Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Bottlenose Dolphin (Tursiops truncatus) spermatozoi: raccolta, crioconservazione e fecondazione In Vitro eterologa

doi: 10.3791/55237 Published: August 21, 2017

Summary

Qui, presentiamo i protocolli che sono stati utilizzati con successo per la collezione di spermatozoi di dolphin, crioconservazione e prestazioni di FIVET eterologa usando i oocytes bovina.

Abstract

L'uso degli spermatozoi crioconservati delfino facilita lo scambio di materiale genetico tra parchi acquatici e rende gli spermatozoi accessibile ai laboratori per studi per avanzare la nostra comprensione della riproduzione di mammiferi marini. FIVET eterologa, un sostituto per la FIVET omologa, potrebbe fornire un mezzo per testare la fertilità dello sperma potenziali; per studiare la fisiologia dei gameti e sviluppo iniziale dell'embrione; e per evitare l'uso di ovociti prezioso dei delfini, che sono difficili da ottenere. Qui, presentiamo i protocolli che sono stati utilizzati con successo per raccogliere e crioconservare gli spermatozoi delfino. La raccolta di sperma viene eseguita da stimolazione manuale su delfini addestrati. Crioconservazione avviene utilizzando un extender di tuorlo d'uovo basata TRIS con glicerolo. Inoltre, vi presentiamo un protocollo che descrive la FIVET eterologa utilizzando delfino gli spermatozoi e gli ovociti bovini e che verifica la natura ibrida dell'embrione risultante usando la PCR. Fecondazione eterologa solleva interrogativi sulla fecondazione e può essere utilizzata come strumento per studiare la fisiologia dei gameti e sviluppo iniziale dell'embrione. Inoltre, il successo della FIVET eterologa dimostra il potenziale di questa tecnica per testare le capacità, che vale la pena di ulteriore esame di fecondante dello spermatozoo di delfino.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tecnologie di riproduzione assistita sono scarsamente sviluppate negli animali selvatici, tra cui mammiferi marini. La mancanza di metodi sensibili per valutare il successo di fertilizzazione dello sperma contribuisce allo sviluppo lento delle tecnologie riproduttive in specie come il delfino. Non era fino a poco tempo che il base parametri seminali di tursiope (Tursiops truncatus) sono stati segnalati1,2. Tuttavia, le variabili come motilità e morfologia, sebbene ampiamente usato, dare informazioni limitate sull'efficienza riproduttiva. Il migliore indicatore della qualità dello sperma è la valutazione del potenziale fecondante.

Recentemente, il nostro gruppo ha utilizzato un metodo per valutare sperma delfino potenziale di fertilizzazione valutando formazione pronuclei maschile e/o formazione dell'embrione ibrido dopo FIVET eterologa utilizzando ovociti bovina intatta zona3. L'uso della FIVET eterologa delfino-bovino ha importanti vantaggi rispetto alle FIVET omologa, come supera la difficoltà di ottenere ovociti delfino e facilita l'uso dei sistemi di maturazione ben testati in vitro degli ovociti bovini. Al fine di evitare la specificità di specie, la fecondazione eterologa è generalmente svolta in assenza di ZP. Anche se esso consente per la valutazione della capacità degli spermatozoi ha reagito acrosomiale di fondersi con la membrana vitellina, si altera la valutazione di altre caratteristiche legate alla fertilizzazione. La procedura descritta utilizza zona intatta ovociti e permette la valutazione dei seguenti parametri: associazione di zona di sperma e allegato, penetrazione, gamete, formazione pronuclei e fenditura dell'embrione ibrido.

Qui, presentiamo diversi protocolli per la raccolta dello sperma, sperma base analisi, congelamento di spermatozoi così come la valutazione della funzionalità degli spermatozoi delfino valutando formazione maschile dell'embrione di pronuclei e/o ibrido dopo FIVET eterologa utilizzando zona intatta ovociti bovini.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dichiarazione etica: tutte le procedure sperimentali sono stata esaminate e approvate dal comitato di uso del Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA) e istituzionali Animal Care. Tutti gli esperimenti sono stati eseguiti in conformità con la guida per la cura e l'uso di animali da laboratorio, come adottato dalla società per la studio di riproduzione e per l'Animal Welfare Act per la cura di mammiferi marini.

1. raccolta di sperma di dolphin e crioconservazione

  1. preparazione
    1. rendere FERT medio (eparina - e ipotaurina-free). Preparare il supporto di FERT-TALP completato con bicarbonato di 25mm, lattato di sodio 22 mM, piruvato di sodio di 1 mM, 6 mg/mL BSA privo di acidi grassi ed eparina 10 mg/mL (pH 7,4).
      Nota: Preparare questo mezzo il giorno di utilizzo e tenerlo a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima per almeno 2 h prima dell'uso.
    2. Tampone di base di tuorlo del uovo preparare TRIS
    3. . Sciogliere 30,28 g/L Tris, 16,75 g/L di acido citrico, fruttosio 12,5 g/L e streptomicina 0,5 g/L in acqua ultrapura (pH 7,3, osmolalità = 310 mOsm/kg). Aggiungere il tuorlo d'uovo di 20% (v/v).
  2. Treno un tursiope maschio di allevamento provata a mentire in dorsale recumbence vicino al bordo della piscina per la raccolta dello sperma volontaria.
    Nota: Il delfino maschio deve essere addestrato oltre 6 mesi di rinforzo positivo, come descritto in precedenza 4.
  3. Eseguire varie stimolazioni tattili premendo delicatamente sulla zona cranica della scanalatura genitale del delfino di suscitare volontaria estrusione del pene dalla scanalatura genitale.
  4. Dopo il raggiungimento di un'erezione completa, dirigere la punta del pene in un contenitore sterile per ottenere ejaculate.
  5. Mantenere il campione di sperma a 37 ° C fino all'analisi. Ripetere i passaggi da 1.3 e 1.4 per eiaculare successive raccolte, utilizzando un nuovo vetro di propilene ogni volta.
  6. Immediatamente dopo il prelievo, determinare il volume utilizzando un cilindro graduato in vetro precedentemente riscaldato a 37 ° C. Evaluate il colore, pH e osmolarità (utilizzando un micro-Osmometro) del liquido seminale.
  7. Di valutare la concentrazione di spermatozoi nel liquido seminale, aggiungere 10 µ l della sospensione di sperma in una provetta eppendorf contenente 90 µ l di acqua distillata. Determinare la concentrazione di spermatozoi utilizzando uno spermatozoo contando camera.
    Nota: Durante la valutazione, mantenere il resto del liquido seminale a 37 ° C.
  8. Valutare i parametri di motilità.
    1. Prendere 10 µ l di campione di sperma e metterlo in una camera di sperma pre-riscaldato.
    2. Valutare la motilità utilizzando un sistema di analisi computerizzata dello sperma, precedentemente convalidato per il tursiope, valutare oggettivamente la motilità dello sperma 2.
      Nota: Se necessario, è possibile diluire il campione di sperma con il mezzo di FERT (eparina - e ipotaurina-free) per un'adeguata visualizzazione della motilità degli spermatozoi. Durante la valutazione, mantenere il campione a 37 ° C su una fase di microscopio riscaldata.
  9. Prendere 20 µ l di campione di sperma e valutare la morfologia di attuabilità e sperma come descritto in precedenza 5.
  10. Trasferire il campione di sperma per una provetta da centrifuga. Centrifugare il campione di sperma a 250 x g per 5 min. Dopo determinare la concentrazione di spermatozoi utilizzando una camera di conteggio, regolare la concentrazione di spermatozoi a 400 x 10 6 spermatozoi/mL.
    Nota: Se necessario, è possibile diluire il pellet dal concentrato eiacula con plasma seminale isolato da un volume in eccesso di liquido seminale stesso mediante centrifugazione (250 x g, 10 min).
    1. Nel corso di 5 min, diluire lentamente lo sperma campione 1:1 (v/v) con un tampone TRIS, uovo tuorlo-base 1,5% glicerolo. Collocare la provetta contenente la sospensione di sperma a 5 ° C per 1 h 30 min.
    2. Eseguire una seconda diluizione della sospensione di sperma con un TRIS uovo tuorlo-base tampone contenente glicerolo per ottenere una concentrazione di glicerolo finale del 3% e una concentrazione finale di 200 x 10 6 spermatozoi/mL. Mantenere la sospensione di sperma a 5 ° C per 10 min.
  11. Caricare la sospensione di sperma nelle cannule di 0,25 mL. Saldatura a caldo le cannucce. Posto le cannucce in un rack da 4,5 cm di sopra dell'azoto liquido per 10 min. tuffano le cannucce l'azoto liquido e memorizzare fino a valutazione.

2. Eterologa In Vitro fertilizzazione usando Zona intatta bovina ovociti

soluzione
  1. preparazione
    1. preparare la colorazione e il mezzo di montaggio.
      1. Soluzione di riserva di Hoechst preparare sciogliendo 1 mg di Hoechst in 1 mL di acqua distillata. Fare 30 aliquote µ l e tenerli al buio a-20 ° C fino all'utilizzo. Preparare soluzione colorante aggiungendo 25 µ l di soluzione madre di Hoechst a 5 mL di tampone fosfato salino (PBS) completato con 1 g/L PVA. Mescolare bene e tenere al buio a 4 ° C fino all'utilizzo.
      2. Mezzo di montaggio
      3. preparare mescolando 6,25 mL di PBS con 6,25 mL di glicerolo e 6,25 µ l di soluzione madre di Hoechst. Mescolare bene e tenere al buio a 4 ° C fino all'utilizzo.
    2. Preparare il supporto per la fertilizzazione di collezione e in vitro degli ovociti.
      1. Preparare soluzione salina aggiungendo 0,5 mL della gentamicina a 0,9% NaCl distillata acqua.
      2. Preparare il supporto di maturazione stock aggiungendo 10 ng/mL il fattore di crescita epidermico (EGF) e 10% di siero fetale di vitello (FCS) a 10 mL di TCM-199. Mantenere entrambi i media a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima per almeno 2 h prima dell'uso.
  2. Raccogliere le ovaie al macello in soluzione salina a 33-35 ° C e loro trasporto al laboratorio entro 4 ore dalla raccolta.
  3. Una volta in laboratorio, lavare le ovaie tre volte per rimuovere i detriti e sangue utilizzando soluzione salina precedentemente riscaldato a 37 ° C. mantenere le ovaie in soluzione salina a 37 ° C durante il processo di.
  4. Aspirato follicoli di 2 a 8 mm con un G 18 ago e una siringa da 10 mL. Raccogliere il liquido follicolare aspirato in provette da 50 mL.
  5. Consentire il liquido follicolare contenente gli ovociti a riposare per circa 15 min a 37 ° C, fino a che il sedimento di cellule. Rimuovere il surnatante del tubo con una pipetta Pasteur e risospendere il pellet in PBS.
  6. Recuperare i complessi cumulo-ovocita (COC) in piastre da 90 mm sotto un microscopio stereoscopico.
  7. Lavare il COC tre volte in PBS e una volta in mezzo maturazione.
  8. Trasferimento morfologicamente normale COC a piatti 4 pozzetti, ciascuno contenente ben 500 mL di terreno di maturazione, in gruppi di 50 COC per pozzetto.
    Nota: Qui, tre pozzi – un pozzetto per eterologa FIVET, un controllo bene per FIVET omologhe e uno ben contenente solo maturato COC come controllo partenogenetico – sono stati usati.
  9. Incubare il CoC per 24 h a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima.
  10. Preparare il mezzo ed il gradiente di densità.
    1. Di preparare il supporto di fertilizzazione (FERT), integrare medium FERT-TALP con bicarbonato di 25 mM, lattato di sodio 22 mM, piruvato di sodio di 1 mM, 6 mg/mL BSA privo di acidi grassi e l'eparina 10 mg/mL. Mantenere a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima per almeno 2 h prima dell'uso.
    2. Preparare il gradiente di densità aggiungendo 1 mL di terreno gradiente di densità in una provetta da 15 mL e 3 mL di soluzione in una provetta da 15 mL di lavaggio. Mantenerli a 38,5 ° C per almeno 1 h.
  11. Lavare la in vitro maturato ovociti due volte nel mezzo FERT.
  12. Trasferire gli ovociti alle 4 pozzetti piatti, ciascuno contenente ben 50 COC in 250 mL di FERT. Mantenere i piatti 4 pozzetti a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima durante la preparazione dello sperma per fertilizzazione.
  13. Scongelare una cannuccia congelata contenenti gli spermatozoi delfino in un bagno di acqua a 37 ° C per 50 s.
    Nota: Sperma bovino per la FIVET omologa dovrà essere elaborato in parallelo, seguendo il protocollo standard per IVF bovino omologo.
  14. Prendere 10 µ l di sperma campione e posizionarlo in un pre-riscaldato sperma camera di conteggio. Valutare la motilità utilizzando un sistema di analisi computerizzata dello sperma, precedentemente convalidato per le specie, valutare oggettivamente la motilità dello sperma. Durante questo tempo, mantenere il campione di sperma a 38,5 ° C.
  15. Aggiungere il campione di sperma per il tubo del gradiente di densità (passo 2.10.2). Centrifugare per 10 min 250 x g.
  16. Attentamente rimuovere il surnatante con una pipetta Pasteur. Aggiungere 3 mL di soluzione di lavaggio nella provetta contenente il pellet. Risospendere il pellet miscelando delicatamente.
  17. Centrifuga per 5 min a 250 x g. eliminare il surnatante con una pipetta Pasteur ad un volume di sperma di 300 µ l.
  18. Aggiungere 5 µ l della sospensione di sperma in una microcentrifuga contenente 95 µ l di acqua distillata. Mantenere la sospensione di sperma a 38,5 ° C. Inserire il conteggio delle cellule dell'alloggiamento con 10 µ l del 01:20 misura la concentrazione e diluizione dello sperma. Calcolare la quantità di mezzo FERT che deve essere aggiunto a 100 µ l degli spermatozoi per ottenere spermatozoi/mL di 2 x 10 6.
  19. Aggiungere il volume calcolato di FERT e sperma in una provetta da 15 mL e mescolare delicatamente utilizzando una pipetta Pasteur.
  20. Aggiungere 250 µ l della sospensione di sperma-FERT in ciascun pozzetto del piatto 4 pozzetti contenenti il mezzo FERT con gli ovociti stagionati per ottenere una concentrazione finale di 1 x 10 6 spermatozoi/mL.
  21. Co-Incubare i gameti per 18 h a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima.
  22. Preparare il terreno di coltura basato sul sintetico liquido oviduttali completato con 5% FCS. Preparare 25 µ l di gocce di coltura fluidi oviduttali sintetico in 35mm piatti coperti con 3 mL di olio minerale. Mantenere a 38,5 ° C, in un'atmosfera di 5% CO 2 e in aria con umidità massima per almeno 2 h prima dell'uso.
  23. a 2,5 h post co-incubazione, rimuovere 20 ovociti dal piatto; mantenere gli ovociti rimanenti nell'incubatrice alle stesse condizioni.
    1. Pipettare vigorosamente la metà degli ovociti attraverso una pipetta di Pasteur stretto-foro 10 volte per rimuovere gli spermatozoi senza bloccare allegati.
    2. Difficoltà 20 ovociti in 50 µ l di 0,5% glutaraldeide per 30 min. lavare gli ovociti in PBS per 5 min, trasferire gli ovociti a 50-µ l di soluzione colorante Hoechst per 15 min e lavare gli ovociti in PBS per 5 min.
    3. Trasferire gli ovociti individualmente alle 2 µ l gocce di mezzo di montaggio a un tasso di 10 ovociti per ogni diapositiva. Delicatamente, coprire con un vetrino coprioggetto e sigillare con smalto.
    4. Contare il numero di spermatozoi associata agli ovociti bovini utilizzando un microscopio a contrasto di fase dotato di ottica epifluorescente e un filtro di eccitazione 361 nm a 40 ingrandimenti.
  24. Dopo 12 h di co-incubazione, rimuovere 10 zigoti presuntiva dai piatti 4 pozzetti; mantenere gli zigoti presuntivi rimanenti nell'incubatrice alle stesse condizioni.
    1. Trasferimento 10 zigoti presuntiva di una centrifuga 15 mL tubo da 2 mL di PBS e vortice delicatamente per 2 minuti per rimuovere le cellule del cumulo. Lavare due volte in PBS, correzione e macchia, come precedentemente descritto (passo 2.23.2.)
  25. Dopo 18, 20, 22 e 24 h di co-incubazione, rimuovere 10 zigoti presuntiva dal 4 pozzetti piatti e vortice, difficoltà e macchiare loro come descritto in precedenza (passo 2.23.2). Mantenere il resto degli zigoti presuntiva in incubatrice alle stesse condizioni.
    1. Valutare formazione pronuclei e gamete sotto un microscopio di fase-contrasto/epifluorescente in entrambi i gruppi di FIVET omologhi ed eterologi macchiando con Hoechst.
    2. Valutare pronuclei formazione in 10 zigoti scelti a caso ibrido presuntiva per campione. Confermare pronuclei formazione sotto un laser confocale scansione microscopio all'eccitazione del laser di argon a 488 nm e rilevamento di 515 a 530 nm.
    3. Sezione otticamente zigoti presuntiva in sequenza (2 mm) e raccogliere immagini utilizzando un software di imaging. Visualizzare utilizzando un pacchetto di software di analisi 3D.
    4. Dopo 24 h di co-incubazione, lavare 50 zigoti presuntiva quattro volte in PBS e due volte nel mezzo di coltura.
  26. Trasferirli in gruppi di 25 microgocce di terreno di coltura precedentemente preparato e i.
  27. Maintain a 38,5 ° C in un'atmosfera di 5% O 2 / 5% CO 2 e in aria con umidità massima.
  28. Dopo 26 e 28 h di co-incubazione, rimuovere 10 zigoti presuntiva dai piatti e il vortice, la correzione e macchiare la loro, come descritto in precedenza (passo 2.23.2).
  29. Dopo 48 h di cultura, osservare il clivaggio sotto uno stereomicroscopio.
  30. Trasferimento degli embrioni per una soluzione di proteasi di 5 mg/mL per rimuovere la zona pellucida (ZP).
  31. Lavare singolarmente ogni embrione tre volte in PBS. Snap-freeze li in azoto liquido in provette da 0,2 mL microcentrifuga. Conservarli a-80 ° C fino all'analisi.

3. PCR

  1. materiali e reagenti
    Nota: I reagenti, materiali e attrezzature utilizzate per eseguire il protocollo PCR sono dettagliati nella tabella materiali e includono una cremagliera del tubo PCR e un set di micropipette (P2, P20, P200, P1000), 1,5 mL microcentrifuga, provette per PCR e tappi, un termociclatore, un illuminatore UV gel di agarosio e tampone (Tris Borato EDTA (TBE)).
    1. Scongelare delicatamente tutti i reagenti sul ghiaccio. Mantenerle in ghiaccio in tutto l'esperimento. Utilizzare deossinucleotidi (dNTPs; dATP, dCTP, dTTP e dGTP), target primer su riferimento gene codificante per la proteina ribosomale delfino 18 S (DQ404537.1); R1: TTGGACACACCCACGGTGCGG e F2: CAGAAGGACGTGAAGGATGGA), DNA polimerasi, 5 X buffer per il modello della polimerasi del DNA, DNA, acqua sterile e cloruro di magnesio (MgCl 2 ad una concentrazione finale di 5,0 mM).
    2. Dell'agarosi gel e preparazione di campioni. Campioni
      1. preparare delfino e bovino DNA spermatico.
        1. Disgelo una cannuccia congelata di ogni specie in un bagno di acqua a 37 ° C per 50 s. aggiungere 3 mL di soluzione di lavaggio. Centrifuga a 250 x g per 10 min. eliminare il surnatante. Aggiungere 30 µ l di tampone di lisi STES (50 mM Tris-HCl, pH 8; 20 mM NaCl; e 1 mM 0,1% SDS), 2 µ l di proteinasi K (20 mg/mL) e 5 µ l di ditiotreitolo (DTT); concentrazione finale: 150 mM. Mantenere durante la notte a 55 ° C. aggiungere 200 µ l di acqua ultrapura. Centrifuga a 250 x g per 5 min, tenere il supernatante. Misurare la concentrazione di DNA usando uno spettrofotometro.
      2. Eseguire diluizioni seriali di DNA da spermatozoi Delfino (cioè, 40, 4 e 0,4 ng/mL) con acqua ultrapura per verificare che le condizioni PCR sono in grado di rilevare una piccola quantità di delfino DNA.
      3. Eseguire diluizioni seriali di sperma di bovini del DNA (cioè, 4.000, 400, 40 e 4 ng/mL) con acqua ultrapura per verificare che le condizioni PCR sono in grado di rilevare una piccola quantità di DNA bovino.
      4. Preparare gli embrioni dei delfini e bovino. Scongelare gli embrioni su ghiaccio. Aggiungere 8 µ l di proteinasi di 100 µ g/mL K e mantenere durante la notte a 55 ° C. Per interrompere la reazione, posizionare i campioni a 96 ° C per 5 min.
      5. Preparare buffer di TBE del gel di agarosio 2% e aggiungere 20 µ l di acido nucleico macchia utilizzando tecniche standard.
    3. Preparazione di PCR.
      1. Provette PCR etichetta: diluizioni seriali del delfino (40, 4 e 0,4 ng/mL), bovini diluizioni seriali (4.000, 400, 40 e 4 ng/mL), omologo bovino embrione di due cellule, embrioni eterologi presuntivi di due celle e controllo negativo.
      2. Preparare un master in una microcentrifuga da 1,5 mL sterile ad un volume finale di 25 µ l per reazione.
        1. Aggiungere 5 µ l di tampone di flexi 5 di polimerasi del DNA di X, 0,5 µ l di dNTP (10 mM) 1,5 µ l di MgCl 2 (25 mM), 0,5 µ l di primer forward e reverse (10 µM), 1,5 µ l della mascherina del DNA (sperma) o 8 µ l della mascherina del DNA (due-cellula embrioni) , 0,07 µ l della Taq polimerasi e sterile distillata fino ad un volume finale di 25 µ l. Mescolare bene.
  2. Protocollo di amplificazione
    1. posizionare i tubi nel termociclatore. Selezionare il seguente programma: 94 ° C per 3 min; 40 cicli di 94 ° C per 15 s, 59 ° C per 25 s, 72 ° C per 20 s; e 72 ° C per 5 min, avviare il programma.
    2. Conservare le provette a 4 ° C. aggiungere 2,5 µ l di tampone di caricamento per ogni prodotto PCR a 4 ° C e carico 15 µ l della miscela nei pozzetti del gel di agarosio al 2%. Utilizzare un marcatore di scala del DNA per la stima precisa dimensione dei frammenti PCR.
    3. Eseguire l'elettroforesi per 15 minuti consentire la migrazione del DNA. Visualizzate bande utilizzando un illuminatore UV.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutti i risultati, tabelle e figure (1 e 2) qui presentate sono stati riprodotti con autorizzazione3.

Gli spermatozoi dei delfini hanno alta motilità dopo congelamento e scongelamento

Il delfino congelati eiacula ha mostrato percentuali (% ± SD) di 84,5 ± 5,3 totale motili e 69,1 ± 5.1 spermatozoi mobili progressivi. In termini di motilità, questi numeri sono rappresentativi della qualità degli spermatozoi crioconservati.

Delfino spermatozoi sono in grado di penetrante zona intatta bovina ovociti ed embrioni ibridi produttori

Figura 1A e tabella 1 Visualizza dolphin spermatozoi attaccati alla ZP bovina dopo 2,5 h di co-incubazione. Gli spermatozoi dei delfini sono stati fissati a una percentuale più elevata di spermatozoi bovini ( tabella 1eFigura 1B ). Microscopia a fluorescenza dimostra infatti che gli spermatozoi dei delfini sono in grado di penetrare la zona intatta spermatozoi bovini (Figura 1), che conduce alla formazione di pronuclei ed clivaggio (Figura 1E e tabella 1). Ciò è stata confermata mediante microscopia confocale (Figura 1 e Figura 1F). Nessun gamete è stata osservata negli ovociti dal gruppo FIVET eterologo dopo 12 h di co-incubazione (tabella 1). Formazione di pronuclei nella FIVET eterologa ha raggiunto la più alta percentuale a 24 h, un tempo maggiore che nel gruppo omologo, che si è verificato a 18 h di co-incubazione (tabella 1). Il tasso di clivaggio a 48 h dopo l'incubazione è stata inferiore all'eterologa la FIVET omologa (tabella 1). Un tasso di attivazione partenogenetico spontanea del 8,0% è stato osservato nel bovini stagionati ovociti non fecondati a 48 h (tabella 1).

Infine, i risultati PCR ha confermato la presenza di materiale genetico delfino negli embrioni ibridi (Figura 3) valutando la presenza di un gene di riferimento di delfino che codifica per la 18 ribosomal S proteina (Figura 2).

Figure 1
Figura 1: gli spermatozoi Dolphin attaccato al bovina zona pellucida (ZP). Allegato Delfino (A) e bovina (B) gli spermatozoi dopo 2,5 h di co-incubazione con ovociti bovina intatta di zona. Gameti sono stati colorati con Hoechst e visualizzate al microscopio a contrasto di fase (ingrandimento 40x). Un spermatozoi delfino nello spazio di un ovocita bovina (C e D) e un decondensing testa di delfino dello spermatozoo nel citoplasma degli ovociti bovini (E) periviteline. Immagini sono state catturate sotto un microscopio confocale e corrispondono al piano equatoriale dello zigote presuntivo (Hoechst macchiatura; ingrandimento 40x). Due pronuclei (F) osservati sotto un microscopio a contrasto di fase dopo 24 h di FIVET eterologa costituito il co-incubazione di spermatozoi delfino con zona intatta ovociti bovini (Hoechst macchiatura; ingrandimento 40x; Barra della scala = 25 µm). La figura è stata riprodotta da riferimento3 con permesso. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: rappresentanza elettroforesi (agarosio al 2% gel etidio bromuro macchiato) che mostra i risultati di amplificazione di PCR per il gene di delfino 18 S. 1 corsie a 30 Visualizza embrioni ibridi presuntiva delfino/bovino; corsie di S1 e S2 sono dotate di 4 ng/mL e 0,4 ng/mL delfino sperma DNA, rispettivamente; e corsie da C1 a C5 dispongono di due celle embrioni di bovini e H2O (acqua) (il controllo in bianco). La freccia indica la banda di 190-bp corrispondente al 18 amplificato S rDNA. La figura è stata riprodotta da riferimento3 con permesso. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: immagini rappresentative di embrioni ibridi. Immagine rappresentativa di un embrione di due celle ibride (A) a 48 h di incubazione (Hoechst macchiatura; ingrandimento 40x). Embrioni ibridi non macchiate a 48 h di incubazione, a diversi stadi della divisione, visualizzati sotto lo stereomicroscopio (B). Clicca qui per visualizzare una versione più grande di questa figura.

Table 1
Tabella 1: tassi di attaccamento, gamete, pronuclei formazione e scissione seguito omologa ed eterologa co-incubazione con bovina ovociti e spermatozoi bovini o Delfino, rispettivamente. Le variabili sono state analizzate con ANOVA (test di Kruskal-Wallis e Mann-Whitney). I valori sono espressi come la media ± SEM (gamma) di dodici repliche; n = numero totale di ovociti o presuntiva zigoti esaminati. La tabella è stata riprodotta da riferimento3 con permesso. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Per molte diverse specie di mammiferi, ci sono diversi vantaggi nell'utilizzo di spermatozoi congelati. Questi includono la capacità di trasferire il prezioso materiale genetico, il potenziale per la distribuzione in tutto il mondo, il basso rischio di contaminazione e la capacità di conservare i gameti maschili per decenni. L'utilizzo di spermatozoi crioconservati è essenziale per il tursiope, perché questa specie è protetta in appendice II della CITES, che limita il trasporto e lo scambio di animali tra diversi parchi acquatici. Trasporto dei delfini è un'attività che crea problemi logistici e pericolosi rischi. Tuttavia, astenendosi da trasportarli ha anche conseguenze, quali il rischio di introduzione della consanguineità ad una popolazione in cattività degli animali. Una soluzione è la crioconservazione degli spermatozoi. Alcuni autori hanno crioconservati delfino sperma5,7,8,9, con molto incoraggianti risultati. Inoltre, nel 2005, la prima nascita di un vitello di delfino ideato da inseminazione artificiale con spermatozoi crioconservati era segnalato10. Alcuni anni più tardi, questo è stato fatto utilizzando spermatozoi ordinato secondo sesso11.

Lo sperma dei delfini hanno stato crioconservato utilizzando tecniche diverse, da metodi sofisticati, ad esempio un congelatore programmabile5, a metodi comuni, come il ghiaccio secco12 o azoto liquido vapori2,9, 13. Il vantaggio principale dell'utilizzo di ghiaccio secco o azoto liquido vapori è la possibilità di crioconservare nella stessa posizione in cui lo sperma viene estratto, senza l'utilizzo di attrezzature altamente specializzate. Lo sperma congelato in cannucce il polistirolo in vapori di azoto liquido è un metodo semplice, rapido e poco costoso13. In pratica, quando questa metodologia è stata utilizzata sui delfini, motilità dello sperma era 65%. Tuttavia, è importante considerare quanto sia difficile stabilire un metodo standardizzato: la tecnica può essere influenzata da fattori esterni, quali temperatura, umidità, Taglia polistirolo, ecc. Di conseguenza, ulteriori studi sono necessari ad ottimizzare e standardizzare la procedura al fine di migliorare il successo di usando lo sperma congelato con il metodo del vapore di azoto liquido.

Al fine di ottimizzare un protocollo di congelamento, è importante sviluppare un metodo affidabile per la valutazione funzionale degli spermatozoi. FIV è un buon mezzo di test lo sperma potenziale per la fecondazione. Idealmente, gli ovociti delfino devono essere utilizzati per la FIVET, ma il difficile e faticosa procedure necessarie per ottenere ovociti dalle femmine rappresentano un vincolo importante. Di conseguenza, la possibilità di utilizzare FIVET eterologa apre un nuovo mezzo per testare l'efficienza di fertilizzazione del delfino. Ovociti da altre specie possono essere utilizzati per FIVET eterologa dei delfini. I risultati mostrano che la FIVET eterologa tra bovini ovociti e spermatozoi delfino può essere eseguita. Gli spermatozoi congelati e scongelati delfino possono penetrare l'ovocita bovina intatta zona e generare un embrione ibrido.

La combinazione presentata di protocolli per la raccolta, gelo-disgelo e l'esecuzione di eterologa IVF con ovociti bovini sono stati dimostrati con successo e rappresenta un primo passo per l'ottimizzazione della crioconservazione e la valutazione di sperma di delfino. È importante notare che ci sono ancora molte incognite in queste procedure. Tuttavia, la possibilità di crioconservare lo sperma delfino lo rende accessibile e permette di essere tenuti nei laboratori. Questo faciliterà gli studi scientifici e può portare ad una migliore comprensione del comportamento degli spermatozoi, la composizione e fisiologia.

La valutazione dello sperma di FIVET eterologa può facilitare l'ottimizzazione dei protocolli di congelamento, ma può anche essere utilizzato in futuro per testare e selezionare i maschi per efficienza di fertilità. Una considerazione importante è il rapporto tra numeri di fertilizzazione reale e valori di FIVET eterologi. Inoltre e a causa della novità della FIVET eterologa tra queste due specie filogeneticamente distanti, bovino e delfino, nuove ipotesi biologiche possono essere costruite. Complessivamente, questi protocolli aprire un nuovo spazio per la ricerca sulla riproduzione dei delfini e altri mammiferi marini.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

il suo lavoro è stato finanziato dal Ministero spagnolo dell'economia e competitività (AGL2015-70140-R a D. Rizos), AGL2015-66145R a A. Gutierrez-Adan e J.p. F. Pérez-Gutiérrez · e Seneca Foundation di Murcia (Grant 20040/GERM/16 a F. García-Vázquez)

Materials

Name Company Catalog Number Comments
FERT-TALP medium Merck
TCM-199 Sigma M-4530
Hoechst 33342 Sigma B-2261
4-well dishes Nunc 176740
Density gradient BoviPure Nidacon International BP-100
Washing solution Boviwash Nidacon International BW-100
Magnesium chloride Promega A35 1H
Sterile water Mili Q sintesis A10 Millipore A35 1H
Buffer Tris Borate EDTA Sigma T4415
MB agarose Biotools 20.012
5X GoTaq flexi buffer Mili Q sintesis A10 Millipore M 890 A
MB agarose Biotools 20.012
Taq polymerase Promega
SafeView NBS Biologicals Ltd. M 890 A
Makler counting chamber Sefi Medical
Thoma chamber Hecht-Assistant
pHmeter MicropH 2000 Crison Instruments
Osmometer Advanced micro osmometer 3300 Norwood
Computer assisted sperm analysis system Projectes y Serveis R+D
Stereomicroscope MZ 95 Leica
Epifluorescent optics Eclipse Te300 Nikon
Confocal assistant 4.02 software Bio-Rad 3D analysis software
Confocal laser scanning microscopy Bio-Rad
Micropippetes (P2. P20, P200, P1000) Gilson
Microcentrifuge tubes VWR
UV iluminator Bio-Rad
PCR Thermal cycler Primus 96 Plus MWG AG Biotech

DOWNLOAD MATERIALS LIST

References

  1. Montano, G. A., et al. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 143, (6), 799-813 (2012).
  2. Sánchez-calabuig, M. J., et al. Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 49, (5), 761-768 (2014).
  3. Sánchez-calabuig, M. J., et al. Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa. Theriogenology. 84, (6), 983-994 (2015).
  4. Keller, K. V. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. IAAAM. 14, (22), 22-24 (1986).
  5. Robeck, T. R., O'brien, J. K. Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 70, (5), 1340-1348 (2004).
  6. Coy, P., et al. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 135, (1), 19-27 (2008).
  7. Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).
  8. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  9. Sánchez-Calabuig, M. J., et al. Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 50, (2), 227-235 (2015).
  10. Robeck, T. R., et al. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). Reproduction. 129, (5), 659-674 (2005).
  11. Robeck, T. R., et al. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). Anim Reprod Sci. 139, (1-4), 168-181 (2013).
  12. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  13. Madeddu, M., et al. Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen. Anim Reprod Sci. (2016).
Bottlenose Dolphin (<em>Tursiops truncatus</em>) spermatozoi: raccolta, crioconservazione e fecondazione <em>In Vitro</em> eterologa
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).More

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter