Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analizar los efectos beneficiosos de los suplementos nutricionales sobre las funciones epitelial intestinal de barrera durante Experimental Colitis

doi: 10.3791/55095 Published: January 5, 2017

Summary

Los tratamientos actuales de las enfermedades inflamatorias intestinales (EII) tienen como objetivo aliviar los síntomas de la enfermedad, pero pueden causar efectos secundarios graves. Por lo tanto, las estrategias alternativas están siendo investigados en modelos animales con colitis. A continuación, explicamos cómo se analizan los efectos beneficiosos de los suplementos de la dieta en los signos clínicos de la EII en un modelo de este tipo colitis.

Abstract

Las enfermedades inflamatorias intestinales (EII), incluyendo la enfermedad de Crohn y la colitis ulcerosa, son enfermedades crónicas recurrentes de los intestinos. Causan problemas graves, tales como calambres abdominales, diarrea con sangre, pérdida de peso, y en los individuos afectados. Desafortunadamente, no existe una cura todavía, y tratamientos sólo tienen como objetivo aliviar los síntomas. Los tratamientos actuales incluyen fármacos antiinflamatorios e inmunosupresores que pueden causar efectos secundarios graves. Esto justifica la búsqueda de opciones alternativas de tratamiento, tales como suplementos nutricionales, que no causan efectos secundarios. Antes de su aplicación en los estudios clínicos, tales compuestos deben ser probados rigurosamente para la eficacia y la seguridad en modelos animales. Un modelo experimental fiable es el modelo de colitis de dextrano sulfato de sodio (DSS) en ratones, que reproduce muchos de los síntomas clínicos de la colitis ulcerosa en humanos. Hemos aplicado recientemente este modelo para probar los efectos beneficiosos de un suplemento nutricional que contienevitaminas C y E, L-arginina, y los ácidos grasos omega 3-poliinsaturados (PUFA). Se analizaron varios parámetros de la enfermedad y se encontró que este suplemento era capaz de mejorar la formación de edema, daño tisular, infiltración de leucocitos, el estrés oxidativo y la producción de citoquinas pro-inflamatorias, lo que lleva a una mejora general en el índice de actividad de la enfermedad. En este artículo, se explica en detalle la correcta aplicación de los suplementos nutricionales utilizando el modelo de colitis DSS en ratones C57BL / 6, así como la forma parámetros de la enfermedad, tales como la histología, el estrés oxidativo y la inflamación son evaluados. El análisis de los efectos beneficiosos de los diferentes suplementos de dieta puede entonces eventualmente abrir nuevas vías para el desarrollo de estrategias de tratamiento alternativas que alivien los síntomas de IBD y / o que prolongan las fases de remisión sin causar efectos secundarios graves.

Introduction

La colitis es una enfermedad inflamatoria del colon que puede causar diarrea y dolor abdominal. La colitis puede ser aguda, en respuesta a la infección o al estrés, o se puede desarrollar como una enfermedad crónica, tal como en la colitis ulcerosa (UC), que pertenece al grupo de las enfermedades inflamatorias del intestino (EII). A pesar de los signos clínicos de la UC han sido bien descritos, la patogénesis aún es poco conocido 1. Es un hecho aceptado entre los expertos de que la UC es una enfermedad multifactorial, con mutaciones genéticas y las respuestas inmunes aberrantes que juegan un papel importante 2. Sin embargo, los factores ambientales, como el estilo de vida y la nutrición, también contribuyen al desarrollo de la enfermedad y la progresión 3.

Por desgracia, la EII no es curable, pero hay muchas opciones de tratamiento que tienen como objetivo aliviar los síntomas clínicos. Los tratamientos actuales incluyen fármacos anti-inflamatorios, tales como la sulfasalazina y corticosteroides; inmunosupresores, tales como azathioprine; anticuerpos monoclonales que captura citoquinas pro-inflamatorias, tales como factor de necrosis tumoral-α (TNF-α), o moléculas de adhesión de bloques, tales como las integrinas, para reducir el reclutamiento de leucocitos excesiva; e inhibidores que se dirigen a quinasas que activan las vías de pro-inflamatorias, tales como Janus quinasa (JAK) 4. No todos los pacientes responden a todos los tratamientos, por lo que las estrategias terapéuticas deben individualizarse 5. Además, la mayoría de estos fármacos terapéuticos interferir con el metabolismo y la respuesta inmune, causando a menudo efectos secundarios graves. Por esta razón, se han investigado las opciones de tratamiento alternativos.

Los tratamientos alternativos incluyen probióticos y suplementos nutricionales, que se han aplicado en modelos animales y ensayos clínicos con diferentes niveles de éxito 6,7. Recientemente, hemos encontrado que la aplicación de diferentes suplementos nutricionales individuales, tales como las vitaminas anti-oxidantes o ácidos grasos ω3-poli-insaturados (PUFA), es inferior a la aplicación de una combinación de tales suplementos en el alivio de la colitis y síntomas de la enfermedad cardiovascular 8,9. Estos estudios se realizaron en ratones, por lo que los estudios clínicos deben ser realizados en seres humanos para determinar si estos hallazgos también serán aplicables a los seres humanos. Antes de iniciar los estudios clínicos, la eficacia y la seguridad de las nuevas opciones de tratamiento deben ser evaluados en modelos animales.

Por IBD, el modelo de dextrano sulfato sódico (DSS) se ha utilizado ampliamente para estudiar los mecanismos de desarrollo de la enfermedad y los efectos beneficiosos de los fármacos y suplementos nutricionales 6,10. En la mayoría de los estudios, sólo una enfermedad aguda durante un período de tiempo de siete días se inducidas; sin embargo, los signos clínicos observados en estos animales se parecen mucho a los observados en pacientes con EII (es decir, diarrea sanguinolenta, pérdida de peso, disfunción epitelial, y la infiltración de células inmunes) 10. DSS induce erosiones en la mucosa,lo que resulta en disfunción de la barrera y en aumento de la permeabilidad del epitelio intestinal 11. El mecanismo exacto se desconoce. Sin embargo, un estudio sugiere que el DSS interactúa con ácidos grasos de cadena media-longitud para formar nano-lipocomplexes que son capaces de entrar en las células epiteliales y para inducir la señalización inflamatoria vías 12. En este artículo, se describe en detalle cómo se induce la colitis y se analizaron en ratones, cómo los suplementos nutricionales se aplica mediante una sonda para asegurar una dosificación constante en cada animal, y cómo se examinan los efectos de dichos suplementos sobre diversos síntomas de la colitis.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los experimentos con animales han sido aprobados por el Comité de Cuidado y Uso de Animales institucional del Cinvestav.

1. Preparación de DSS Agua Potable y la inducción de la colitis

  1. Preparar una solución de 3,5% w / v de sulfato de dextrano sódico (DSS) en el agua potable tratada en autoclave. DSS se disuelve fácilmente y no es necesario para filtrar la solución final.
    NOTA: 7 días de tratamiento DSS induce colitis severa. Si la inducción de la colitis leve, 3 - 4 Se recomienda a días de tratamiento. Mientras el agua potable DSS queda claro, no es necesario cambiar el agua. Sin embargo, si resulta turbia, debe ser reemplazado.
  2. Anotar el peso basal de los ratones machos. Asegúrese de que tengan entre 8 - 12 semanas de edad y dentro de un rango de 21 - 25 g de peso corporal.
    NOTA: La concentración DSS correspondiente debe ser optimizado en cada laboratorio. Los resultados pueden variar mucho, dependiendo de las condiciones de vivienda. Concentraciones entre 2,5 - 5% de resultados normalmente se dan para inducir una fuerte colitis en ratones C57BL / 6J WT 10. DSS de diferentes empresas y diferentes lotes debe ser probado, ya que los resultados pueden variar también con diferentes fuentes de DSS.
  3. Proporcionar agua ad libitum y reemplazarlo con agua fresca DSS 3.5% si es necesario.

2. La aplicación de suplementos nutricionales mediante sonda

  1. Preparar una solución "puede alimentar" de los suplementos nutricionales deseados en un disolvente apropiado. Para este estudio, se utilizó una mezcla que contiene 200 mg / kg de L-arginina, 83 mg / kg de vitamina C, 46 mg / kg de vitamina E, 77 mg / kg del ácido eicosapentaenoico (EPA), y 115 mg kg / ácido docosahexaenoico (DHA ) en una solución 1: 1 de agua y aceite de cártamo.
  2. Llenar una jeringa de 1 ml conectada a una aguja de sonda nasogástrica (15 G x 50 mm) con la mezcla de suplemento nutricional. Limpiar el exterior de la aguja de sonda para eliminar cualquier compuesto exterior de la aguja y asegurar la aplicación de dosis adecuada.
  3. Restringir el ratón agarrando la base de la cola conuna mano y agarrando firmemente un pliegue de la piel en la parte posterior del cuello con el pulgar y el dedo índice de la otra mano. Coloque la cola entre el tercer dedo y la base del pulgar de la misma mano que sujeta el cuello.
  4. Mientras se mantiene el ratón en una posición vertical, inserte la aguja en el lado izquierdo de la boca del animal y seguir cuidadosamente el techo de la boca para localizar el esófago. Si se encuentra ninguna resistencia, avanzar la aguja hacia el estómago.
    NOTA: Asegúrese de que el animal está respirando adecuadamente antes de proceder.
  5. Administrar la mezcla lentamente, retirar el tubo lentamente tirando de la jeringa, y suelte el ratón. Aplicar suplementos nutricionales una vez al día por alimentación forzada durante el curso del experimento colitis.

3. Determinación del Índice de Actividad de la Enfermedad

NOTA: El índice de actividad de la enfermedad es la combinación de las puntuaciones para la pérdida de peso, sangrado perianal y consistencia de las heces, que son obcontenida diaria 13.

  1. Medir el peso corporal al día y asignar una puntuación de 0 a 4 de acuerdo con el porcentaje de pérdida de peso (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, y 4:> 20 %).
    NOTA: Peso corporal pérdida se determina calculando la diferencia en porcentaje entre el peso basal antes de la inducción de colitis por DSS y el peso real.
  2. Para determinar el nivel de sangrado perianal, se recoge una muestra de materia fecal fresca y utilizar los aplicadores previstos para aplicar una capa delgada sobre un portaobjetos de un kit de prueba de sangre oculta en heces guayaco. Utilice un aplicador nuevo para cada muestra.
    1. Cierre la cubierta en la parte delantera y abra la ventana en la parte posterior de la diapositiva. Aplicar dos gotas de la solución de revelado a la parte posterior en la ubicación de la muestra.
    2. Lea los resultados después de 30 s. Cualquier rastro del color azul es positivo para sangre oculta. Asignar una puntuación de 0 a 4 (0: ninguno, 0,5 - 2,5: guayacol en heces positivo Examen de sangre oculta (dependiendo de la intensidad de la señal), y 3 - 4: grosangrado ss).
      NOTA: Si la sangre en las heces es visible, la prueba de sangre oculta en heces guayaco no tiene que ser realizado, y una puntuación de 3, 3,5, o 4 está asignado, dependiendo de la cantidad de sangre visible.
  3. Determinar consistencia de las heces mediante la observación de una muestra de heces frescas. Asignar una puntuación de 0 a 4 (0: sólido, 0,5 normales / - 2,5: heces pastosas y 3 - 4: diarrea).

4. Determinación Intestinal epitelial Permeabilidad in vivo por Evans Blue Ensayo

  1. Anestesiar a los animales mediante la inyección por vía intraperitoneal con una mezcla de ketamina (100 mg / kg de peso corporal) y xilazina (13 mg / kg de peso corporal) diluido en solución salina (0,9% NaCl), y evaluar la profundidad de la anestesia mediante la supervisión de la pizca reflejo de retirada.
  2. Coloque los animales anestesiados en una posición supina y realizar una laparotomía para exponer los intestinos.
  3. Localizar el ciego y hacer una pequeña incisión en el segmento proximal del colon unascendens (idealmente, inmediatamente adyacentes al ciego).
  4. Insertar una aguja de alimentación (G-22) y fijarlo con una ligadura usando un hilo de seda común. Limpiar, cuidadosamente abundante PBS a través del tubo para enjuagar todas las heces en el colon. Infundir solución azul de Evans (1,5% w / v en PBS) en el colon hasta que llega al ano.
  5. Incubar el azul de Evans durante 15 minutos. Lave el colorante lavando el tubo con abundante PBS hasta que el lavado perianal es clara.
  6. La eutanasia a los animales por dislocación cervical.
  7. Extirpar el colon y enjuague nuevamente con abundante PBS. Enjuagar una vez con 1 ml de 6 mM N-acetilcisteína en PBS para eliminar cualquier colorante se adhiera a la mucosa colónica.
  8. Cortar el colon longitudinalmente y enjuague una vez más con PBS y 1 ml de 6 mM N-acetilcisteína.
  9. Anotar el peso y longitud. Para extraer el colorante azul de Evans, colocar los dos puntos en 2 ml de N, N-dimetilformamida durante la noche a temperatura ambiente con suave agitationorte. Medir la concentración de colorante por espectrofotometría a 610 nm.

5. Colección de Tejidos

  1. Anestesiar a los animales mediante la inyección por vía intraperitoneal con una mezcla de ketamina (100 mg / kg de peso corporal) y xilazina (13 mg / kg de peso corporal) diluido en solución salina (0,9% NaCl), y evaluar la profundidad de la anestesia mediante la supervisión de la pizca reflejo de retirada.
  2. La eutanasia a los animales por dislocación cervical.
  3. Colocar los animales en decúbito supino y realizar una laparotomía para exponer la cavidad abdominal.
  4. Con unas tijeras, diseccionar todo el colon y registrar su longitud.
  5. Enjuague el colon cuidadosamente varias veces con PBS enfriado para eliminar las heces. Registrar el peso del tejido y prepararse para los siguientes experimentos, como se describe en los pasos 5.6 - 5.8.
  6. Para los ensayos de mieloperoxidasa (MPO) y el aislamiento de ARN, cortar una muestra de tejido del tamaño adecuado (100 mg es generalmente suficiente), colocarlo dentro de un tubo, y SNAp-congelarlo en nitrógeno líquido. Guarde los tejidos a -80 ° C para uso futuro.
  7. Para la tinción de inmunofluorescencia y la determinación del estrés oxidativo (véase más adelante), cortar una pequeña muestra de colon (0,5 - 1 cm) y sumerja en pequeños recipientes de aluminio rellenas de compuesto temperatura óptima de corte (OCT). Coloque las tazas en hielo seco y dejar que ellos se congelan lentamente, con el fin de evitar la formación de burbujas. muestras de tejido congeladas se pueden almacenar a -80 ° C para uso futuro.
  8. Para suiza rueda 14, abrir el colon longitudinalmente y retirar con cuidado las heces usando fórceps. Enrollarlo, con la mucosa hacia el interior, con unas pinzas de punta fina o un palo de madera fina, redonda. Que lo coloque dentro de un casete de inclusión y continúe con el paso 6.1.
    NOTA: DSS induce daño en el colon. Sin embargo, la distribución daño varía desde el proximal hasta el colon distal, con más daños por lo general visto en el colon distal y el recto. Por lo tanto, se recomienda el análisis de la histología, ya sea en el col distalsobre o en papeles suizos de todo el colon.

6. Análisis de Histología de colon por la tinción con hematoxilina-eosina

  1. Preparación de tejidos
    1. Para el análisis histológico, sumergir cualquiera de los brazos de gitano o los pequeños trozos de tejido de ciertas regiones del colon de ratones control y tratados en 5 ml de 10% de formaldehído durante 48 h a temperatura ambiente (RT) para conseguir una fijación adecuada.
      NOTA: Todos los pasos adicionales en el paso 6 se llevan a cabo a temperatura ambiente, a menos que se indique lo contrario.
    2. Lavarlos con agua del grifo durante 18 h.
    3. Deshidratar con 15 ml de 70% de etanol durante 1 h, 96% durante 1 h, y etanol absoluto durante 1 h. Repita cada paso con alcohol fresco antes de proceder a la siguiente concentración.
    4. Continuar la deshidratación en una mezcla de 7,5 ml de etanol absoluto y 7,5 ml de xileno absoluta de 1 h. Repetir una vez antes de pasar las muestras a 15 ml de xileno absoluta de 1 h. Repita este paso una vez con xileno fresco.
    5. Incorporación de muestras de tejido de colon en parafina
      1. Sumergir las muestras en 50 ml de aceite de parafina durante 17 h. Repita este paso una vez, pero sólo el 3 h.
      2. Sumergir las muestras en cubos (de plástico, molde cuadrado, tamaño: 22 x 22 x 22 mm) en 810 ml de aceite de parafina.
      3. Dejar que la parafina con las muestras de tejido de colon se solidifique durante 24 h a TA.
    6. Corte de tejido secciones transversales utilizando un micrótomo
      1. Cortar muestras de colon utilizando un micrótomo, de acuerdo con las instrucciones del fabricante, en un espesor de 5 micras.
      2. Recoge los recortes en un baño de agua (1 l) que contiene 0,3% de gelatina. Esto impide el plegado de tejido secciones transversales. Recuperar las secciones de tejido y montarlos en portaobjetos de vidrio.
    7. Hematoxilina y eosina de tejido secciones transversales
      1. Desparafinar las muestras durante 18 horas a 60 ° C en una incubadora. Para este fin, utilizar un cristal slide estante con un mango.
      2. Después de deparaffinization, sumergir los portaobjetos en 70 ml de xileno absoluta durante 5 min. Repita este paso una vez con xileno fresco.
      3. La transferencia de las muestras en 70 ml de alcohol absoluto durante 1 min. Repita este paso una vez con el alcohol fresco.
      4. Incubar las muestras de tejido de colon en 70 ml de etanol al 96% durante 1 min. Repita este paso una vez con el alcohol fresco.
      5. Lavar las muestras en agua del grifo dos veces durante 2 s.
      6. Incubar los tejidos en hematoxilina de Harris durante 7 min.
      7. Lavar las muestras en agua del grifo dos veces durante 2 s.
      8. Se incuban las muestras en alcohol ácido (70 ml de etanol al 70% y 700 l de 1 M de ácido clorhídrico) durante 7 s.
      9. Lavar las muestras en agua del grifo dos veces durante 2 s.
      10. Incubar las muestras de tejido en 70 ml de carbonato de litio (1 g de carbonato de litio en 100 ml de agua destilada) durante 7 s.
      11. Lavar las muestras en agua del grifo dos veces durante 2 s.
      12. Se incuban las muestras en 70 ml de etanol 80% Para 1 min.
      13. La transferencia de las muestras en 70 ml de eosina-Y durante 15 s.
      14. Incubar en 70 ml de 96% de etanol durante 1 min. Repita este paso una vez con el alcohol fresco.
      15. Incubar las muestras de tejido en 70 ml de etanol absoluto (alcohol etílico anhidro absoluto) durante 1 min. Repita este paso una vez con el alcohol fresco.
      16. Se incuban las muestras en 70 ml de una mezcla de 35 ml de alcohol absoluto y 35 ml de xileno absoluta de 1 min.
      17. La transferencia de las muestras en 70 ml de xileno absoluta durante 1 min. Repita este paso durante 5 minutos en 70 ml de xileno absoluta fresco.
      18. Añadir 80 l de resina sintética para las muestras de tejido de colon, los cubren con cubreobjetos, y dejar secar durante 24 horas a temperatura ambiente. Por último, analizar las muestras utilizando microscopía de campo brillante 8.

    7. Analizar Junction Composición por inmunofluorescencia

    1. Preparar el tejido como se describe en el paso 5.7 y cortar 8 micras de espesor secciones transversalesusando un criostato.
    2. Fijar y permeabilizar de colon secciones transversales con etanol al 96% a -20 ° C durante 20 minutos.
      NOTA: Todas las incubaciones posteriores deben llevarse a cabo a temperatura ambiente, a menos que se indique lo contrario, en una caja oscura húmeda para evitar el secado y fluorocromo desvanecimiento.
    3. muestras de aire seco, y luego enjuagar 3 veces durante 5 minutos cada uno con PBS 1x
    4. Se incuban las muestras con solución de bloqueo (PBS que contiene 0,01% de Tween y 2% BSA) durante 2 h.
    5. Retire la solución de bloqueo y enjuagar con PBS-Tween al 0,01% durante 10 min.
    6. Durante este tiempo, diluir los anticuerpos primarios a las concentraciones deseadas en PBS-Tween 0,01%.
    7. Quitar la solución de lavado, aplicar la solución de anticuerpo de la etapa anterior, y se incuba durante la noche a 4 ° C en una caja humidificada.
    8. Retirar la solución de anticuerpo y lavar 3 veces con PBS-Tween 0,01% durante 5 min cada uno y una vez con agua desionizada durante 10 minutos, con agitación muy suave.
    9. Durante el lavado, fluor centrífugaochromeconjugated, específico de la especie anticuerpos secundarios a 14.000 xg durante 20 min a 4 ° C.
    10. Diluir los anticuerpos secundarios sin precipitados según lo indicado por el proveedor en PBS-Tween 0,01%, aplicarlas, y se incuba durante 1 hora a temperatura ambiente.
    11. Repita el paso 7.8 y eliminar la solución de lavado lo más completamente posible.
    12. Pipeta de 4 l de agente anti-decoloración con cada muestra en la diapositiva.
    13. Cubrir las muestras con un cubreobjetos.
    14. Deje secar al aire durante 1 h.
    15. Sello de diapositivas con esmalte de uñas. Las diapositivas se pueden almacenar a -20 ° C hasta su posterior análisis.
    16. Analizar en un microscopio láser confocal 8.

    8. Determinación del estrés oxidativo mediante la oxidación de etidio

    1. Después de 7 días de DSS colitis, preparar el tejido como se describe en el paso 5.7 y cortar secciones de colon en un criostato con un espesor de 5 micras. Mount secciones transversales en portaobjetos de vidrio tratados con solución de lisina poli-L-e incubar la ingenio muestrash 5 M de dihydroethidium (DHE) en agua a 37 ° C durante 30 min en la oscuridad.
    2. Lavar las muestras con PBS (pH 7,6) tres veces durante 15 min cada uno con agitación suave a temperatura ambiente. Secar las muestras y añadir una gota de medio de montaje para proteger la fluorescencia. Observar la fluorescencia de etidio oxidado en un microscopio láser confocal de barrido (aumento 40X, 568 nm longitud de onda).

    9. Análisis de reclutamiento de leucocitos mediante el ensayo de MPO

    1. Después de 7 días de DSS colitis, recoger tejido de colon y homogeneizar las muestras (200 a 400 mg) con 1 ml de hexadeciltrimetilamonio (HTAB) tampón (0,5% HTAB en tampón fosfato 50 mM, pH 6,0) utilizando un homogeneizador en hielo.
    2. Enjuague la punta del homogeneizador dos veces con 1 ml de tampón HTAB para incluir todos los tejidos en el lisado y sonicar cinco veces en 40% de amplitud durante 10 s cada uno. Congelación-descongelación en nitrógeno líquido tres veces.
    3. Centrifugar a 14.000 xg durante 15 min y se recoge el sobrenadante.Preparar 2,2'-azino-bis solución (3-etilbenzotiazolina-6-sulfónico) (ABTS) mediante la mezcla de ABTS, 5 ml de citrato de sodio (1 M en agua), 0,1 ml de peróxido de hidrógeno y 45 ml de bi -agua destilada.
    4. Mezclar 0,1 ml de cada sobrenadante con 0,1 ml de ABTS solución en una placa de 96 pocillos de fondo plano. Después de 10 min, se mide la absorbancia a 460 nm utilizando un espectrofotómetro.

    10. Evaluación de la expresión de las citoquinas pro-inflamatorias por PCR

    1. La homogeneización del tejido
      1. Homogeneizar 50 a 100 mg de muestras de tejido de colon en 1 ml de una mezcla de tiocianato de guanidinio-fenol-cloroformo de ácido usando un homogeneizador de energía.
      2. Incubar a temperatura ambiente durante 15 min.
    2. La separación de fase
      1. Añadir 0,2 ml de cloroformo y agitar vigorosamente durante 30 s.
      2. Se incuba a 4 ° C durante 30 min.
      3. Centrifugar a 12.000 xg durante 60 min a 4 ° C.
      4. La transferencia de la Upper fase acuosa a un tubo nuevo (~ 500 l).
    3. ARN precipitación y resuspensión
      1. Añadir 0,5 ml de alcohol isopropílico y se incuban las muestras a 4 ° C durante 60 min.
      2. Centrifugar a 12.000 xg durante 30 min a 4 ° C.
      3. Eliminar el sobrenadante por completo.
      4. Añadir 1 ml de etanol al 75% y agitar.
      5. Centrifugar a 12.000 xg durante 30 min a 4 ° C.
      6. Eliminar el sobrenadante.
      7. Permitir que el etanol restante se seque al aire durante 3-5 minutos.
        NOTA: Es importante no dejar que el precipitado de ARN se seque por completo, ya que esto reduciría enormemente su solubilidad.
      8. Re-disolver el precipitado en 0,3 ml de pirocarbonato de dietilo (DEPC) de agua tratada. Inmediatamente transcribir las muestras de ARN en ADNc (más estables, consulte el paso 10.5) o almacenar a -80 ° C.
    4. Cuantificación de ARN
      1. Diluir 1 l de ARN con 99 l de agua tratada con DEPC.
      2. Leer THe DO a 260 nm y 280 nm utilizando un espectrofotómetro UV / VIS para determinar la concentración de la muestra y de la pureza.
    5. Síntesis de ADNc
      1. Mezclar las muestras de ARN (1-5 mg) con 1 l de oligo (dT) 12-18 (0,5 g / l) y agua tratada con DEPC (volumen total de 12 l) en tubos estériles RNasa libre.
      2. Incubar a 70 ° C durante 10 min.
      3. Añadir 2 l de 10x tampón de PCR, 1 l de 50 mM MgCl 2, 1 l de mezcla de dNTP 10 mM, y 2 l de 0,1 M de ditiotreitol (DTT).
      4. Se incuba a 4 ° C durante 5 min.
      5. Añadir 1 l de la transcriptasa inversa y se incuba a 42 ° C durante 5 min.
      6. Incubar a 70 ° C durante 15 min.
      7. Se incuba a 4 ° C durante 15 min. cDNA se puede almacenar a -20 ° C hasta su uso posterior.
    6. PCR
      1. Mezclar 2,5 l de 10x tampón de PCR, 1,5 l de 25 mM MgCl 2, 0,5 l de dNTP 10 mM de la mezcla, 0,25 μL de Taq ADN polimerasa, 0,25 l de cada cebador (10 M) y ADNc (100 ng), y agua estéril hasta un volumen total de 25 mL.
      2. Ejecutar las muestras en un termociclador de 96 pocillos. Para evitar la amplificación de ADN genómico, cebadores directo e inverso deben estar ubicados en diferentes exones: IL1β-FW: GCAACTGTTCCTGAACTCAACT y IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA e IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT y KC-RE: CCTGAGGGCAACACCTTCA; y actina-FW: TATCCACCTTCCAGCAGATGT y actina-RE: AGCTCAGTAACAGTCCGCCTA. Use las siguientes condiciones de PCR: 95 ° C durante 5 min seguido de 30 ciclos a 95 ° C durante 15 s, 58 ° C durante 30 s, y 72 ° C durante 30 s, más una extensión final de 10 min a 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Suplementos de dieta puede proteger de la colitis DSS

suplementos de dieta Anti-inflamatorias y anti-oxidantes, tales como ácidos grasos omega 3-poliinsaturados vitamina C, la vitamina E, el óxido nítrico (NO) -source L-arginina, y (omega 3-PUFAs), se han utilizado con éxito variable en animales modelos para aliviar los síntomas de enfermedades inflamatorias 3,6,15. La malnutrición, el estrés oxidativo y la producción de citoquinas pro-inflamatorias pueden desencadenar tanto la colitis aguda y crónica 3. En un estudio anterior, hemos demostrado que una combinación de micronutrientes mostró efectos protectores contra la colitis inducida por DSS en vivo. A continuación, ofrecemos protocolos detallados sobre cómo se midieron estos efectos 8. En primer lugar, se analizaron los efectos de los suplementos nutricionales en progresión de la enfermedad mediante la determinación del índice de actividad de la enfermedad (DAI), que consta de los tres parámetros de la pérdida de peso,consistencia de las heces, y el sangrado perianal. Los resultados representativos mostraron que el tratamiento DSS llevó a un DAI continuamente creciente, como se esperaba, alcanzando un máximo de 8,2 ± 0,46 en el día siete (Figura 1A). la administración de suplementos de dieta anti-inflamatoria retrasó el inicio de la colitis, pero en momentos posteriores, cuando la colitis era muy fuerte, el efecto protector fue marginal y ya no estadísticamente significativa, lo que sugiere que los suplementos de la dieta solamente son eficaces cuando la colitis aún no es demasiado fuerte. Es importante destacar que la intervención dietética podría impedir el aumento inducida por DSS en la permeabilidad del epitelio intestinal, que es una característica importante de la colitis (Figura 1B). DSS colitis llevó a longitudes de colon reducidos, y este acortamiento también se ha mejorado por el suplemento de la dieta anti-inflamatorio y anti-oxidativo (Figura 1C). Por lo tanto, los síntomas clínicos de la colitis de hecho pueden ser aliviados por los cambios en la composición de dieta.

Para analizar por qué la colitis progresión fue menos severa en los animales que recibieron un suplemento de dieta, la morfología del tejido fue investigado después de hematoxilina / eosina (H / E) tinción de los tejidos del colon distal incluidos en parafina. Las muestras de control mostraron una morfología normal (Figura 2A, panel superior), mientras que los animales tratados con 3,5% DSS mostraron signos típicos de la colitis (es decir, la infiltración de leucocitos, formación de edema, displasia cripta, y ulceraciones; Figura 2A, panel central). De nota, el tratamiento paralelo con la suplementación de la dieta claramente aliviado cambios morfológicos colitis inducida, con una morfología general que era más comparable con el grupo control (Figura 2A, panel inferior). Estas observaciones fueron muy similares a lo que ha sidoreportado para los compañeros de tratamientos con bacterias probióticas 13 y muestran claramente que los cambios en la dieta pueden contrarrestar el desarrollo de la colitis.

Que ya se sabía que la permeabilidad del epitelio intestinal colitis inducida podría ser contrarrestado por la suplementación de la dieta. Aumento de la permeabilidad es un sello distintivo de la EII, y es en gran parte causado por el desmontaje de las uniones adherentes estabilizadores (AJ) y las uniones estrechas (TJ). La desestabilización de los contactos de células epiteliales de la internalización de proteínas de unión es inducida por las citoquinas pro-inflamatorias, que son producidos en abundancia durante colitis 16. Hemos encontrado, a través de la tinción de inmunofluorescencia de tejido del colon distal, que se internalizan los TJ molécula zonula occludens-1 (ZO-1) y la molécula AJ E-cadherina en la colitis inducida por DSS y que co-localización de estas proteínas fue en parte perdida en los contactos de células epiteliales de las criptas (Figura 2B). yomportantly, la internalización de E-cadherina y ZO-1 se redujo cuando los ratones tratados con DSS fueron co-tratado con un suplemento de la dieta anti-inflamatorio y anti-oxidativo (Figura 2B). En general, las estructuras de las criptas y de unión eran más comparables a los controles cuando se aplicó el suplemento de la dieta, lo que sugiere que el efecto protector observado fue al menos en parte debido a la preservación de la arquitectura del tejido.

La intervención dietética puede contrarrestar inflamatoria de neutrófilos reclutamiento, el estrés oxidativo y la producción de citoquinas pro-inflamatorias

Otra característica de la EII es la infiltración de neutrófilos no controlada. Neutrófilos reclutados contribuyen al daño tisular mediante la producción y liberación de especies reactivas de oxígeno (ROS) y proteasas 17. El uso de un ensayo de actividad de MPO, encontramos una fuerte reclutamiento de neutrófilos en el colon en respuesta a DSS, que fue contrarrestadopor la suplementación de la dieta (Figura 3A).

El estrés oxidativo es otra característica importante de la colitis, causada por la liberación de ROS por los neutrófilos reclutados. De este modo, se analizó la producción de ROS en el colon secciones transversales. Figura 3B demuestra que el tratamiento con DSS firmemente el aumento de estrés oxidativo. De nota, cambios en la dieta se impide totalmente inducida por DSS-estrés oxidativo (Figura 3B), que es más probablemente una consecuencia de la reducción del reclutamiento de neutrófilos (Figura 3A).

Citoquinas pro-inflamatorias y quimiocinas se producen fuertemente por diversos tipos de células durante 18 colitis. Tales mediadores inflamatorios contribuyen al reclutamiento y la proteína de unión de internalización-características de neutrófilos que ya sabíamos que podría ser atenuada por los cambios en la dieta. Análisis de la expresión de ARNm por RT-PCR reveló que DSSaumento de la expresión de IL1β, IL-6, y quimiocinas de queratinocitos derivados (KC), como se esperaba (Figura 3C), y que la suplementación de la dieta anti-inflamatoria disminuyó este aumento inducida por DSS (Figura 3C). Estos datos implican que los suplementos de la dieta de hecho pueden servir para contrarrestar los signos clínicos de la EII.

Figura 1
Figura 1. Los suplementos nutricionales pueden aliviar Índice de actividad de la enfermedad, la permeabilidad epitelial intestinal, y el acortamiento de colon. (A) El índice de actividad de la enfermedad (DAI, los valores de 0 - 12) se compone de los tres parámetros de la pérdida de peso, consistencia de las heces, y el sangrado perianal y se registró diariamente en los grupos experimentales de control (ctrl), colitis y colitis + suplemento nutricional (colitis + supl.). El grupo de control no mostró ningún signo de la colitis, lo que resulta en un DAI de 0 throughout el periodo experimental. n = 5 por grupo. (B) la permeabilidad epitelial intestinal se midió por la fuga de azul de Evans en los grupos experimentales mencionadas anteriormente y se expresó como la absorción a 620 nm por g de tejido. n = 8 por grupo. Todos los datos se muestran como la media ± la desviación estándar de la media (SDM). * P <0,05; ** P <0,01; *** P <0,001. Las estadísticas se calcularon por ANOVA de una vía. (C) Imágenes representativas de los dos puntos enteros de los respectivos grupos experimentales después de 7 días de tratamiento. La escala de la izquierda es en cm. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Morfología y Tejidos Junction Arquitectura se conservan mejor durante la colitis cuando se aplica nutricional Supplements. (A) parafina sección transversal 5-m de biopsias de tejido de los dos puntos distales de los respectivos grupos experimentales fueron teñidas con hematoxilina / eosina y se analizó para signos típicos de la colitis, tales como la formación de edema (flechas), la infiltración de leucocitos (puntas de flecha), y ulceración (*). la morfología del tejido general de la colitis + supl. grupo más se asemeja a la del control que el grupo de colitis, lo que demuestra un efecto protector global contra DSS colitis. Las imágenes son representativos de 3 preparaciones de tejidos independientes por grupo. Las imágenes fueron tomadas usando un objetivo de 10X. Bar = 100 micras. (B) 8 micras de colon crio-secciones de los grupos respectivos se tiñeron con anticuerpos contra ZO-1 (verde) y E-cadherina (rojo). Co-localización (amarillo en las imágenes fusionadas; flechas) de E-cadherina y ZO-1 en las células epiteliales de las criptas contactos, que se pierde durante la colitis, se conserva en su mayoría en la colitis + supl. grupo. Las imágenes son representativas de 3preparaciones de tejido independientes. Bar = 50 micras. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. El reclutamiento de neutrófilos, el estrés oxidativo y la producción de citoquinas pro-inflamatorias pueden reducirse mediante suplementos nutricionales. Se midió la actividad (A) de mieloperoxidasa (MPO) para analizar la cantidad de reclutamiento de leucocitos en los tejidos de colon en los grupos experimentales: control (ctrl), colitis y colitis + suplemento nutricional (colitis + supl.). n = 5 por grupo; * P <0,05. Los datos se muestran como la media ± SDM. Las estadísticas se calcularon por ANOVA de una vía. (B) La fluorescencia de etidio oxidado, representado en rojo como la medida del estrés oxidativo en 8-micras crio-secciones de colon tejidos, se registró mediante microscopía confocal láser. Las imágenes son representativos de 3 preparaciones de tejidos independientes. Bar = 100 micras. (C) La producción de las citoquinas pro-inflamatorias IL1β e IL-6 y el de quimioquinas KC se determinó por semi-cuantitativos RT-PCR en un gel de agarosa al 1,5% (en blanco y negro se revirtió en aras de la claridad). β-actina sirvió como la limpieza de genes. se muestran imágenes representativas de tres preparaciones de ADNc independientes. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Con el fin de utilizar suplementos nutricionales en los estudios clínicos, los beneficios y la seguridad de estos suplementos deben ser cuidadosamente evaluados in vivo en estudios con animales. En el caso de colitis, varios modelos animales adecuados que se asemejan a los signos clínicos de la EII se han establecido, incluyendo modelos químicos usando DSS, TNBS, o en ácido acético; knock-out (KO) los modelos tales como IL10-KO; y colitis de células inmune mediada por el uso de la transferencia adoptiva de células T 19-21. El modelo DSS de colitis es un método rápido y fiable de la inducción de colitis que se asemeja a muchos síntomas de la enfermedad de la EII humana y se ha utilizado en una gran cantidad de estudios que investigan los mecanismos moleculares de la colitis 22. Por otra parte, DSS colitis es reversible y por lo tanto también permite el estudio de la cicatrización de los tejidos después del estímulo colitogenic se ha eliminado. El protocolo al que se describe en detalle el modelo de colitis DSS que ha sido optimizado previamente en nuestro laboratorio 8.

23. Además, el DSS debe estar en un rango de peso molecular de 40 - 50 kDa para inducir colitis. Para el investigador inexperto, será importante desarrollar un ojo para una evaluación objetiva de los parámetros del DAI de consistencia de las heces y hemorragia perianal. Si la evaluación se lleva a cabo por un investigador sin experiencia, es recomendable tener un compañero de confirmar la evaluación, a ser posible de una manera ciega.

Para el análisis de la permeabilidad epitelial intestinal para macromoléculas, tres métodos principales se han utilizado en la literatura: el ensayo de colorante azul de Evans, como se describe aquí; la instilación de 4 kDa FITC-dextrano en un asa intestinal; y la alimentación de 13,24,25 4 kDa FITC-dextrano. En este último ensayo, FITC-dextrano se alimenta por sonda, Y la cantidad de FITC dextrano que cruzó el epitelio y se filtró en la corriente de la sangre se mide fluorométricamente a partir de muestras de suero. En este ensayo, se mide la permeabilidad de todo el tracto gastrointestinal, ya que el trazador pasa todo el camino desde el esófago hasta el recto y la mayoría del trazador pasará antes de alcanzar el colon. En el modelo de bucle, la permeabilidad se mide en una región intestinal confinado utilizado para el bucle (normalmente el intestino delgado) 25. Por el contrario, el ensayo de azul de Evans tiene la ventaja de que sólo la permeabilidad epitelial en el colon se mide, ya que el trazador se instila directamente en todo el colon. Por lo tanto, utilizando este ensayo, se puede concluir que el epitelio del colon está protegido por el suplemento de la dieta.

Siempre es importante registrar el peso y la longitud del colon después de la extracción y antes de utilizar los tejidos para otros ensayos, debido a que algunos datos (por ejemplo, se filtraron azul de Evans en la permeabilidad ASSAy) se expresan por g de tejido. Además, la relación de peso a longitud es una lectura de salida independiente de daño a los tejidos 26. En general, la morfología del tejido se analiza utilizando tejidos embebidos en parafina teñidas con hematoxilina y eosina, tal como se describe aquí. inclusión en parafina tiene la ventaja de que la morfología de los tejidos es mucho mejor conservada en comparación con otros métodos de incrustación. Esto permite la identificación inequívoca de diferentes tipos de células dentro de la mucosa (es decir, las células inmunes, epitelio, células caliciformes, etc.) y el análisis de alteraciones de los tejidos durante la colitis, tales como la formación de edema, infiltración de leucocitos, y erosiones epiteliales apicales. Por otro lado, la parafina tiene la desventaja de que la tinción de inmunofluorescencia sólo se puede realizar después de la recuperación epítopo tiempo. Por lo tanto, siempre nos preparamos diferentes biopsias de tejidos congelados incrustados en compuesto OCT. Tales muestras de tejido pueden ser seccionados fácilmente usando un criostato y muestran bajos niveles de autofluorescence. Utilizamos el etanol para la fijación por deshidratación porque tampoco interfiere con los filamentos de actina (como metanol lo hace), ni tampoco lo haga saltar autofluorescencia (como lo hace PFA). El uso de estas técnicas, se encontró que un suplemento de la dieta anti-inflamatorio y anti-oxidante puede mejorar la morfología del tejido y la arquitectura de unión durante la colitis (comparar Figura 2).

Reclutamiento excesivo de neutrófilos es un evento crítico durante colitis que es inducida por la producción de factores quimiotácticos en respuesta a la inflamación 17. reclutamiento de neutrófilos es un acontecimiento fisiológico porque los neutrófilos contribuyen a la eliminación de la señal inflamatoria y a la posterior curación de la herida. Sin embargo, si esta respuesta inmune innata no está debidamente controlado y terminado, los neutrófilos en la mucosa pueden contribuir al daño tisular por la liberación de proteasas y especies de oxígeno reactivo. Los neutrófilos contienen MPO, que se puede medir fácilmente y se cuantificaron usando unaensayo colorimétrico, donde la cantidad de MPO es directamente proporcional a la cantidad de neutrófilos. La figura 3A muestra que los neutrófilos reclutamiento aumenta durante la colitis y que la intervención dietética puede prevenir esta respuesta inmune excesiva e incontrolada. De acuerdo con la presencia de neutrófilos abundante en la mucosa, el estrés oxidativo aumenta durante la colitis (Figura 3B).

Nuestra administración de suplementos de dieta claramente protege la mucosa del estrés oxidativo, lo que es más probable consecuencia de la reducción del reclutamiento de neutrófilos. Como se ha mencionado, los neutrófilos son atraídos por las quimioquinas y la producción de quimiocinas es inducida por las citoquinas pro-inflamatorias que son secretadas por diversos tipos de células durante la colitis. Por lo tanto, se asumió que el reclutamiento de neutrófilos reducida es una consecuencia de la reducción de citoquinas y la producción de quimioquinas. La Figura 3C demuestra que las citoquinas pro-inflamatorias IL-1β y IL-6, así como laquimioquinas KC, se regula positivamente durante la colitis inducida por DSS. El suplemento de la dieta invirtió los niveles de IL-6 de nuevo a los niveles de control y mejoró la mayor producción de IL-1β y KC. Es de destacar que KC es el más importante quimioatrayente para los neutrófilos en ratones.

Por lo tanto, es tentador especular que la preservación de la morfología del tejido observada es debida a la reducción de la infiltración de neutrófilos, que es, a su vez, una consecuencia de la reducción de la producción de KC. El análisis de la producción de ARN en los tejidos tratados con DSS por RT-PCR es problemático cuando DSS residual está presente en el ARN aislado. Esto se debe a DSS inhibe tanto las transcriptasas inversas y Taq polimerasas. Si no se puede lograr la amplificación, será necesario purificar aún más las muestras de ARN mediante precipitación mediada por LiCl, como se describe en otra parte 27.

En resumen, se describen en detalle los diferentes métodos para el análisis de daño tisular durante la colitis DSS y cómo este dAmage se puede mejorar por los suplementos dietéticos. Los conocimientos derivados de este tipo de experimentos con animales pueden justificar el establecimiento de cohortes de pacientes para investigar los efectos protectores de los suplementos analizados en la EII humana. Los datos obtenidos de los estudios clínicos pueden entonces abrir nuevas vías para desarrollar estrategias de tratamiento alternativas para el tratamiento de la EII.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por subvenciones del Consejo Nacional de Ciencia y Tecnología (Conacyt, 207268 y 233395 a Michael Schnoor). KFCO es un beneficiario de una beca del Conacyt (396260) para obtener un grado de maestría.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analizar los efectos beneficiosos de los suplementos nutricionales sobre las funciones epitelial intestinal de barrera durante Experimental Colitis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter