6. 15 분 동안 70 ℃에서 인큐베이션.
      7. 15 분 동안 4 ° C에서 품어. cDNA를 더 사용할 때까지 -20 ° C에 저장할 수 있습니다.
    6. PCR
      1. 10 배 PCR 버퍼 2.5 μL, 25 mM의 1.5 μL의 MgCl 2를 혼합, 10 밀리미터의 dNTP 0.5 μL는, 혼합 0.25 μ25 μL의 총 부피의 Taq DNA 중합 효소, 0.25 μL 각 프라이머 (10 μM) 및 cDNA를 (100 NG) 및 멸균 L.
      2. 96 웰 열 자전거 타는 사람에 샘플을 실행합니다. 앞으로, 게놈 DNA의 증폭을 방지하고 프라이머가 다른 엑손에 위치해야 반전하려면 : IL1β-FW : GCAACTGTTCCTGAACTCAACT 및 IL1β-RE : TCTTTTGGGGTCCGTCAACT; IL6-FW : CCTTCCTACCCCAATTTCCAA 및 IL6-RE : AGATGAATTGGATGGTCTTGGTC; KC-FW : TGTCAGTGCCTGCAGACCAT 및 KC-RE : CCTGAGGGCAACACCTTCA; 그리고 굴지-FW : TATCCACCTTCCAGCAGATGT과 액틴-RE : AGCTCAGTAACAGTCCGCCTA. 15 초, 30 초 동안 58 ° C, 30 초 동안 72 ° C, 플러스 72 ℃에서 10 분간 최종 연장을 95 ° C에서 95 ° C에서 5 분 동안 30 사이클 뒤에 다음 PCR 조건을 사용하여 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

다이어트 보조 식품 DSS 대장염에서 보호 할 수 있습니다

비타민 C, 비타민 E, 산화 질소 (NO) -source의 L- 아르기닌 및 ω3 - 불포화 지방산 (ω3-PUFAs에) 등의 항 염증 및 항산화 다이어트 보조제, 동물에서 다양한 성공 사용되고 모델은 염증성 질환 3,6,15의 흔적을 완화한다. 영양 실조, 산화 스트레스, 및 염증성 사이토 카인의 생산은 급성 및 만성 대장염 3을 트리거 할 수있다. 이전의 연구에서, 우리는 미량 영양소의 조합이 생체 내에서 DSS 유도 된 대장염에 대한 보호 효과를 보였다 있음을 증명했다. 여기, 우리는 이러한 효과가 8을 측정 하였다 방법에 대한 자세한 프로토콜을 제공합니다. 첫째, 우리는 체중 감소의 세 파라미터 이루어진 질병 활성 지수 (DAI)를 결정하여 질환 진행에 대한 영양 보충제의 효과를 분석대변 ​​일관성, 그리고 항문 주위 출혈. 대표 결과는 DSS 치료는 하루 일곱 (그림 1A)에 8.2 ± 0.46의 최대에 도달, 예상대로 지속적으로 증가 DAI 주도 것으로 나타났다. 항염증제식이 보충 대장염의 발병을 지연되지만 대장염이 매우 강한 경우 나중 시점에서, 상기 보호 효과는 대장염 아직 너무 강하지 않은 때식이 보충제에만 효과적 시사 한계 더 이상 통계적으로 유의 하였다. 중요한식이 개입 대장염의 중요한 기능 (도 1b)를 인 장내 상피 투과성의 DSS - 유도 증가를 방지 할 수있다. DSS 대장염은 대장의 길이 감소되었다,이 단축은 항 염증 및 항산화식이 보충제 (도 1C)에 의해, 개선 하였다. 따라서, 대장염의 임상 증상은 실제로 다이어트 조성의 변화에 ​​의해 완화 될 수있다.

진행은 다이어트 보충제를받는 동물에서 덜 심각했다 대장염 이유를 분석하기 위해, 조직 형태는 헤 마톡 실린 / 에오신 (H / E) 파라핀 포함 된 원위부 대장 조직의 염색 후 조사 하였다. (도 2A, 가운데 패널 즉, 백혈구 침윤, 부종 형성, 토굴 이형성증 및 궤양) 3.5 %의 DSS로 치료 동물 대장염의 전형적인 징후를 보여 주었다 반면, 제어 샘플은 정상적인 형태 (그림 2A, 상단 패널)을 보여 주었다. 주, 대조군 (그림 2A, 하단 패널)에 더 비교했다 전반적인 형태와 다이어트 보충제 명확하게 완화 성 대장염에 의한 형태 학적 변화와 병렬 처리,의. 이 관찰되었습니다 것과 매우 유사했다프로 바이오 틱 균 13 명확와 공동 치료법에 대한보고는식이 변화 대장염의 개발을 방해 할 수 있음을 보여준다.

우리는 대장염을 유발 장 상피 투과성이 다이어트 보충제에 의해 상쇄 될 수있다 이미 알고 있었다. 증가 된 투자율은 IBD의 특징이며, 안정화 adherens 접합부 (AJ) 꽉 접합 (TJ)의 분해에 의한 큰 부분이다. 접합부 단백질의 국제화에 의한 상피 세포 접점의 불안정이 풍부 성 대장염 16시에 발생하는 염증성 사이토 카인에 의해 유도된다. 우리는 TJ 분자 zonula의 occludens-1 (ZO-1)과 AJ 분자 E-cadherin의가 DSS 유도 된 대장염 동안 내면화하고,이 단백질의 공동 현지화가 부분적으로 손실 된 것을, 원위 결장 조직의 면역 염색을 통해 발견 토굴 상피 세포 접촉에서 (그림 2B). 나는mportantly, E-cadherin의 DSS 및 처리 된 마우스는 공동 처리 소염 및 항산화식이 보충제 (도 2B)에있을 때 ZO-1 감소의 내재화. 전반적으로, crypt와 접합 구조는 관찰 보호 효과가 적어도 부분적으로 인해 조직 구조의 보전 것을 제안, 다이어트 보조 식품이 적용된 컨트롤에 더 비슷 하였다.

염증성 호중구 모집, 산화 스트레스 및 염증성 사이토 카인의 생산을 해소하는식이 개입

IBD의 또 다른 특징은 통제되지 않은 호중구 침윤이다. 모집 호중구 생산 및 반응성 산소 종 (ROS) 및 프로테아제 17 박리하여 조직 손상에 기여한다. MPO 활성 분석을 사용하여, 우리는 상쇄 된 DSS에 응답 결장 강한 호중구 채용 발견다이어트 보충제로 (그림 3A).

산화 스트레스는 모집 호중구에서 ROS의 방출에 의한 대장염의 또 다른 중요한 기능입니다. 따라서, 우리는 대장 단면에서 ROS의 생성을 분석 하였다. 도 3b는 DSS 처리 강하게 산화 스트레스를 증가 것을 보여준다. 참고로, 다이어트의 변화는 완전히 가능성이 감소 호중구 모집 (그림 3A)의 결과이다 DSS에 의한 산화 스트레스 (그림 3B)를 방지.

염증성 사이토 카인 및 케모카인 강하게 대장염 18 동안 다양한 세포 유형에 의해 생성된다. 이러한 염증 매개은 우리가 이미 다이어트의 변화에 ​​의해 감쇠 될 수 있다는 것을 알았 호중구 모집 및 접합 단백질 국제화-기능에 기여한다. RT-PCR에 의한 mRNA 발현의 분석은 DSS 밝혀IL1β의 발현, IL-6를 증가 및 각질 세포 유래 케모카인 (KC), (그림 3C) 예상대로, 그리고 항 염증 다이어트 보충이 DSS에 의한 증가 (그림 3C)를 감소. 이러한 데이터는 다이어트 보조 식품이 실제로 IBD의 임상 증상을 중화하는 역할을 할 수 있음을 의미한다.

그림 1
그림 1. 영양 보조 식품은 질병 활동 지수, 장 상피 침투성 및 콜론 단축을 완화 할 수 있습니다. (A) 질병 활성 지수 (DAI는 0의 값 - 12) + 체중 감소, 대변 일관성 및 항문 출혈의 세 개의 매개 변수 구성 및 제어 (CTRL), 대장염, 및 대장염의 실험군 매일 기록 하였다 영양 보충 (성 대장염 + Suppl에.). 대조군은 0 throughou의 DAI 결과 대장염의 흔적이 나타나지 않았다실험 기간을 t. 그룹 당 n = 5. (B) 소장 상피 투과성 상술 실험군 에반스 블루 누설에 의해 측정하고, 조직의 g 당 620 nm에서 흡광도로 나타내었다. 그룹 당 n = 8. 모든 데이터는 평균 (SDM)의 평균 ± 표준 편차로 표시됩니다. * P <0.05; ** P <0.01; *** p <0.001. 통계는 일방 ANOVA에 의해 산출 하였다. (C) 치료 7 일 후 각 실험군의 전체 콜론의 대표 이미지. 좌측의 스케일 cm이다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2. 조직 형태와 접합 구조는 더 나은 영양 스와을 적용 할 때 대장염 동안 유지됩니다pplements. (A) 각 실험군의 원위 결장의 조직 생검 5 μm의 파라핀 단면는 헤 마톡 실린 / 에오신 염색 및 부종 형성 (화살표), 백혈구 침윤 (화살촉) 등 대장염의 전형적인 징후에 대해 분석 하였다 및 궤양 (*). 대장염 + Suppl에의 전체 조직 형태. 더 그룹은 DSS 대장염에 대한 전반적인 보호 효과를 입증, 그 대장염 그룹보다 컨트롤의 유사합니다. 이미지 그룹 당 세 독립적 인 조직 제제의 대표이다. 이미지는 10 배 목표를 사용하여 촬영 하였다. 바 = 100 μm의. (B) 각 그룹에 8 ㎛의 대장 크라이 섹션 ZO-1에 대한 항체 (녹색) 및 E-cadherin의 (적색)으로 염색 하였다. (병합 된 이미지 노란색, 화살표) 공동 현지화 대장염 동안 손실되는 토굴 상피 세포 접촉에서 E-cadherin의 및 ZO-1은 주로 성 대장염 + Suppl에 보존된다. 그룹. 이미지 (3)의 대표독립적 인 조직 준비. 바 = 50 μm의. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
도 3 호중구 채용 산화 스트레스, 및 염증성 사이토 카인의 생산은 영양 보충제에 의해 감소 될 수있다. (A) 마이 엘 로퍼 옥시 다제 (MPO) 활성은 실험군에 결장 조직으로 백혈구 보충 량을 분석하여 측정되었다 : 제어 (CTRL), 대장염, 대장염 + 영양제 (대장염 + Suppl에있다.). 그룹 당 n = 5; * P <0.05. 데이터는 SDM 평균 ±로 표시됩니다. 통계는 일방 ANOVA에 의해 산출 하였다. 공동 8 μm의 극저온의 섹션에서 산화 스트레스의 척도로 도시 된 적색 (B) 산화 티듐의 형광경도 조직을 레이저 공 초점 현미경으로 기록 하였다. 이미지는 세 독립적 인 조직 제제의 대표이다. 바 = 100 μm의. (C) 친 염증성 사이토킨 IL1β 및 IL-6 및 KC은 1.5 % 아가 로스 겔에서 반 정량적 RT-PCR에 의해 측정 하였다 케모카인의 제조는 (흑백는 명확성을 위해 복귀 하였다). β - 굴지는 하우스 키핑 유전자 역임했다. 3 개의 독립적 인 cDNA를 준비의 대표 이미지가 표시됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

임상 연구에서 영양 보충제를 사용하기 위해, 이득 등과 보충 안전 신중 동물 연구에서 생체 내에서 평가한다. 대장염의 경우, IBD의 임상 증상과 유사한 여러 적절한 동물 모델은 DSS, TNBS, 또는 아세트산을 이용한 화학 모델을 포함하여, 확립되었다; 녹 - 아웃 등 IL10-KO로 (KO) 모델; 및 입양 T 세포 전송 19-21를 사용하여 대장염을 면역 세포 매개. 대장염의 DSS 모델은 인간 IBD 많은 질병 증상과 유사한 및 대장염 (22)의 분자 메커니즘을 조사 연구의 과다 사용되어왔다 대장염 유도 신속하고 신뢰할 수있는 방법이다. 또한, DSS 대장염은 가역적이며, colitogenic 자극이 제거 된 후, 따라서 또한 조직의 치유에 대한 연구 수 있습니다. 제공되는 프로토콜 상세 이전에 우리의 실험실 8에 최적화 된 DSS 대장염 모델을 설명합니다.

진행에 영향을주는 23 이후 DSS 농도의 최적화는 모든 기관에서 수행되어야한다는 것이다. 대장염을 유발하는 50 kDa의 - 또한 DSS 40의 분자량 범위에 있어야한다. 미경 연구의 경우, 대변 일관성과 항문 출혈 DAI 파라미터 공정한 평가 눈을 개발하는 것이 중요 할 것이다. 평가가 미경 연구자에 의해 수행되는 경우, 동료는 이상적 맹검 방식으로, 평가를 확인하도록 권장한다.

여기에 설명 된 바와 같이, 에반스 블루 염료 분석; 고분자 용 장 상피 세포 투과율을 분석하기 위해, 세 가지 주요 방법은 문헌에 걸쳐 사용 된 장내 루프 4-kDa의 FITC-덱스 트란의 점안; 4-kDa의 FITC-덱스 트란 13,24,25의 먹이입니다. 후자의 분석에서, FITC-덱스 트란은 위관에 의해 공급된다및 상피 교차하고 혈류 내로 유출 FITC 덱스 트란의 양 혈청 시료에서 fluorometrically 측정된다. 트레이서 줄곧 직장의 식도 통과 탐침의 대부분이 대장에 도달하기 전에 통과하기 때문에 상기 분석에서, 전체 위장관의 투과도를 측정한다. 루프 모델에서 침투성 루프 (주로 소장) (25)에 사용되는 밀폐 된 장 영역에서 측정된다. 반대로, 에반스 블루 분석은 탐침이 직접 전체 결장 내로 주입되기 때문에, 대장 상피 만 투자율을 측정하는 장점이있다. 따라서,이 분석을 이용하여, 우리는 대장 상피 다이어트 보충제에 의해 보호되는 것으로 결론 지을 수있다.

일부 데이터 (예 침투성 ASSA 에반스 블루 누출 때문에, 추출 후, 다른 분석을 위해 조직을 사용하기 전에 대장 중량과 길이를 기록하는 것이 중요Y)는 조직의 g 당 표현된다. 또한, 중량 대 길이 비는 조직 손상 (26)의 독립적 인 판독이다. 여기에 기술 된 바와 같이 일반적으로, 조직 형태는 헤 마톡 실린 및 에오신으로 염색 하였다 파라핀 조직을 이용하여 분석한다. 파라핀 매립은 조직 형태가 다른 삽입 방법에 비해 훨씬 보존되는 장점을 갖는다. 이 점막 내에서 다른 세포 유형의 명확한 식별이 가능 (즉, 면역 세포, 상피 세포, 술잔 세포 등) 부종 형성, 백혈구 침윤과 상피 정점 미란과 같은 대장염 동안 조직 변화의 분석. 한편, 파라핀 면역 염색 단지 시간 소모적 에피토프 복구 후 수행 될 수 있다는 단점이있다. 따라서, 우리는 항상의 OCT 화합물에 포함 된 다른 냉동 조직 생검을 준비합니다. 그러한 조직 샘플은 쉽게 저온 유지 장치를 이용하여 절단 및 AUT 낮은 레벨을 표시 할 수있다ofluorescence. (메탄올처럼)은 액틴 필라멘트를 방해 않는 것도 있기 때문에 우리는 탈수에 의해 고정 에탄올을 사용하거나 (PFA는 마찬가지로)이 자기 형광을 유발 않습니다. 이러한 기술을 사용하여, 우리는 소염 및 항산화식이 보충 대장염 (도 2)와 비교시 조직 형태학 및 접합 구조를 개선 할 수 있음을 발견 하였다.

과도한 호중구 모집은 염증 (17)에 대한 응답으로 화학 유인 물질의 생산에 의해 유도되는 대장염 동안 중요한 이벤트입니다. 호중구 염증 큐의 제거 이후의 상처 치유에 기여하기 때문에 호중구 모집 생리 이벤트이다. 이러한 선천성 면역 반응이 적절히 제어되고 종료되지 않은 경우, 점막의 호중구 해제 프로테아제와 활성 산소 종에 의해 조직 손상에 기여할 수있다. 호중구 쉽게 측정 할 수있다 MPO를 포함하고를 사용하여 정량MPO 양이 호중구의 수에 정비례 비색 분석법. 도 3a는 대장염 그식이 개입 동안 호중구 채용이 증가하고 제어되지 않은 과도한 면역 반응을 방지 할 수 있음을 보여준다. 점막의 풍부한 호중구의 존재에 따라, 산화 스트레스는 성 대장염 (그림 3B) 동안 증가한다.

우리의 다이어트 보충제는 명확하게 가장 가능성이 감소 호중구 모집의 결과이다 산화 스트레스로부터의 점막을 보호합니다. 언급 한 바와 같이, 케모카인은 호중구에 흡착되어 케모카인 생산은 대장염 동안 다양한 세포 유형에 의해 분비되는 염증성 사이토 카인에 의해 유도된다. 따라서, 우리는 호중구 감소 모집 저감 사이토 카인 및 케모카인 생산의 결과 인 것으로 가정한다. 도 3c는 보여 그 염증성 싸이토카인 IL-1β 및 IL-6,뿐만 아니라케모카인 KC는 DSS 유도 된 대장염 동안 상향 조절된다. 다이어트 보충제 레벨을 제어하는 ​​백 IL-6의 수준을 반전 IL-1β 및 KC의 생산 증가가 없어진다. 참고로, KC는 마우스에서 호중구의 가장 중요한 화학 유인 물질이다.

따라서, 조직 형태 학적 관찰 보존 차례로이다 감소 호중구 침윤에 의한 것으로 추측 유혹, KC의 생산 감소의 결과. 잔류 DSS는 절연 RNA에 존재하는 경우, RT-PCR에 의해 DSS 처리 된 조직에서 분석 RNA 생산이 문제가된다. DSS는 역전사 - 중합 효소 및 Taq를 동시에 저해하기 때문이다. 더 증폭이 달성 할 수없는 경우, 다른 27 바와 같이 또한, LiCl을 매개 석출하여 RNA 샘플을 정제 할 필요가있다.

요약하면, 우리는 조직 손상의 분석에 대한 세부 사항 다른 방법 DSS 대장염 동안 어떻게이 D에 설명amage는 건강 보조 식품으로 개선 될 수 있습니다. 지식은 인간의 IBD의 분석 보충제의 보호 효과를 조사하기 위해 환자 집단의 설립을 정당화 할 수와 같은 동물 실험에서 얻은. 임상 시험에서 얻은 데이터는 IBD의 관리를위한 대안 치료 전략을 개발하기 위해 새로운 길을 열 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 아무것도 없어.

Acknowledgments

이 작품은 멕시코 과학 기술위원회 (CONACYT, 207268 및 233395 마이클 Schnoor에)에서 보조금에 의해 지원되었다. KFCO는 석사 학위를 취득 할 수있는 CONACYT의 장학금 (396260)의받는 사람입니다.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
실험 성 대장염 동안 장내 상피 장벽 기능에 영양 보조 식품의 유익한 효과 분석
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter