Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Bottlenose Dolphin (bred snute truncatus) Spermatozoa: innsamling, kryonisk bevaring og Heterologous I Vitro fertilisering

doi: 10.3791/55237 Published: August 21, 2017

Summary

Her presenterer vi som har blitt brukt for dolphin spermatozoa samling, kryonisk bevaring og heterologous IVF ytelse ved hjelp av bovin oocytes.

Abstract

Bruk cryopreserved dolphin spermatozoa muliggjør utveksling av genetisk materiale mellom vannparker og gjør spermatozoa tilgjengelig for laboratorier for studier for å fremme vår forståelse av marine pattedyr reproduksjon. Heterologous IVF, en erstatning for homologe IVF, kan gi et middel test sperm fruktbarhet potensielle; Kjønnscelle fysiologi og tidlig embryo utvikling; og for å unngå bruk av verdifulle dolphin oocytes, som er vanskelig å få. Her presenterer vi som har blitt brukt til å samle og cryopreserve dolphin spermatozoa. Samlingen av sæd er utført av manuell stimulering på utdannet delfiner. Kryonisk bevaring oppnås med en TRIS eggeplomme basert extender med glyserol. I tillegg presenterer vi en protokoll som beskriver heterologous IVF dolphin spermatozoa og storfe oocytes og som bekrefter hybrid natur resulterende fosteret bruker PCR. Heterologous befruktning reiser spørsmål på befruktning og kan brukes som et verktøy for å studere Kjønnscelle fysiologi og tidlig embryo utvikling. I tillegg viser suksessen til heterologous IVF potensialet i denne teknikken å teste dolphin sperm gjødsling kapasitet, som er verdt videre undersøkelser.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Assistert reproduktive teknologier utvikles dårlig i ville dyr, inkludert marine pattedyr. Mangel på sensitive metoder for å vurdere sperm gjødslende suksess bidrar til langsom utvikling reproduktive teknologier i arter som dolphin. Det var ikke før nylig at grunnleggende banebrytende parameterne for Tumlar (bred snute truncatus) var rapportert1,2. Men gir variabler som motilitet og morfologi, selv om mye brukt, begrenset informasjon på reproduktive effektivitet. Den beste indikatoren for kvaliteten er evalueringen av gjødslende potensial.

Nylig brukt vår gruppe en metode for å vurdere dolphin sperm gjødsling potensial ved å vurdere mannlige pronuclear formasjon og/eller hybrid embryoet formasjon etter heterologous IVF bruke zona intakt bovin oocytes3. Bruk av delfin-storfe heterologous IVF har viktige fordeler over homologe IVF, som det overvinner vanskelighetene med å skaffe dolphin oocytes og forenkler bruken av godt testet i vitro bovin oocyte modning systemer. For å unngå arter spesifisitet, utføres heterologous befruktning vanligvis i fravær av ZP. Selv om det tillater for vurdering av muligheten for acrosome-reagert spermatozoa å fusjonere med eggeplomme membranen, svekker det evalueringen av andre funksjoner for befruktning. Fremgangsmåten bruker zona intakt oocytes og tillater evaluering av følgende parametere: sperm zona bindende og vedlegg, penetrasjon, polyspermy, pronuclear formasjon og hybrid embryoet cleavage.

Her presenterer vi flere protokoller for sæd samling, grunnleggende sperm analyse, spermatozoa fryser samt evaluering av dolphin sperm funksjonaliteten ved å vurdere mannlig pronuclear og/eller hybrid embryoet formasjon etter heterologous IVF bruke zona intakt storfe oocytes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

etikk uttalelse: alle eksperimentelle prosedyrer blir gjennomgått og godkjent av institusjonelle Animal Care og bruk komiteen av Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). Alle forsøkene ble utført i henhold til guiden og bruk av forsøksdyr, som ble vedtatt av Society for studier av reproduksjon og det dyr velferd gjerning for omsorg for sjøpattedyr.

1. dolphin sæd samling og kryonisk bevaring

  1. forberedelse
    1. gjøre FERT medium (heparin - og hypotaurine-ledig). Forberede FERT-TALP medium med 25 mM bikarbonat, 22 mM natrium laktat, 1 mM natrium pyruvate, 6-mg/mL fettstoffer syre-fri BSA og 10 mg/mL heparin (pH 7.4).
      Merk: Forberede dette mediet ved bruk og holde det på 38,5 ° C, en atmosfære av 5% CO 2, og i luften med maksimal fuktighet for minst 2 timer før bruk.
    2. Forberede TRIS egg eggeplomme-baserte buffer. Oppløse 30.28 finans Tris, 16.75 finans sitronsyre, 12.5 finans fruktose og 0,5 finans streptomycin i ultrapure vann (pH 7.3, osmolality = 310 mOsm/kg). Legge til 20% eggeplomme (v/v).
  2. Trene en bevist avl mannlige Tumlar å ligge i dorsal recumbence nær kanten av bassenget for frivillig sæd samling.
    Merk: Den mannlige dolphin bør være trent over 6 måneder av positiv forsterkning, som beskrevet tidligere 4.
  3. Forsiktig Trykk på skallen området genital sporet av dolphin å lokke fram frivillige ekstrudering av penis fra genital sporet utføre ulike taktile stimulations.
  4. Etter å oppnå en full ereksjon, direkte penis spissen til et sterilt container for å få ejakulere.
  5. Behold sperm eksempel på 37 ° C før analysen. Gjenta trinn 1.3 og 1.4 for påfølgende ejakulere samlinger, bruker en ny propylen glass hver gang.
  6. Umiddelbart etter samling, bestemmer volumet ved hjelp av en gradert glass sylinder tidligere varmet 37 ° C. Evaluer fargen, pH og osmolaritet (med en mikro-osmometer) av ejakulere.
  7. å vurdere konsentrasjonen av spermatozoa i ejakulere, legge 10 µL av sæd suspensjon slik eppendorf som inneholder 90 µL destillert vann. Bestemme sperm konsentrasjonen med en sædceller telle kammeret.
    Merk: Under evaluering, holde resten av ejakulere på 37 ° C.
  8. Vurdere parameterne motilitet.
    1. Ta 10 µL av sæd utvalget og plassere den i en forvarmes sperm kammer.
    2. Vurdere motilitet med en computer-assistert sperm analysesystem, tidligere godkjent for Tumlar, å objektivt vurdere sperm motilitet 2.
      Merk: Eventuelt fortynne sperm prøven med FERT medium (heparin - og hypotaurine-gratis) for tilstrekkelig visualisering av Spermiemotilitet. Under evalueringen, opprettholde prøven på 37 ° C på en oppvarmet microscope scene.
  9. Ta 20 µL av sæd prøve og vurdere levedyktighet og sperm morfologi som beskrevet tidligere 5.
  10. Overføre sperm prøven slik sentrifuge. Sentrifuge sperm prøven 250 x g i 5 min. Etter finne sæd konsentrasjon bruke en telling kammer, justere sæd konsentrasjon til 400 x 10 6 spermatozoa/mL.
    Merk: Eventuelt fortynne pellet fra konsentrert ejakulerer med isolert banebrytende plasma fra en overflødig volum på samme ejakulere med sentrifugering (250 x g, 10 min).
    1. i løpet av 5 minutter, sakte fortynne sperm prøve 1:1 (v/v) med TRIS egg eggeplomme-baserte bufferen som inneholder 1,5% glyserol. Sett røret som inneholder sæd suspensjon på 5 ° C i 1 h 30
    2. Utføre en andre fortynning av sæd suspensjon med en TRIS egg eggeplomme-baserte buffer med glyserol for å få en 3% siste glyserol konsentrasjon og en siste konsentrasjon av 200 x 10 6 sperm/mL. Opprettholde sperm suspensjon på 5 ° C for 10 min.
  11. Laste sperm suspensjon i 0,25 mL sugerør. Heat-Seal strå. Strå i et stativ 4,5 cm over flytende nitrogen for 10 min. stupe strå i flytende nitrogen og lagre til evaluering.

2. Heterologous I Vitro fertilisering bruke Zona intakt bovin Oocytes

  1. forberedelse
    1. forberede den flekker løsning og montering medium.
      1. Forberede Hoechst lagerløsning ved å løse opp 1 mg Hoechst i 1 mL destillert vann. Gjør 30 µL dele og holde dem i mørket på 20 ° C før bruk. Forberede flekker løsning ved å legge til 25 µL av Hoechst lagerløsning 5 mL fosfat-bufret saltoppløsning (PBS) med 1 g/L PVA. Bland godt og holde i mørket på 4 ° C før bruk.
      2. Forberede montering medium ved å blande 6,25 mL PBS med 6,25 mL glyserol og 6,25 µL av Hoechst lagerløsning. Bland godt og holde i mørket på 4 ° C før bruk.
    2. Forberede mediet oocyte innsamling og i vitro fertilisering.
      1. Forberede saltvann ved å legge til 0,5 mL gentamycin 0,9% NaCl destillert vann.
      2. Forberede lager modning medium ved å legge 10 ng/mL epidermal vekstfaktor (EGF) og 10% fosterets kalv serum (FCS) til 10 mL av TCM-199. Beholde både media ved 38,5 ° C, under en atmosfære av 5% CO 2, og i luften med maksimal fuktighet for minst 2 timer før bruk.
  2. Samle eggstokkene ved slakteriet i saltvann på 33-35 ° C og transportere dem til laboratoriet innen 4 timer fra samlingen.
  3. En gang i laboratoriet, vask eggstokkene tre ganger å fjerne rusk og blod med saltvann tidligere varmet til 37 ° C. opprettholde eggstokkene i saltvann løsning på 37 ° C i løpet av prosessen.
  4. Leveringstanken 2 til 8 mm follikler med en 18G nål og en 10-mL sprøyte. Samle aspirerede follikulær væske i 50 mL rør.
  5. La follikulær væske som inneholder oocytes stå i ca 15 min ved 37 ° C, inntil celler sediment. Fjerne nedbryting av rør med en Pasteur pipette og å avbryte pellet PBS.
  6. Gjenopprette cumulus-oocyte komplekser (COCs) i 90 mm retter under en stereomicroscope.
  7. Vask COCs tre ganger i PBS og en gang i modning medium.
  8. Overføre morphologically normal COCs til 4-vel retter, hver også inneholder 500 mL modning medium, i grupper på 50 COCs per brønn.
    Merk: Her tre brønner – en brønn for heterologous IVF, en kontroll for homologe IVF og som også inneholder bare modnet COCs som en parthenogenetiske – ble brukt.
  9. Ruge COCs 24 h på 38,5 ° C, en atmosfære av 5% CO 2 og i luften med maksimal fuktighet.
  10. Forberede mediet og tetthet graderingen.
    1. å forberede befruktning medium (FERT), FERT-TALP medium med 25 mM bikarbonat, 22 mM natrium laktat, 1 mM natrium pyruvate, 6 mg/mL fettstoffer syre-fri BSA og 10 mg/mL heparin i tillegg. Opprettholde på 38,5 ° C, en atmosfære av 5% CO 2, og i luften med maksimal fuktighet for minst 2 timer før bruk.
    2. Forberede tetthet graderingen ved å legge til 1 mL av tetthet gradert medium til en 15-mL tube og 3 mL vaske løsning til en 15-mL tube. Opprettholde dem på 38,5 ° C i minst 1 h.
  11. Vask den i vitro modnet oocytes to ganger i FERT medium.
  12. Overføre oocytes til 4-vel retter, hver godt med 50 COCs i 250 mL av FERT. Opprettholde 4-vel rettene på 38,5 ° C, en atmosfære av 5% CO 2, og i luften med maksimal fuktighet mens forbereder sperm befruktning.
  13. Tine frosne sugerør som inneholder dolphin spermatozoa i et vannbad på 37 ° C for 50 s.
    Merk: Bovine sæd for homologe må behandles parallelt, etter standard protokoll for homologe bovin.
  14. Ta 10 µL av sperm smak og legg den i en forvarmes sædceller telle kammer. Evaluere motilitet med en computer-assistert sperm analysesystem, tidligere godkjent for arten, å objektivt vurdere Spermiemotilitet. Samtidig opprettholde sperm prøven på 38,5 ° C.
  15. Legge til sæd prøven tetthet gradert røret (trinn 2.10.2). Sentrifuge for 10 min på 250 x g.
  16. Forsiktig fjerne nedbryting bruker en Pasteur pipette. Legge 3 mL vask løsningen til røret som inneholder pellet. Nytt suspendere pellet ved å blande forsiktig.
  17. Sentrifuge for 5 min på 250 x g. fjerne nedbryting med en Pasteur pipette til et sperm volum av 300 µL.
  18. Legge til 5 µL av sæd suspensjon til en microcentrifuge som inneholder 95 µL destillert vann. Opprettholde sperm suspensjon på 38,5 ° C. fylle cellen telling kammer med 10 µL av 1:20 sperm fortynning og måle konsentrasjonen. Beregne mengden FERT medium som må legges til 100 µL av sæd å få 2 x 10 6 spermatozoa/mL.
  19. Legge det beregnede FERT og sperm volumet til en 15-mL tube og bland forsiktig med en Pasteur pipette.
  20. Legge til 250 µL av sæd-FERT suspensjon i hver brønn på 4-vel parabolen som inneholder FERT mediet med de modnet oocytes å få en endelig konsentrasjon av 1 x 10 6 spermatozoa/mL.
  21. Co ruge kjønnscellene 18 h på 38,5 ° C, en atmosfære av 5% CO 2, og i luften med maksimal fuktighet.
  22. Forberede kultur medium basert på syntetisk oviductal væske med 5% FCS. Forberede 25 µL av syntetisk oviductal væske kultur dråper i 35 mm retter dekket med 3 mL mineralolje. Opprettholde på 38,5 ° C, en atmosfære av 5% CO 2, og i luften med maksimal fuktighet for minst 2 timer før bruk.
  23. På 2,5 t innlegget co inkubasjon fjerne 20 oocytes fra parabolen, opprettholde de gjenværende oocytes i inkubator oppstiller.
    1. Fjerne løst tilknyttet spermatozoa ved kraftig pipettering halvparten av oocytes gjennom en smal-fødte Pasteur pipette 10 ganger.
    2. Fikse de 20 oocytes i 50 µL av 0,5% glutaraldehyde i 30 min. vask oocytes i PBS i 5 min. overføre oocytes til 50-µL av Hoechst flekker løsning for 15 min og vask oocytes i PBS i 5 min.
    3. Overføre oocytes individuelt til 2 µL dråper av montering medium med en hastighet på 10 oocytes per lysbilde. Forsiktig dekk med en dekkglassvæske og forsegle med neglelakk.
    4. Antall spermatozoa knyttet til storfe oocytes bruker en kontrast mikroskopet utstyrt med epifluorescent optikk og en 361 nm eksitasjon filter på 40 x forstørrelse.
  24. Etter 12 timer med co inkubering, fjerne 10 presumptive zygotes fra 4-vel rettene, opprettholde de gjenværende presumptive zygotes i inkubator oppstiller.
    1. Overføring på 10 presumptive zygotes til en 15-mL sentrifuge rør som inneholder 2 mL PBS og vortex forsiktig i 2 minutter for å fjerne cumulus celler. Vask to ganger i PBS, fastsette, og flekker, som beskrevet tidligere (trinn 2.23.2.)
  25. Etter 18, 20, 22 og 24 h co inkubering, fjerne 10 presumptive zygotes fra 4-vel retter og virvelen, fastsette, og stain dem som beskrevet tidligere (trinn 2.23.2). Opprettholde resten av presumptive zygotes i inkubator oppstiller.
    1. Evaluere pronuclear formasjon og polyspermy under mikroskop fase-kontrast/epifluorescent i begge homologe og heterologous IVF grupper av farging med Hoechst.
    2. Evaluere pronuclear formasjon i 10 tilfeldig valgt presumptive hybrid zygotes per prøve. Bekrefte pronuclear formasjon under en AC confocal laserskanning mikroskopet på 488-nm argon laser eksitasjon og 515 til 530 nm oppdagelsen.
    3. Optisk delen presumptive zygotes sekvensielt (2 mm) og samle bilder ved hjelp av en programvare. Visualisere bruker en 3D Analyser programvarepakke.
    4. 24 h med co inkubering, vaskes 50 presumptive zygotes fire ganger i PBS og to ganger i kultur medium.
  26. Overføre dem i grupper på 25 til microdroplets kultur medium tidligere utarbeidet og equilibrated.
  27. Behold på 38,5 ° C en atmosfære av 5% O 2 / 5% CO 2 og i luften med maksimal fuktighet.
  28. Etter 26 og 28 timer med co inkubering, fjerne 10 presumptive zygotes fra retter og vortex, fastsette, og stain dem, som beskrevet tidligere (trinn 2.23.2).
  29. Etter 48 timer av kultur, observere cleavage under en stereomicroscope.
  30. Fjerne zona pellucida (ZP) ved å overføre embryoene til en 5 mg/mL protease løsning.
  31. Vask individuelt hver embryoet tre ganger i PBS. Snapin-fryse dem i flytende nitrogen i 0,2 mL microcentrifuge rør. Lagre dem ved-80 ° C før analysen.

3. PCR

  1. materialer og reagenser
    Merk: reagenser, materiell og utstyr som utfører PCR protokollen er beskrevet i tabellen for materiale og inkluderer et PCR tube rack og en rekke Mikropipetter (P2, P20, P200, P1000), 1,5 mL microcentrifuge rør, PCR rør og caps, en termisk cycler, UV illuminator, agarose gel og buffer (Tris Borate EDTA (TBE)).
    1. Forsiktig tine reagenser på is. Opprettholde dem i isen hele eksperimentet. Bruk deoxynucleotides (dNTPs, dATP, dCTP, dTTP og dGTP), målrette grunninger på referanse genet koding for dolphin 18 S ribosomal protein (DQ404537.1); R1: TTGGACACACCCACGGTGCGG og F2: CAGAAGGACGTGAAGGATGGA), DNA polymerase, 5 X bufferen for DNA polymerase, DNA-mal, sterilt vann og magnesiumklorid (MgCl 2 i en siste konsentrasjon av 5.0 mM).
    2. Agarose gel og prøve forberedelse.
      1. Forberede delfin og storfe sperm DNA prøver.
        1. Tøvær frossen sugerør av hver art i et vannbad på 37 ° C for 50 s. legge 3 mL vaske løsning. Sentrifuge 250 x g for 10 min. fjerne nedbryting. Legge til 30 µL av STES lyseringsbuffer (50 mM Tris-HCl, pH 8, 20 mM NaCl; og 1 mM 0,1% SDS), 2 µL av proteinasen K (20 mg/mL) og 5 µL av dithiothreitol (DTT); siste konsentrasjon: 150 mM. Opprettholde natten på 55 ° C. Legg 200 µL ultrapure vann. Sentrifuge 250 x g for 5 min. holde nedbryting. Måle DNA konsentrasjonen bruker et spektrofotometer.
      2. Utføre føljetong fortynninger av DNA fra dolphin spermatozoa (dvs. 40, 4 og 0,4 ng/mL) med ultrapure vann å sjekke at PCR betingelser er i stand til å oppdage en liten mengde dolphin DNA.
      3. Utføre føljetong fortynninger av bovin sperm DNA (dvs. 4000, 400, 40 og 4 ng/mL) med ultrapure vann å sjekke at PCR betingelser er stand til å oppdage en liten mengde bovin DNA.
      4. Forberede delfin og storfe embryoer. Tine embryoer på is. Legge til 8 µL av 100 µg/mL proteinasen K og vedlikeholde natten på 55 ° C. For å stoppe reaksjonen, plassere prøvene på 96 ° C i 5 min.
      5. Forberede 2% agarose gel TBE bufferen og legge til 20 µL av nukleinsyre flekken ved bruk av standardmetoder.
    3. PCR forberedelse.
      1. Etiketten PCR lysrør: dolphin føljetong fortynninger (40, 4 og 0,4 ng/mL), storfe føljetong fortynninger (4000, 400, 40 og 4 ng/mL), homologe bovin to celle embryo, to-celle presumptive heterologous embryoer og negativ kontroll.
      2. Forbered en master blanding i en bakteriefri 1.5-mL microcentrifuge tube til et endelig antall 25 µL per reaksjon.
        1. Legge til 5 µL av 5 X DNA polymerase flexi buffer, 0,5 µL av dNTPs (10 mM) 1.5 µL MgCl 2 (25 mM), 0,5 µL av revers primer (10 µM), 1,5 µL av DNA (sperm) eller 8 µL av DNA (to-celle embryo) , 0,07 µL av Taq utvalg, og sterile destillert vann til et 25 µL siste volum. Bland godt.
  2. Forsterkning protokollen
    1. sette rør i termisk cycler. Velg følgende program: 94 ° C i 3 min; 40 sykluser av 94 ° C for 15 s, 59 ° C for 25 s, 72 ° C for 20 s; og 72 ° C i 5 min. Start programmet.
    2. Lagre rørene på 4 ° C. Legg 2.5 µL laste inn buffer hver PCR produktet på 4 ° C og belastning 15 µL av blandingen i brønnene i 2% agarose gel. Bruke en DNA stigen markør for nøyaktig størrelse estimering av PCR.
    3. Utføre geleelektroforese i 15 min tillate DNA migrasjon. Visualisert band med en UV-illuminator.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle resultater, tabeller og figurer (1 og 2) presenteres her ble gjengitt med tillatelse3.

Dolphin spermatozoa har høy motilitet etter fryses

Frosset-tint dolphin ejakulerer viste prosentdeler (% ± SD) 84.5 ± 5.3 totalt motile og 69,1 ± 5.1 progressiv motile spermatozoa. Motilitet sagt er disse tallene representant for høykvalitets cryopreserved spermatozoa.

Dolphin spermatozoa er gjennomtrengende zona intakt bovin oocytes og produsere hybrid embryo

Figur 1A og tabell 1 viser dolphin spermatozoa knyttet til storfe ZP etter 2,5 timer med co inkubasjon. Dolphin spermatozoa var festet på en høyere prosentandel enn storfe spermatozoa (figur 1B og tabell 1). Faktisk viser fluorescens mikroskopi at dolphin spermatozoa er stand til å penetrere zona intakt bovin spermatozoa (figur 1 c), fører til pronuclear dannelse og cleavage (figur 1E og tabell 1). Dette ble bekreftet av AC confocal mikroskopi (figur 1 d og figur 1F). Ingen polyspermy ble observert i oocytes fra heterologous IVF gruppen etter 12 timer med co inkubering (tabell 1). Pronuclear formasjon i heterologous IVF nådde den høyeste andelen på 24 h, lengre tid enn i homologe gruppen som skjedde på 18 h med co inkubering (tabell 1). Kløv hastigheten 48 timer etter inkubasjon var lavere i den heterologous enn homologe IVF (tabell 1). En spontan parthenogenetiske aktivisering sats på 8.0% ble observert i bovin modnet 5mas oocytes på 48 timer (tabell 1).

Til slutt, PCR resultatene bekreftet tilstedeværelse av dolphin genetisk materiale i hybrid embryoer (Figur 3) ved å evaluere tilstedeværelsen av en delfin referanse genet som koder for ribosomal 18 S protein (figur 2).

Figure 1
Figur 1: Dolphin spermatozoa knyttet til storfe zona pellucida (ZP). Vedlagte dolphin (A) og storfe (B) spermatozoa etter 2,5 timer med co inkubasjon med zona intakt bovin oocytes. Gameter var farget med Hoechst og visualisert under kontrast mikroskopet (40 X forstørrelse). En delfin spermatozoa inn periviteline en storfe oocyte (C og D) og en decondensing dolphin sæden hodet i bovin oocyte cytoplasma (E). Bildene ble tatt under AC confocal mikroskop og tilsvarer equatorial flyet av presumptive zygoten (Hoechst flekker, 40 X forstørrelse). To pronuclei (F) observert under fase kontrast mikroskop etter 24 h heterologous IVF bestående av den co inkubering dolphin spermatozoa med zona intakt bovin oocytes (Hoechst flekker, 40 X forstørrelse; Skala bar = 25 µm). Figuren ble reprodusert referanse3 med tillatelse. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: representant geleelektroforese (2% agarose gel ethidium bromide farget) viser PCR forsterkning resultatene for 18 S dolphin genet. Baner 1 til 30 Vis presumptive dolphin/storfe hybrid embryo; baner S1 og S2 har 4 ng/mL og 0,4 ng/mL dolphin sperm DNA, henholdsvis; og baner C1 til C5 har to-celle bovin embryoer og H2O (vann) (tom kontrollen). Pilen viser 190-bp bandet tilsvarer forsterket 18 S rDNA. Figuren ble reprodusert referanse3 med tillatelse. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: representant bilder av hybrid embryoer. Representativt bilde av en to-celle hybrid embryo (A) på 48 timer med inkubering (Hoechst flekker, 40 X forstørrelse). Unstained kvinne hybrid embryoer på 48 timer med inkubering, på ulike stadier av divisjon, visualisert under stereomicroscope (B). Klikk her for å se en større versjon av dette tallet.

Table 1
Tabell 1: priser på vedlegg, polyspermy, pronuclear formasjon og cleavage etter homologe og heterologous co inkubasjon med bovin oocytes og storfe eller dolphin spermatozoa, henholdsvis. Variabler ble analysert med ANOVA (Kruskal-Wallis- og Mann-Whitney test). Verdiene uttrykkes som gjennomsnittlig ± SEM (område) av tolv replikat; n = antall oocytes eller presumptive zygotes undersøkt. Tabellen ble reprodusert referanse3 med tillatelse. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For mange forskjellige pattedyrarter finnes det ulike fordeler med å bruke frosne-tint sperm. Disse inkluderer muligheten til å overføre verdifulle genetisk materiale, potensialet for verdensomspennende distribusjon, lave risikoen for forurensning og evne til å bevare mannlige gameter i flere tiår. Bruk av cryopreserved sperm er viktig for Tumlar, fordi denne arten er beskyttet under vedlegg II av SITERER, som begrenser transport og utveksling av dyr mellom forskjellige vannparker. Delfiner transport er en aktivitet som skaper logistiske problemer og farlige risiko. Avstå fra å transportere dem har imidlertid også konsekvenser, for eksempel risikoen ved å innføre nært slektskap til en captive befolkningen av dyr. En løsning er kryonisk bevaring av sæd. Noen forfattere har cryopreserved dolphin sperm5,7,8,9, med veldig oppmuntrende resultatene. Videre i 2005 var den første fødselen av dolphin kalv unnfanget ved kunstig inseminasjon med cryopreserved sperm rapporterte10. Noen år senere, dette ble gjort ved hjelp av sex-sortert spermatozoa11.

Dolphin sperm har vært cryopreserved ved hjelp av ulike teknikker, fra sofistikerte metoder, for eksempel en programmerbar fryser5, til vanlige metoder, slik som tørris12 eller flytende nitrogen damp2,9, 13. Den største fordelen med tørris eller flytende nitrogen damp er muligheten til å cryopreserve på samme sted hvor sperm trekkes, uten bruk av høyt spesialisert utstyr. Sperm frosset i strå på polystyren i flytende nitrogen damp er en enkel, rask og billig metode13. I praksis, når denne metoden er brukt på delfiner, var Spermiemotilitet 65%. Det er imidlertid viktig å vurdere hvor vanskelig det er å etablere en standardisert metode: teknikken kan påvirkes av eksterne faktorer, som temperatur, fuktighet, polystyren størrelse, etc. Derfor videre er studier nødvendig for å optimalisere og standardisere prosedyren for å forbedre suksessen med å bruke sperm frosset med flytende nitrogen damp metoden.

For å optimalisere en frysing protokoll, er det viktig å utvikle en pålitelig metode for funksjonell vurdering av spermatozoa. IVF er en god måte å teste sperm potensial for befruktning. Ideelt sett dolphin oocytes skal brukes for IVF, men vanskelig og strevsom prosedyrene for å hente oocytes fra kvinner representerer en viktig betingelse. Derfor åpner bruke heterologous IVF en ny måte å teste befruktning effektivitet i dolphin. Oocytes fra andre arter kan brukes heterologous dolphin IVF. Resultatene viser at heterologous IVF mellom bovine oocytes og dolphin spermatozoa kan utføres. Frosne og tinte dolphin spermatozoa kan trenge zona intakt bovin oocyte og generere en hybrid fosteret.

Presentert kombinasjonen av protokoller for innsamling, fryse-tining og utføre heterologous IVF med storfe oocytes har blitt vist og representerer et første trinn for optimalisering av kryonisk bevaring og evaluering av Dolphin sædceller. Det er viktig å merke seg at det er fortsatt mange ukjente i disse fremgangsmåtene. Men evnen til å cryopreserve dolphin sæd gjør det tilgjengelig og kan holdes i laboratorier. Dette vil lette vitenskapelige studier og kan føre til en bedre forståelse av fysiologi, sammensetning og atferd spermatozoa.

Evalueringen av sæd av heterologous IVF kan lette optimalisering av frysing protokollene, men det kan også brukes i fremtiden å teste og velg menn for fruktbarhet effektivitet. Et viktig hensyn er forholdet mellom ekte befruktning tall og heterologous IVF verdier. I tillegg, og nyheten av heterologous IVF mellom disse to phylogenetically Fjern arter, storfe og dolphin, bygges nye biologiske hypoteser. Sammen åpne disse protokollene en ny plass for forskning på gjengivelse av dolphin og andre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

hans arbeid ble finansiert av det spanske departementet for økonomi og konkurranseevne (AGL2015-70140-R til D. Rizos), AGL2015-66145R A. Gutierrez-Adan og J. F. Pérez-Gutiérrez og Seneca Foundation i Murcia (Grant 20040/BAKTERIE/16 til F. García-Vázquez)

Materials

Name Company Catalog Number Comments
FERT-TALP medium Merck
TCM-199 Sigma M-4530
Hoechst 33342 Sigma B-2261
4-well dishes Nunc 176740
Density gradient BoviPure Nidacon International BP-100
Washing solution Boviwash Nidacon International BW-100
Magnesium chloride Promega A35 1H
Sterile water Mili Q sintesis A10 Millipore A35 1H
Buffer Tris Borate EDTA Sigma T4415
MB agarose Biotools 20.012
5X GoTaq flexi buffer Mili Q sintesis A10 Millipore M 890 A
MB agarose Biotools 20.012
Taq polymerase Promega
SafeView NBS Biologicals Ltd. M 890 A
Makler counting chamber Sefi Medical
Thoma chamber Hecht-Assistant
pHmeter MicropH 2000 Crison Instruments
Osmometer Advanced micro osmometer 3300 Norwood
Computer assisted sperm analysis system Projectes y Serveis R+D
Stereomicroscope MZ 95 Leica
Epifluorescent optics Eclipse Te300 Nikon
Confocal assistant 4.02 software Bio-Rad 3D analysis software
Confocal laser scanning microscopy Bio-Rad
Micropippetes (P2. P20, P200, P1000) Gilson
Microcentrifuge tubes VWR
UV iluminator Bio-Rad
PCR Thermal cycler Primus 96 Plus MWG AG Biotech

DOWNLOAD MATERIALS LIST

References

  1. Montano, G. A., et al. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 143, (6), 799-813 (2012).
  2. Sánchez-calabuig, M. J., et al. Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 49, (5), 761-768 (2014).
  3. Sánchez-calabuig, M. J., et al. Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa. Theriogenology. 84, (6), 983-994 (2015).
  4. Keller, K. V. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. IAAAM. 14, (22), 22-24 (1986).
  5. Robeck, T. R., O'brien, J. K. Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 70, (5), 1340-1348 (2004).
  6. Coy, P., et al. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 135, (1), 19-27 (2008).
  7. Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).
  8. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  9. Sánchez-Calabuig, M. J., et al. Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 50, (2), 227-235 (2015).
  10. Robeck, T. R., et al. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). Reproduction. 129, (5), 659-674 (2005).
  11. Robeck, T. R., et al. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). Anim Reprod Sci. 139, (1-4), 168-181 (2013).
  12. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  13. Madeddu, M., et al. Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen. Anim Reprod Sci. (2016).
Bottlenose Dolphin (<em>bred snute truncatus</em>) Spermatozoa: innsamling, kryonisk bevaring og Heterologous <em>I Vitro</em> fertilisering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).More

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter