Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Tonina Delfín (Tursiops truncatus) espermatozoides: recolección, criopreservación y fecundación In Vitro heteróloga

doi: 10.3791/55237 Published: August 21, 2017

Summary

Aquí, presentamos los protocolos que se han utilizado con éxito para delfín espermatozoides recolección, criopreservación y rendimiento de fecundación in vitro heteróloga utilizando ovocitos bovinos.

Abstract

El uso de espermatozoides criopreservados delfín facilita el intercambio de material genético entre parques acuáticos y hace accesible a los laboratorios de estudios para mejorar nuestra comprensión de la reproducción de mamíferos marinos espermatozoides. Fecundación in vitro heteróloga, un reemplazo para la FIV homóloga, podría proporcionar un medio para probar la fertilidad de esperma potencial; para estudiar la fisiología de gametos y desarrollo temprano del embrión; y evitar el uso de ovocitos de valioso delfín, que son difíciles de obtener. Aquí, presentamos los protocolos que se han utilizado con éxito para recoger y criopreservar espermatozoides de delfín. La colección de semen se realiza por estimulación manual de delfines entrenados. Criopreservación se logra utilizando un extensor TRIS base de yema de huevo con el glicerol. Además, presentamos un protocolo que describe FIV heteróloga utilizando delfines espermatozoides y ovocitos bovinos y que verifica la naturaleza híbrida del embrión resultante mediante PCR. Fecundación heteróloga plantea preguntas sobre fertilización y puede utilizarse como una herramienta para estudiar la fisiología de gametos y desarrollo temprano del embrión. Además, el éxito de la FIV heteróloga demuestra el potencial de esta técnica para probar la capacidad, lo que vale la pena la examinación adicional de la fertilización de espermatozoides delfín.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tecnologías de reproducción asistida están poco desarrollados en los animales salvajes, incluyendo los mamíferos marinos. La falta de métodos sensibles para evaluar éxito fecundante de espermatozoides contribuye al lento desarrollo de tecnologías reproductivas en especies como los delfines. No fue hasta recientemente que los parámetros seminales básicos del delfín mular (Tursiops truncatus) fueron reportados1,2. Sin embargo, las variables tales como la motilidad y morfología, aunque ampliamente utilizado, dan información limitada sobre la eficiencia reproductiva. El mejor indicador de la calidad del esperma es la evaluación del potencial fecundante.

Recientemente, nuestro grupo utiliza un método para evaluar semen delfín potencial de la fertilización mediante la evaluación de formación pronuclear masculina o la formación de embriones híbridos después de la fecundación in vitro heteróloga con zona intacta ovocitos bovinos3. El uso de FIV heteróloga delfín bovino tiene ventajas importantes sobre fecundación in vitro homóloga, como supera la dificultad de obtener ovocitos de delfín y facilita el uso de bien probado en vitro sistemas de maduración de ovocitos bovinos. Para evitar la especificidad de especie, fecundación heteróloga se realiza generalmente en la ausencia de ZP. Aunque se permite para la evaluación de la capacidad de los espermatozoides con acrosoma reaccionado se fusionan con la membrana vitelina, deteriora la evaluación de otras características relacionadas con la fertilización. El procedimiento descrito utiliza ovocitos intactos de la zona y permite la evaluación de los siguientes parámetros: enlace zona de esperma y fijación, penetración, polyspermy, formación pronuclear y escote de embrión híbrido.

Aquí, presentamos varios protocolos de recogida de esperma, espermograma básico, congelación de espermatozoides, así como la evaluación de la funcionalidad del esperma de delfines mediante la evaluación de la formación de embrión pronuclear o híbrido macho después de la fecundación in vitro heteróloga con zona intacta ovocitos bovinos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

declaración de ética: todos los procedimientos experimentales fueron revisados y aprobados por el cuidado de Animal institucional y Comité de uso del Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). Todos los experimentos se realizaron de acuerdo a la guía para el cuidado y uso de animales de laboratorio, aprobado por la sociedad para el estudio de la reproducción y a la ley de Bienestar Animal para el cuidado de mamíferos marinos.

1. Delfín colección de semen y criopreservación

  1. preparación
    1. FERT hacer medio (heparina e hipotaurina-libre). Preparar el medio TALP FERT suplementado con bicarbonato de 25 mM, 22 mM sodio lactato, piruvato de sodio 1 mM, 6 mg/mL BSA libre de ácidos grasos y heparina 10 mg/mL (pH 7.4).
      Nota: Preparar este medio día de uso y mantenerlo a 38,5 ° C, bajo una atmósfera de 5% CO 2 y en el aire con una humedad máxima durante al menos 2 h antes de su uso.
    2. TRIS preparar huevo yema búfer. Disolver 30,28 g/L Tris, 16,75 g/L de ácido cítrico, fructosa de 12,5 g/L y estreptomicina 0.5 g/L en agua ultrapura (pH 7.3, osmolalidad = 310 mOsm/kg). Añadir la yema de huevo 20% (v/v).
  2. Formar un delfín macho de cría comprobada en postración dorsal cerca del borde de la piscina para colección de semen voluntario.
    Nota: El delfín macho debe ser entrenado más de 6 meses por refuerzo positivo, como se describió anteriormente 4.
  3. Realizar diversos estímulos táctiles presionando suavemente en la zona craneal de la ranura genital del delfín para provocar extrusión voluntaria del pene de la ranura genital.
  4. Después de alcanzar una erección completa, dirigir la punta del pene en un recipiente estéril para obtener eyaculado.
  5. Mantener la muestra de semen a 37 ° C hasta el análisis. Repita los pasos 1.3 y 1.4 para ejaculate sucesivas colecciones, utilizando un vidrio de propileno nuevo cada vez.
  6. Inmediatamente después de la colección, determinar el volumen de un cilindro de vidrio graduado previamente calentado a 37 ° C. evaluar el color, el pH y la osmolaridad (usando un micro-osmómetro) del eyaculado.
  7. Para evaluar la concentración de espermatozoides en el eyaculado, añadir 10 μl de la suspensión de esperma a un tubo eppendorf que contiene 90 μl de agua destilada. Determinar la concentración espermática usando un esperma recuento cámara.
    Nota: Durante la evaluación, mantener el resto del eyaculado a 37 ° C.
  8. Evaluar los parámetros de motilidad.
    1. Tomar 10 μl de la muestra de semen y colocarlo en una cámara de esperma con.
    2. Evaluar la motilidad mediante un sistema de análisis de espermatozoides asistido por ordenador, previamente validado para el delfín mular, objetivamente evaluar la motilidad de esperma 2.
      Nota: Si es necesario, diluir la muestra de semen con medio FERT (heparina e hipotaurina-libre) para la visualización adecuada de la movilidad de los espermatozoides. Durante la evaluación, mantener la muestra a 37 ° C sobre una platina del microscopio caliente.
  9. Tomar 20 μl de muestra de semen y evaluar la viabilidad y espermatozoides morfología descrita 5.
  10. Transferencia de la muestra de esperma a un tubo de centrífuga. Centrifugar la muestra de esperma a 250 x g durante 5 minutos. Tras determinar la concentración de esperma utilizando una cámara de conteo, ajustar la concentración de espermatozoides a 400 x 10 6 espermatozoides/mL.
    Nota: Si es necesario, diluir el sedimento de los eyaculados concentrados con plasma seminal aislado de un volumen de exceso del mismo eyaculado por centrifugación (250 x g, 10 min).
    1. En el transcurso de 5 minutos, diluir lentamente los espermatozoides de la muestra 1:1 (v/v) con un huevo yema de huevo-basado tampón TRIS que contiene 1.5% de glicerol. Coloque el tubo que contiene la suspensión de esperma a 5 ° C durante 1 h 30 minutos
    2. Realizar una segunda dilución de la suspensión de esperma con un TRIS de huevo que contiene glicerol para obtener una concentración final de glicerol de 3% y una concentración final de 200 x 10 6 espermatozoides/mL de búfer basados en la yema de huevo. Mantener la suspensión de esperma a 5 ° C durante 10 minutos
  11. Cargar la suspensión de semen en pajillas de 0.25 mL. Sellado de las pajuelas. Lugar la paja en un rack de 4,5 cm por encima del nitrógeno líquido durante 10 minutos sumergirse las pajillas en nitrógeno líquido y hasta evaluación.

2. Heterólogo In Vitro fertilización usando Zona intacta ovocitos bovinos

solución
  1. preparación
    1. preparar la tinción y el medio de montaje.
      1. Hoechst preparar solución stock disolviendo 1 mg de Hoechst en 1 mL de agua destilada. Hacer 30 alícuotas μl y mantenerlos en la oscuridad a-20 ° C hasta su uso. Preparar solución de tinción añadiendo 25 μl de la solución madre de Hoechst a 5 mL de tampón fosfato salino (PBS) suplementada con 1 g/L de PVA. Mezclar bien y mantener en la oscuridad a 4 ° C hasta su uso.
      2. Medio de montaje de
      3. preparar mezclando 6,25 mL de PBS con 6,25 mL de glicerol y 6,25 μl de solución stock de Hoechst. Mezclar bien y mantener en la oscuridad a 4 ° C hasta su uso.
    2. Preparar el medio para la fertilización de colección y en vitro de ovocitos.
      1. Preparar una solución salina mediante la adición de 0,5 mL de gentamicina al 0.9% NaCl destilada agua.
      2. Preparar el medio común de maduración mediante la adición de 10 ng/mL factor de crecimiento epidérmico (EGF) y 10% de suero fetal de ternero (FCS) para 10 mL de TCM-199. Mantener ambos medios a 38,5 ° C, bajo una atmósfera de 5% CO 2 y en el aire con una humedad máxima durante al menos 2 h antes de su uso.
  2. Recoger los ovarios en el matadero en solución salina a 33-35 ° C y transportarlas al laboratorio dentro de las 4 h de colección de.
  3. Una vez en el laboratorio, lavar los ovarios tres veces para eliminar los desechos y sangre con solución salina previamente calentada a 37 ° C. mantener los ovarios en solución salina a 37 ° C durante el proceso de.
  4. Aspirar folículos de 2 a 8 mm con un 18G aguja y una jeringa de 10 mL. Recoger el líquido folicular aspirado en tubos de 50 mL.
  5. Permitir que el líquido folicular que contiene los ovocitos reposar unos 15 minutos a 37 ° C, hasta que el sedimento de células. Quite el sobrenadante del tubo con una pipeta Pasteur y resuspender el precipitado en PBS.
  6. Recuperar los complejos cúmulo-ovocitos (AOC) en platos de 90 mm bajo un estereomicroscopio.
  7. Lavar el AOC tres veces en PBS y una vez en medio de maduración.
  8. Transferir AOC morfológicamente normales para pozo de 4 platos, cada bien que contenga 500 mL de medio de maduración, en grupos de 50 AOC por bien.
    Nota: Aquí, tres pozos – bien heterólogas FIV, un control bien para la FIV homóloga y bien que contiene sólo madurado AOC como un partenogenético control – se usa.
  9. Incubar los AOC por 24 h a 38,5 ° C, bajo una atmósfera de 5% CO 2 y aire con humedad máxima.
  10. Preparar el medio y el gradiente de densidad.
    1. Para preparar medio de fertilización (FERT), complementar el medio TALP FERT con bicarbonato de 25 mM, 22 mM sodio lactato, piruvato de sodio 1 m m, 6 mg/mL BSA libre de ácidos grasos y heparina 10 mg/mL. Mantener a 38,5 ° C, bajo una atmósfera de 5% CO 2 y en el aire con una humedad máxima durante al menos 2 h antes de su uso.
    2. Preparar el gradiente de densidad agregando 1 mL de medio de gradiente de densidad en un tubo de 15 mL y 3 mL de solución en un tubo de 15 mL de lavado. Mantener a 38,5 ° C por lo menos 1 h.
  11. Lavado el en vitro madurado ovocitos dos veces en medio FERT.
  12. Transfiera los ovocitos a platos 4-bien, bien que contienen los 50 AOC en 250 mL de FERT. Mantener los platos de 4 pozos a 38,5 ° C, bajo una atmósfera de 5% CO 2 y en el aire con una humedad máxima mientras se prepara el esperma para la fertilización.
  13. Descongelar una paja congeladora que contienen espermatozoides de delfín en un baño de agua a 37 ° C durante 50 s.
    Nota: Semen de bovino para la FIV homóloga debe ser procesada en paralelo, siguiendo el protocolo estándar para homólogo FIV bovina.
  14. Tomar 10 μl de esperma de la muestra y colóquela en un espermatozoide con cámara de conteo. Evaluar la motilidad utilizando un sistema de análisis de espermatozoides asistido por ordenador, previamente validado para la especie, para evaluar objetivamente la motilidad del esperma. Durante este tiempo, mantener la muestra de esperma a 38.5 ° C.
  15. Añadir la muestra de semen en el tubo de gradiente de densidad (paso 2.10.2). Centrifugar 10 min a 250 g. x
  16. Retire con cuidado el sobrenadante con una pipeta Pasteur. Añadir 3 mL de la solución de lavado al tubo que contiene el precipitado. Resuspender el pellet mezclando suavemente.
  17. Centrifugar 5 min a 250 x g. quitar el sobrenadante con una pipeta Pasteur a un volumen de esperma de 300 μl.
  18. Añadir 5 μl de la suspensión de espermatozoides en una microcentrífuga con 95 μl de agua destilada. Mantener la suspensión de espermatozoides en 38.5 ° C. relleno el recuento celular de cámara con 10 μl de la 1:20 dilución del esperma y medida de la concentración. Calcular la cantidad de medio de fertilidad que debe añadirse a 100 μl de semen para obtener 2 x 10 6 espermatozoides/mL.
  19. Agregar el volumen calculado de fertilidad y los espermatozoides en un tubo de 15 mL y mezclar suavemente con una pipeta de Pasteur.
  20. Añadir 250 μl de la suspensión de esperma-FERT en cada pocillo de la placa de 4 pozos que contienen el medio de fertilidad con los ovocitos madurados para obtener una concentración final de 1 x 10 6 espermatozoides/mL.
  21. Co incubar durante 18 h a 38,5 ° C, bajo una atmósfera de 5% CO 2 y en el aire con una humedad máxima de los gametos.
  22. Preparar el medio de cultivo basado en el fluido sintético de oviducto suplementado con 5% FCS. Preparar 25 μl del cultivo líquido oviducto sintético gotitas en platos de 35-mm cubiertos con 3 mL de aceite mineral. Mantener a 38,5 ° C, bajo una atmósfera de 5% CO 2 y en el aire con una humedad máxima durante al menos 2 h antes de su uso.
  23. En el post 2,5 h de incubación en Co, retire el plato de 20 ovocitos; mantener los ovocitos restantes en la incubadora bajo las mismas condiciones.
    1. Eliminar los espermatozoides libremente conectados por la mitad de los ovocitos a través de una pipeta de Pasteur estrecho alesaje pipetear enérgicamente 10 veces.
    2. Fijar los 20 ovocitos en 50 μl de glutaraldehído del 0,5% durante 30 minutos lavado transfiera los ovocitos en PBS durante 5 minutos los ovocitos a 50 μl de la solución de tinción de Hoechst durante 15 min y lavar los ovocitos en PBS durante 5 minutos
    3. Transfiera los ovocitos individualmente a 2 gotas de μl de medio de montaje a una velocidad de 10 ovocitos por diapositiva. Cubrir con un cubreobjetos y sellar con esmalte de uñas.
    4. Cuenta el número de espermatozoides a los ovocitos bovinos utilizando un microscopio de contraste de fase equipado con óptica epifluorescente y un filtro de excitación de nm 361 aumento 40 x.
  24. Después de 12 h de la incubación, saque 10 cigotos presuntos de los platos de 4 pozos; mantener los cigotos presuntos restantes en la incubadora bajo las mismas condiciones.
    1. Transferencia el 10 presuntos cigotos a una centrífuga de 15 mL del tubo que contiene 2 mL de PBS y de vortex por 2 minutos para eliminar las células del cúmulo. Lavar dos veces en PBS, fix y la mancha, como describió anteriormente (paso 2.23.2.)
  25. Después de 18, 20, 22 y 24 h de incubación Co, quitan 10 presuntos zigotos de los platos de 4 pozos y vortex, fijar y la mancha les como se describió anteriormente (paso 2.23.2). Mantener el resto de los presuntos cigotos en la incubadora bajo las mismas condiciones.
    1. Evaluar formación pronuclear y polyspermy bajo el microscopio de fase-contraste/epifluorescente en los grupos FIV homólogos y heterólogos mediante tinción con Hoechst.
    2. Evaluar formación pronuclear en cigotos de híbrido presunto escogido de forma aleatoria 10 por muestra. Confirman formación pronuclear bajo un láser confocal de barrido microscopio de excitación del láser de argón de 488 nm y detección de 515 a 530 nm.
    3. Sección ópticamente cigotos presuntos secuencialmente (2 mm) y recoger imágenes utilizando un software de proyección de imagen. Visualizar utilizando un paquete de software de análisis 3D.
    4. Después de 24 h de incubación Co, lavar 50 zigotos presuntos cuatro veces en PBS y dos veces en medio de cultivo.
  26. Transferencia en grupos de 25 a microgotas de medio de cultivo previamente preparado y equilibrado.
  27. Mantener a 38,5 ° C bajo una atmósfera de 5% O 2 / 5% CO 2 y aire con humedad máxima.
  28. Después de 26 y 28 h de incubación Co, 10 presuntos cigotos Retire los platos y vortex, fix y mancha de ellos, como se describió anteriormente (paso 2.23.2).
  29. Después de 48 h de cultivo, observar el escote bajo un estereomicroscopio.
  30. Remover la zona pelúcida (ZP) transfiriendo los embriones a una solución de proteasa de 5 mg/mL.
  31. Lavar individualmente cada embrión tres veces en PBS. Rápido-congele les en nitrógeno líquido en tubos de microcentrífuga de 0.2 mL. Almacenarlas a-80 ° C hasta análisis.

3. Polimerización en cadena

  1. materiales y reactivos
    Nota: los reactivos, materiales y equipos utilizados para realizar el protocolo de la PCR se detallan en la tabla de materiales e incluyen un estante de tubo de PCR y un set de Micropipetas (P2, P20, P200, P1000), 1,5 mL tubos de microcentrífuga, tubos PCR y tapas, un termociclador, un iluminador UV, gel de agarosa y buffer (Tris borato EDTA (TBE)).
    1. Descongelar suavemente todos los reactivos en el hielo. Mantener en hielo durante todo el experimento. Uso de Deoxynucleótidos por (dNTPs; dATP, dCTP, dTTP y dGTP), destino cartillas de referencia gen que codifica para la proteína ribosomal de delfines 18 S (DQ404537.1); R1: TTGGACACACCCACGGTGCGG y F2: CAGAAGGACGTGAAGGATGGA), ADN polimerasa, tampón de X 5 de polimerasa de la DNA, DNA plantilla, agua estéril y cloruro de magnesio (MgCl 2 en una concentración final de 5,0 mM).
    2. Agarosa preparación de gel y de la muestra.
      1. Preparar esperma delfín y bovina DNA muestras.
        1. Deshielo una pajilla congelada de cada especie en un baño de agua a 37 ° C por 50 s. Añadir 3 mL de solución de lavado. Centrifugar a 250 x g durante 10 minutos retirar el sobrenadante. Añadir 30 μl de tampón de lisis STES (50 mM Tris-HCl, pH 8; 20 mM NaCl; y 1 mM 0,1% SDS), 2 μl de proteinasa K (20 mg/mL) y 5 μl de Ditiotreitol (DTT); concentración final: 150 mM. Mantener durante la noche a 55 º C. agregar 200 μL de agua ultrapura. Centrifugar a 250 x g por 5 min mantenga el sobrenadante. Medir la concentración de ADN utilizando un espectrofotómetro de.
      2. Realizar diluciones seriadas del ADN en espermatozoides de delfín (es decir, 40, 4 y 0.4 ng/mL) con agua ultrapura para comprobar que las condiciones PCR son capaces de detectar una pequeña cantidad de delfines ADN.
      3. Realizar diluciones seriadas de esperma bovina DNA (es decir, 4.000, 40, 400 y 4 ng/mL) con agua ultrapura para comprobar que las condiciones PCR son capaces de detectar una pequeña cantidad de ADN bovino.
      4. Preparar los embriones bovinos y delfines. Descongelar los embriones en el hielo. Agregar 8 μl de proteinasa μg/mL 100 K y mantener durante la noche a 55 º C. Para detener la reacción, colocar las muestras a 96 ° C por 5 min
      5. Preparar buffer TBE 2% agarosa gel y añadir 20 μl de colorante de ácidos nucleicos usando las técnicas estándar.
    3. Preparación de la PCR.
      1. Tubo de PCR de etiqueta (s): diluciones seriadas de delfín (40, 4 y 0.4 ng/mL), bovinas diluciones seriadas (4.000 400, 40 y 4 ng/mL), homólogo bovino embriones de dos células, embriones heterólogos presuntos de dos células y el control negativo.
      2. Preparar una mezcla de maestro en un tubo de microcentrífuga de 1,5 mL estéril hasta un volumen final de 25 μl por reacción.
        1. Añadir 5 μl de tampón de flexi de polimerasa de ADN X 5, 0.5 μl de dNTPs (10 mM) 1.5 μl de MgCl 2 (25 mM), 0,5 μl de cebador hacia adelante y hacia atrás (10 μm), 1,5 μl de plantilla de la DNA (espermatozoides) o 8 μl de plantilla de la DNA (embriones de dos células) , 0,07 μl de Taq polimerasa y estéril destilada agua hasta un volumen final de 25 μl. Mezcle bien.
  2. Protocolo de amplificación
    1. Coloque los tubos en el termociclador. Seleccionar el siguiente programa: 94 ° C por 3 min; 40 ciclos de 94 ° C por 15 s, 59 ° C por 25 s, 72 ° C por 20 s; y 72 ° C por 5 min iniciar el programa.
    2. Almacenar los tubos a 4 ° C. Añadir 2.5 μl de tampón de cada producto PCR en 4 ° C y carga 15 μl de la mezcla de carga en los pocillos del gel de agarosa al 2%. Use un marcador de escala de ADN para la estimación del tamaño exacto de los fragmentos PCR.
    3. Realizar electroforesis durante 15 min permitir la migración del ADN. Visualizar bandas usando un iluminador UV.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los resultados, tablas y figuras (1 y 2) presentadas fueron reproducidas con permiso3.

Espermatozoides de delfines tienen alta motilidad después de la congelación y descongelación

Los eyaculados de delfín congelado porcentajes (% ± SD) de 84,5 ± 5.3 total motile y 69,1 ± 5.1 espermatozoides móviles progresivos. En términos de movilidad, estos números son representativos de espermatozoides criopreservados de alta calidad.

Espermatozoides de delfines son capaces de penetrante zona intacta ovocitos bovinos y producción de embriones híbridos

Figura 1A y tabla 1 show delfines espermatozoides atados ZP bovina después de 2,5 h de incubación conjunta. Espermatozoides de delfín fueron Unidos en un mayor porcentaje de espermatozoides bovinos (figura 1B y tabla 1). De hecho, microscopía de fluorescencia muestra que delfín espermatozoides son capaces de penetrar la zona espermatozoides bovinos intacto (figura 1), hacia la formación pronuclear y escote ( tabla 1yFigura 1E ). Esto fue confirmado por microscopia confocal (figura 1 y Figura 1F). No polyspermy se observó en los ovocitos del grupo FIV heterólogo después de 12 h de incubación Co (tabla 1). Formación pronuclear en la fecundación in vitro heteróloga alcanzó el porcentaje más alto a las 24 h, un tiempo más largo que en el grupo homólogo, que se produjo a las 18 h de incubación Co (tabla 1). El tipo de escote a las 48 h después de la incubación fue menor en la heteróloga la FIV homóloga (tabla 1). Una tasa de activación partenogenética espontánea de 8.0% fue observada en ovocitos no fecundados madurados bovinas a las 48 h (tabla 1).

Finalmente, los resultados PCR confirmaron la presencia de material genético de delfín en los embriones híbridos (figura 3) mediante la evaluación de la presencia de un gen de referencia delfín que codifica para el ribosomal 18 S proteína (figura 2).

Figure 1
Figura 1: espermatozoides delfín atado a la bovina zona pelúcida (ZP). Dolphin adjunto (A) y bovino (B) espermatozoides después de 2,5 h de incubación conjunta con zona intacta ovocitos bovinos. Gametos fueron teñidos con Hoechst y visualizados con microscopio de contraste de fase (40 aumentos). Un espermatozoides de delfines en el espacio periviteline de un oocito bovino (C y D) y una decondensing cabeza de delfín esperma en el citoplasma de ovocitos bovinos (E). Las imágenes fueron capturadas con un microscopio confocal y corresponden al plano ecuatorial del presunto cigoto (tinción de Hoechst; 40 aumentos). Dos pronúcleos (F) observadas bajo un microscopio de contraste de fase después de 24 h de FIV heteróloga que consiste en la incubación de espermatozoides delfín con zona intacta ovocitos bovinos (tinción de Hoechst; 40 aumentos; Barra de escala = 25 μm). Se reprodujo la figura de referencia3 con permiso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: representante de electroforesis (agarosa 2% gel bromuro de etidio manchado) mostrando los resultados de amplificación de PCR para el gene de delfines 18 S. Carriles 1 a 30 ver embriones de presunto delfín/bovinos híbridos; líneas S1 y S2 presentan 4 ng/mL y 0,4 ng/mL delfín espermatozoides DNA, respectivamente; y carriles de C1 a C5 con dos células embriones bovinos y H2O (agua) (el control en blanco). La flecha indica la banda de 190 bp correspondiente al amplificado 18 S rDNA. Se reprodujo la figura de referencia3 con permiso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: imágenes representativas de embriones híbridos. Imagen representativa de un embrión de dos células híbridas (A) a las 48 h de incubación (tinción de Hoechst; 40 aumentos). Embriones híbridos sin manchas a las 48 h de incubación, en las diferentes etapas de la división, visualizadas bajo el estereomicroscopio (B). Haga clic aquí para ver una versión más grande de esta figura.

Table 1
Tabla 1: tasas de apego, polyspermy, formación pronuclear y escote tras incubación Co homóloga y heteróloga con ovocitos bovinos y espermatozoides bovinos o delfín, respectivamente. Las variables se analizaron con ANOVA (prueba de Kruskal-Wallis y Mann-Whitney). Los valores se expresan como la media ± SEM (gama) de doce repeticiones; n = el número total de ovocitos o cigotos presuntos examinados. La tabla fue reproducida de referencia3 con permiso. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Para muchas especies mamíferas diferentes, hay diversas ventajas al uso de semen congelado. Estos incluyen la capacidad de transferir material genético valioso, el potencial de distribución en todo el mundo, el bajo riesgo de contaminación y la capacidad de preservar gametos masculinos durante décadas. El uso de espermatozoides criopreservados es esencial para el delfín mular, porque esta especie está protegida en el Apéndice II de CITES, que limita el transporte y el intercambio de animales entre diferentes parques acuáticos. Transporte de delfines es una actividad que crea los problemas logísticos y peligrosos riesgos. Sin embargo, abstenerse de transporte también tiene consecuencias como el riesgo de introducción de consanguinidad de una población en cautiverio de animales. Una solución es la criopreservación de espermatozoides. Algunos autores han criopreservado delfín esperma5,7,8,9, con muy resultados alentadores. Por otra parte, en 2005, el primer nacimiento de una cría de delfín concebido por inseminación artificial con semen criopreservado fue divulgado10. Algunos años más tarde, esto fue hecha usando espermatozoides clasificados sexo11.

Esperma de delfines ha sido cryopreserved usando diferentes técnicas, de métodos sofisticados, como un congelador programable5, a los métodos comunes, tales como hielo seco12 o líquido nitrógeno vapores2,9, 13. La principal ventaja de utilizar hielo seco o nitrógeno líquido vapores es la posibilidad de criopreservar en el mismo lugar donde se extrae el semen, sin el uso de equipos altamente especializados. Semen congelado en pajuelas en poliestireno en vapores de nitrógeno líquido es un método simple, rápido y barato13. En la práctica, cuando esta metodología se ha utilizado en delfines, la motilidad espermática fue 65%. Sin embargo, es importante considerar lo difícil que es establecer un método estandarizado: la técnica puede estar influenciada por factores externos, como temperatura, humedad, tamaño del poliestireno, etcetera. Por lo tanto, más estudios son necesarios para optimizar y estandarizar el procedimiento para mejorar el éxito de la utilización de semen congelado con el método de vapor de nitrógeno líquido.

Con el fin de optimizar un protocolo de congelación, es importante desarrollar un método confiable para la evaluación funcional de los espermatozoides. Fecundación in vitro es un buen medio para probar el potencial de fertilización de espermatozoides. Idealmente, ovocitos delfín deben utilizarse para la FIV, pero los procedimientos difíciles y laboriosos para obtener ovocitos de hembras representan una restricción importante. Por lo tanto, la posibilidad de utilizar la fecundación in vitro heteróloga abre un nuevo medio para probar la eficiencia de la fertilización en el delfín. Ovocitos de otras especies pueden utilizarse para delfín heteróloga FIV. Los resultados muestran que se puede realizar FIV heteróloga entre ovocitos bovinos y delfín espermatozoides. Espermatozoides congelados y descongelados delfín pueden penetrar el ovocito bovino intacto de la zona y generar un embrión híbrido.

La combinación presentada de protocolos para la recolección, hielo-deshielo, realizar FIV heteróloga con ovocitos bovinos han sido demostrados con éxito y representa un paso inicial para la optimización de la criopreservación y la evaluación de esperma de delfín. Es importante tener en cuenta que todavía hay muchas incógnitas en estos procedimientos. Sin embargo, la posibilidad de criopreservar semen de delfines lo hace accesible y permite que se mantenga en los laboratorios. Esto facilitará los estudios científicos y puede conducir a una mejor comprensión de la fisiología, composición y comportamiento de los espermatozoides.

La evaluación de los espermatozoides por la fecundación in vitro heteróloga puede facilitar la optimización de los protocolos de congelación, pero también puede ser utilizado en el futuro para probar y seleccionar los machos para la eficiencia de la fertilidad. Una consideración importante es la relación entre fertilización real números y valores de fecundación in vitro heterólogos. Además y debido a la novedad de la FIV heteróloga entre estas dos especies filogenéticamente distantes, bovinos y delfines, pueden construirse nuevas hipótesis biológicas. En conjunto, estos protocolos de abren un nuevo espacio para la investigación sobre la reproducción de los delfines y otros mamíferos marinos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

su trabajo fue financiado por el Ministerio de economía y competitividad (70140-AGL2015-R a D. Rizos), AGL2015-66145R A. Gutierrez-Adan y J. F. Pérez-Gutiérrez y la Fundación Séneca de Murcia (Grant 20040/germen/16 a F. García Vázquez)

Materials

Name Company Catalog Number Comments
FERT-TALP medium Merck
TCM-199 Sigma M-4530
Hoechst 33342 Sigma B-2261
4-well dishes Nunc 176740
Density gradient BoviPure Nidacon International BP-100
Washing solution Boviwash Nidacon International BW-100
Magnesium chloride Promega A35 1H
Sterile water Mili Q sintesis A10 Millipore A35 1H
Buffer Tris Borate EDTA Sigma T4415
MB agarose Biotools 20.012
5X GoTaq flexi buffer Mili Q sintesis A10 Millipore M 890 A
MB agarose Biotools 20.012
Taq polymerase Promega
SafeView NBS Biologicals Ltd. M 890 A
Makler counting chamber Sefi Medical
Thoma chamber Hecht-Assistant
pHmeter MicropH 2000 Crison Instruments
Osmometer Advanced micro osmometer 3300 Norwood
Computer assisted sperm analysis system Projectes y Serveis R+D
Stereomicroscope MZ 95 Leica
Epifluorescent optics Eclipse Te300 Nikon
Confocal assistant 4.02 software Bio-Rad 3D analysis software
Confocal laser scanning microscopy Bio-Rad
Micropippetes (P2. P20, P200, P1000) Gilson
Microcentrifuge tubes VWR
UV iluminator Bio-Rad
PCR Thermal cycler Primus 96 Plus MWG AG Biotech

DOWNLOAD MATERIALS LIST

References

  1. Montano, G. A., et al. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 143, (6), 799-813 (2012).
  2. Sánchez-calabuig, M. J., et al. Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 49, (5), 761-768 (2014).
  3. Sánchez-calabuig, M. J., et al. Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa. Theriogenology. 84, (6), 983-994 (2015).
  4. Keller, K. V. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. IAAAM. 14, (22), 22-24 (1986).
  5. Robeck, T. R., O'brien, J. K. Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 70, (5), 1340-1348 (2004).
  6. Coy, P., et al. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 135, (1), 19-27 (2008).
  7. Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).
  8. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  9. Sánchez-Calabuig, M. J., et al. Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 50, (2), 227-235 (2015).
  10. Robeck, T. R., et al. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). Reproduction. 129, (5), 659-674 (2005).
  11. Robeck, T. R., et al. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). Anim Reprod Sci. 139, (1-4), 168-181 (2013).
  12. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  13. Madeddu, M., et al. Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen. Anim Reprod Sci. (2016).
Tonina Delfín (<em>Tursiops truncatus</em>) espermatozoides: recolección, criopreservación y fecundación <em>In Vitro</em> heteróloga
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).More

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter