Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

تحليل فصل الكروموسوم، هيستون أستيلاتيون، و مورفولوجيا المغزل في البويضات الحصان

doi: 10.3791/55242 Published: May 11, 2017

Summary

تصف هذه المخطوطة نهجا تجريبيا لتوصيف البويضات الحصانية شكليا وبيولوجيا كيميائيا. على وجه التحديد، ويوضح العمل الحالي كيفية جمع البويضات الحصان غير ناضجة وناضجة عن طريق الموجات فوق الصوتية الموجهة البيك البيك اب (أوبو) وكيفية التحقيق الفصل الكروموسوم، مورفولوجيا المغزل، هيستون العالمية هيستيون، والتعبير مرنا.

Abstract

وقد تم تطوير مجال المساعدة على الإنجاب لعلاج العقم لدى النساء والحيوانات المصاحبة والأنواع المهددة بالانقراض. في الحصان، كما يسمح الاستنساخ بمساعدة لإنتاج الأجنة من الأداء العالي دون انقطاع حياتهم الرياضية ويسهم في زيادة في عدد من المهرات من الفرس ذات القيمة الوراثية العالية. يصف المخطوطة الحالية الإجراءات المستخدمة لجمع البويضات غير الناضجة والناضجة من المبيض الحصان باستخدام البيضة البيك اب (أوبو). ثم استخدمت هذه البويضات للتحقيق في حدوث أنيوبلوادي عن طريق تكييف بروتوكول وضعت سابقا في الفئران. على وجه التحديد، كانت الكروموسومات و سينتروميرس من الطور الثاني البويضات (مي) فلورزنتلي المسمى وتحسب على خطط التنسيق متتابعة بعد متحد البؤر المجهر ليزر المسح الضوئي. وكشف هذا التحليل عن حدوث أعلى في معدل أنيوبلوادي عندما تم جمع البويضات غير ناضجة من المسام ونضجت في المختبر مقارنة معفي الجسم الحي. المناعية للأنبوبين وشكل أستيل من هيستون أربعة في مخلفات يسين محددة كشفت أيضا الاختلافات في مورفولوجيا المغزل الانتصافي وفي النمط العالمي من أستيون هيستون. وأخيرا، تم التحقيق في التعبير عن ترميز مرناس لهستون ديستيلاسيس (هداس) وأسيتيل-ترانسفاسيس (هاتس) عن طريق النسخ العكسي والكمي ير (ف ير). لم تلاحظ أي اختلافات في التعبير النسبي للنصوص بين في المختبر وفي الجسم الحي نضجت البويضات. في اتفاق مع إسكات العام للنشاط النسخي خلال النضج البويضة، وتحليل مجموع المبلغ نص يمكن أن تكشف فقط استقرار مرنا أو تدهور. ولذلك، فإن هذه النتائج تشير إلى أن الأنظمة الأخرى متعدية وبعد متعدية قد تتأثر.

وعموما، فإن هذه الدراسة تصف نهجا تجريبيا ل مورفولوجيا و بيوشيميكالي وصف بويضة الحصان، و سيليرة لبنانية نوع من الصعب للغاية لدراسة بسبب انخفاض توافر عينة. ومع ذلك، فإنه يمكن توسيع معرفتنا على البيولوجيا التناسلية والعقم في الأنواع أحادي.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد تم تطوير مجموعة واسعة من تقنيات المساعدة على الإنجاب لعلاج العقم لدى النساء والحيوانات المصاحبة والأنواع المهددة بالانقراض. واحدة من الإجراءات الأكثر شيوعا في البيئات السريرية هو استرجاع الطور الثاني (مي) البويضات -stage من الجريبات المبيض عن طريق الموجات فوق الصوتية الموجهة المهبل المهبل، البيضاوي البيك اب (أوبو) 1 . ثم يتم تسميد هذه البويضات في المختبر (إيف)، مع الجنين الناتجة (ق) زرعها في الرحم المستلم. يتم استرجاع البويضات مرحلة مي (ناضجة) بعد إدارة الغدد التناسلية الخارجية. ومع ذلك، يرتبط هذا العلاج، في بعض المرضى، مع تطور متلازمة فرط المبيض (أوهس) 2 .

الاستفادة من القدرة الذاتية من نمت بشكل كامل، البويضات غير ناضجة (GV- مرحلة) لاستئناف عفوية الانقسام الاختزالي مرة واحدة معزولة عن بصيلاتهم، فمن الممكن الحصول على البويضات ناضجة دون أدمينيستيرون الغدد التناسلية 3 . ويسمى هذا الإجراء البويضات في النضج المختبر (إيفم) ويمثل أقل موجهة نحو المخدرات، وأقل تكلفة، وأكثر ملاءمة للمريض نهج لمساعدة التكنولوجيا الإنجابية. ومع ذلك، فإن نجاح تطوير الجنين مع البويضات في المختبر -matured أقل عموما من مع في الجسم الحي نضجت البويضات 4 ، 5 . تفسير محتمل هو أن في المختبر نضجت البويضات هي أكثر تضررا من الأخطاء في الفصل الكروموسوم، و أنيوبلوادي يؤدي إلى إعاقة التطور الجنيني الطبيعي 6 .

وفهم الأساس الجزيئي من الكروموسومات سوء الفصل أثناء إيفم الكشف في نهاية المطاف عن الإمكانات الكاملة لهذه التقنية. في هذا السياق، استخدم المنهج التجريبي للتحقيق في السمات المورفولوجية والبيوكيميائية للبويضات في المختبر -mureded، مقارنة مع في الجسم الحي نضجيتم وصف البويضات إد هنا 7 ، 8 . على وجه التحديد، يتم توضيح إجراءات ل أوبو من البويضات غير ناضجة وناضجة و إيفم من البويضات غير الناضجة باستخدام الخيول الكبار والطبيعة بشكل طبيعي كنموذج تجريبي. ثم، يتم استخدام المناعي وتحليل الصورة للتحقيق الكروموسوم الفصل، مورفولوجيا المغزل، والنمط العالمي من أستيون هيستون على هذه غاميتس. وأخيرا، وصف بروتوكول من النسخ العكسي وكمية ير لتحليل التعبير مرنا.

وبالمقارنة مع النماذج الحيوانية القوارض، والخيول لا تسمح التلاعب الجيني، هي أقل سهولة للتلاعب، وتتطلب صيانة باهظة الثمن. ومع ذلك، فإن هذا النموذج يكتسب اهتماما كبيرا لدراسة النضج البويضة 9 ، 10 بسبب تشابه لعلم وظائف الأعضاء المبيض الإنسان 11 ، 12 </ سوب>. وعلاوة على ذلك، فإن وضع بروتوكولات موثوقة من إيفم-إيف في الحصان له مصلحة اقتصادية كبيرة، لأنها تسمح لزيادة في عدد من المهرات من الفرس من القيمة الجينية العالية.

واحدة من القيود المفروضة على إجراء التجارب على البويضات، وخاصة في الأنواع أحادي، هو توافر عينة مقيدة. وقد تم التغلب على هذا الحد هنا عن طريق تعديل نهج، وضعت سابقا في الفئران، لبويضات الحصان 13 ، 14 من أجل إجراء العد الكروموسوم الذي يقلل من فقدان العينة (انظر المناقشة للمقارنة مع التقنيات المتاحة الأخرى). وعلاوة على ذلك، تم تحسين بروتوكول تلطيخ الثلاثي مضان لإجراء تحليلات متعددة على نفس العينة، وأجريت التحليلات q- ير على برك من 2 البويضات فقط.

وعموما، فإن هذه الدراسة تصف نهجا تجريبيا يهدف إلى تشورفيا و تشيميا كيميائياراكتريز البويضة الحصان، وهو نوع من الخلايا التي هي صعبة للغاية للدراسة بسبب توفر عينة منخفضة. ومع ذلك، فإنه يمكن توسيع معرفتنا في البيولوجيا التناسلية والعقم من الأنواع أحادي.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد تمت الموافقة على جميع الإجراءات من قبل لجنة رعاية الحيوان واستخدامها سييا فال دي لوير رقم 19 وتم تنفيذها وفقا للمبادئ التوجيهية لرعاية واستخدام الحيوانات المختبرية.

1. جمع البويضات والنضج في المختبر

  1. البيضة البيك اب
    1. تقييم يوميا عن طريق الموجات فوق الصوتية قطر بصيلات المبيض في فوج من فرس الكبار. في ظهور بصيلات ≥33 مم (الجريب المهيمن)، حقن الفرس مع 1500 وحدة دولية من الغدد التناسلية المشيمية البشرية (قوات حرس السواحل الهايتية) في الجزء العلوي من الوريد الوداجي (الرابع).
      1. قبل تنفيذ الحقن، مسحة المنطقة مع الكحول، حدد ثقب الوداجي، ووضع الإبهام 2-3 سم تحت موقع الحقن للحث على الوريد في الارتفاع. إدراج الإبرة موازية تقريبا على الرقبة ونضح للتأكد من أن الإبرة في الوريد (الدم سوف يدخل حقنة). عند هذه النقطة، حقن. هغ سوف تحفز متشبع البويضة في الجريب المهيمنة.
    2. 35 ساعة بعد الحقن هغ، رزين الفرس مع ديتوميدين (15 ميكروغرام / كغ، الرابع)، طرطرات بوتورفانول (10 ميكروغرام / كغ، الرابع) و بروميل بوتيلسكوبولامين (0.2-0.3 ملغ / كغ، 15 مل / فرس، 4).
    3. ربط الإبرة إلى الموجات فوق الصوتية التحقيق. إدراج الموجات فوق الصوتية التحقيق عن طريق المهبل وعقد المبيض ترانزريكتالي لمواجهة الموجات فوق الصوتية التحقيق. توجيه مشغل واحد للمناورة الإبرة والآخر لعقد المبيض في المكان، مع بصيلات تواجه مسبار الموجات فوق الصوتية . تبدأ من المبيض مع بصيلات المهيمنة.
    4. ثقب الجدار المهبلي وجدار الجريب المهيمن مع الإبرة (مجسات الموجات فوق الصوتية ل أوبو مجهزة قناة للإبرة متصلة بنظام الشفط). سوف ينيدل تكون مرئية في الصورة إكوغرافيك.
    5. نضح السوائل الجريبي في أنبوب مخروطي 50 مل متصلة بنظام الشفط. صب محتوى المخروطيةأنبوب إلى طبق بتري كبير والبحث عن مجمع البويضة المركب (كوك) باستخدام ستيريوميكروسكوب.
    6. منذ كوك لا يتم استرجاعها دائما مع السائل الجريبي، مسح بصيلات مع المالحة المعدلة الفوسفات المالحة المالحة (دبس) التي تحتوي على 5 إيو / مل هيبارينات 37 درجة مئوية. فحص دبس لوجود كوك، كما هو موضح سابقا للسائل الجريبي في الخطوة 1.1.5. تدفق عدة مرات حتى يتم استرداد كوك.
    7. مرة واحدة يتم استرداد كوك من الجريب المهيمن، ثقب ومسح بصيلات ≥5 و ≤25 مم، كما هو موضح للجريب المهيمن في الخطوات 1.1.3-1.1.4. الجريبات ≥5 و ≤25 لا تعبر عن هرمون لوتينيزينغ / كوريوغونادوتروبين مستقبلات (لغر)، وبالتالي، فإن البويضات لا تنضج ردا على قوات حرس السواحل الهايتيه وسيتم جمعها في مرحلة غف (غير ناضجة). تبقي فقط كوك مع عدة طبقات كاملة من الخلايا الركام والبني، والبلازما حبيبات ناعما. تجاهل الآخرين.
    8. في نهاية أوبو، فيجيكت الفرس مع البنزيل والبنسلين 15،000 وحدة دولية / حيوان لمنع العدوى.
    9. منزل الفرس في هادئة ونظيفة مستقرة لمدة لا تقل عن 2 ساعة. تحقق علامات الوعي من خلال تحديد موقف الأذنين، رد فعل على المحفزات (على سبيل المثال، الضوضاء)، والمشية قبل أن يعود الفرس إلى الشركة من الحيوانات الأخرى.
  2. النضج في المختبر
    1. (HM120) هيبس هيومان، هيبارين، و 0.4٪ من ألبومين المصل البقري (بسا)، والبنسلين، والستربتومايسين إلى 37 درجة مئوية. إعداد هذه الوسيلة مقدما. تصفية تعقيم والحفاظ عليه في 4 درجات مئوية لمدة تصل إلى 6 أشهر.
    2. إعداد المتوسطة إيفم عن طريق استكمال ناهكو 3- مخزنة TCM199 (25 ملي ناهكو 3 ) مع 50 نانوغرام / مل عامل نمو البشرة (إغف) و 20٪ مصل العجل 7 . استخدام ناهكو 3- مخزنة TCM199 في غضون 3 أسابيع من فتح زجاجة جديدة. إعداد إغف مقدما كما الأسهم 100X، وتجميده في -20 درجة مئوية، واستخدامه في غضون 6 أشهر. الاستغناء 500 ميكرولتر في آبار طبق 4-جيدا واحتضان في الهواء ترطيب مع 5٪ كو 2 في 38.5 درجة مئوية لمدة 2 ساعة على الأقل.
    3. بعد استرجاع كوك من الجريبات ≥5 و ≤25 ملم، ووضعها في طبق بتري (قطرها 3.5 سم) مليئة 2 مل من هيبيس-TCM199. نقل كوك إلى مناطق مختلفة من الطبق من أجل غسل الحطام الخلوي.
    4. نقل كوك إلى الوسط إيفم واحتضان لمدة 28 ساعة في الهواء ترطيب مع 5٪ كو 2 في 38.5 درجة مئوية.

2. المناعي وتحليل الصورة

  1. كروموسوم العد
    1. بعد جمع من بصيلات المهيمنة أو في نهاية إيفم، احتضان كوك مع 100 ميكرومتر موناسترول لمدة 1 ساعة في الهواء مرطب مع 5٪ كو 2 في 38.5 درجة مئوية. إعداد موناسترول مقدما كما 100x الأسهم وتخزينها في -20 درجة مئوية لمدة تصل إلى 1 سنة.
    2. إزالة الخلايا الركامعن طريق معاملتها مع 0.5٪ هيالورونيداز أو بيبتينغ بلطف؛ إزالة زونا بلوسيدا عن طريق معالجته في 0.2٪ بروناز. إعداد هيالورونيداز وبروناز مقدما كما 10X الأسهم وتخزينها في -20 درجة مئوية لمدة تصل إلى 1 سنة.
    3. إصلاح البويضات في بارافورمالدهيد 4٪ في دبس لمدة 15 دقيقة في 38.5 درجة مئوية تليها 45 دقيقة أخرى في 4 درجات مئوية.
      الحذر! ارتداء معدات الوقاية الشخصية عند التعامل مع بارافورمالدهيد، والتخلص من المواد الملوثة وفقا للمبادئ التوجيهية للتخلص من النفايات الخطرة.
    4. غسل البويضات عن طريق نقل بالتتابع في 3 آبار مليئة 500 ميكرولتر من دبس تستكمل مع 0.1٪ كحول بولي فينيل (بفا). بيرمابيليز في 0.3٪ تريتون X-100 لمدة 10 دقيقة في درجة حرارة الغرفة (رت).
    5. كتلة غير محددة بيندينغبلي الحضانة في دبس تستكمل مع 1٪ ألبومين المصل البقري (دبس-1٪ بسا) و 10٪ مصل حمار العادي لمدة 30 دقيقة على الأقل في رت. يمكن أن تبقى العينات في حجب الحل في 4 درجات مئوية لمدة 3-4 أيام.
    6. لالتلطيخ الأولية، واحتضان البويضات في أرنب مكافحة أورورا B فوسفو-Thr232 في دبس تستكمل مع 1٪ بسا (التخفيف 1:50) في 4 درجات مئوية بين عشية وضحاها.
    7. غسل البويضات كما هو موضح في الخطوة 2.1.4. احتضان البويضات في حل من تيترا-ميثيلرهودامين إيسوثيوسيانات (تريتك) -conjugated حمار المضادة للأرنب مفتش (1: 100 في دبس-1٪ بسا) لمدة 1 ساعة في رت في الظلام.
    8. غسل البويضات كما هو موضح في الخطوة 2.1.4، ومن ثم وضع 3-4 البويضات في قطرة من غير تصلب، ومكافحة تتلاشى تصاعد المتوسطة تستكمل مع 20 ميكرومتر YOPRO1 على شريحة زجاجية. كرر الإجراء حتى يتم تركيب جميع البويضات (3-4 البويضات في الشريحة).
    9. السماح للبويضات لتسوية لمدة 10 دقيقة في وسط تصاعد، ومن ثم تغطيتها مع ساترة. لتجنب سحق البويضات، وتطبيق شرائط اثنين من الشريط على الوجهين قبل وضع ساترة على الشريحة الزجاجية.
      ملاحظة: هذا الاحتياط سوف تضمن أيضا أن جميع العينات على حد سواء مضغوط بين الزجاج سليدي و ساترة. يمكن تجميد الشرائح الزجاجية في -20 درجة مئوية وتصوير خلال 2-3 أيام التالية.
    10. صورة العينات على متحد البؤر المجهر المسح بالليزر مع هدف 60X باستخدام الأحمر (سينتروميرس) والأخضر (الكروموسومات) قنوات 7 ، 13 ، 14 ، 20 ، 21 . مسح العينات التي تغطي لوحة ميتافاسيك كله على محور Z، مع خطوات كل 0.35 ميكرون. حفظ الصور الرقمية من كل خطة واحدة.
    11. عد سينتروميرز في المقاطع متحد البؤر التسلسلية باستخدام وظيفة العد الخلية من برنامج نيه إيماجيج (متوفر في: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      ملاحظة: تجنب عدد المتكررة من سينتروميرز التي تظهر على الأقسام المجاورة عن طريق تحديد سينتروميرز التي تظهر، والبقاء، وتختفي في أقسام متتابعة مع رمز رقمي.
    12. كرر شركة الكروموسوماتفي الخطوة 2.1.11 مع مشغل مستقل.
      ملاحظة: تصنيف البويضات كما وبلويد (32 الكروموسومات)، فرط (32)، أو نقص الصيغة الصبغية (<32).
  2. المغزل مورفولوجيا و هيستون أستيلاتيون
    1. بعد جمع من بصيلات المهيمنة أو في نهاية إيفم، وإزالة الخلايا الركام عن طريق العلاج في 0.5٪ هيالورونيداز أو عن طريق بيبتينغ لطيف، كما هو موضح في الخطوة 2.1.2.
    2. غسل البويضات في دبس-بفا، كما هو الحال في الخطوة 2.1.4، وإصلاحها في بارافورمالدهيد 2.5٪ لمدة 20 دقيقة في 38 درجة مئوية. يغسل على نطاق واسع، كما هو موضح في الخطوة 2.1.4، و بيرمابيليز في 0.1٪ تريتون X-100 لمدة 5 دقائق في رت.
      ملاحظة: ارتداء معدات الوقاية الشخصية عند التعامل مع بارافورمالدهيد والتخلص من المواد الملوثة وفقا للمبادئ التوجيهية للتخلص من النفايات الخطرة.
    3. كتلة غير محددة بيندينبي حضانة في دبس تستكمل مع 2٪ ألبومين المصل البقري (دبس - 2٪ بسا)، 0.05٪ سابونين، و 10٪ مصل حمار العادي فوr 2 h في رت.
      ملاحظة: يمكن أن تبقى العينات في حجب الحل في 4 درجات مئوية لمدة 3 - 4 أيام.
    4. لالتلطيخ الابتدائي، واحتضان البويضات في الماوس مكافحة ألفا توبولين (1: 150) والأرنب المضادة acH4K16 (1: 250) في دبس-2٪ بسا مع 0.05٪ سابونين في 4 درجات مئوية بين عشية وضحاها.
    5. غسل البويضات كما هو الحال في الخطوة 2.1.4. احتضان البويضات في حل من الأخضر الفلورسنت صبغ مترافق حمار المضادة للماوس مفتش (1: 500) والحمر مترافق مع حمار المضادة للأرنب مفتش (1: 100) في دبس-2٪ بسا مع 0.05٪ سابونين لمدة 1 ساعة في رت في الظلام.
    6. غسل البويضات كما هو الحال في الخطوة 2.1.4، ومن ثم وضع 3-4 البويضات في قطرة من غير تصلب، ومكافحة تتلاشى تصاعد المتوسطة تستكمل مع 1 ميكروغرام / مل 4 '، 6-دياميدينو-2-فينيليندول (دابي) على شريحة زجاجية.
    7. جبل البويضات على الشرائح الزجاجية كما هو موضح في الخطوة 2.1.8.
    8. صورة العينات على متحد البؤر المجهر المسح بالليزر مع هدف 60X باستخدام الأحمر (acH4K16) والأخضر (ألفا-توبولين)، والأزرق (دنا) القنوات.
      ملاحظة: حافظ على إعدادات الليزر للقنوات الحمراء والزرقاء ثابتة في جميع أنحاء الاستحواذ على جميع العينات. مسح العينات التي تمتد المغزل ميتوتيك كله و لوحة ميتافاسيك على المحور Z، مع خطوات كل 0.35 ميكرون. حفظ الصور الرقمية (خطط واحدة وصورة 3D المتوقعة).
    9. قياس طول القطب إلى القطب المغزل وقطر المغزل في الحد الأقصى للعرض على الصورة المعروضة باستخدام وظيفة قياس برنامج نيه إيماجيج (https://imagej.nih.gov/ij/docs/guide/146-30 هتمل). كرر كل 3 مرات وحساب المتوسط.
    10. تحديد مضان النسبية من acH4K16 باستخدام وظيفة كثافة متكاملة من نيه إيماجيج البرمجيات (https://imagej.nih.gov/ij/docs/guide/146-30.html). تطبيعه لكثافة متكاملة من تلطيخ دابي.

3. تحليل التعبير مرنا

  1. بعد أن تم استرجاع مركبات كوك من الجريبات 5 إلى 25 ملم، وجمع الخلايا الحبيبية قأوسبنسيون التي بقيت في طبق بتري وغسله مرتين في دبس الباردة عن طريق الطرد المركزي في 10600 x ج لمدة 2 دقيقة. تجميد المفاجئة في النيتروجين السائل. تخزين العينات في -80 درجة مئوية لمدة تصل إلى 6 أشهر. فإن الخلايا تخدم لمنحنى القياسية.
  2. إزالة بعناية جميع الخلايا الركام، كما هو موضح في الخطوة 2.1.2، من غير ناضجة (غف)، في المختبر نضجت، وفي الجسم الحي نضجت البويضات.
  3. غسل البويضات، كما هو موضح في 2.1.4، في دبس-بفا، وجمعها منفردة في 1 وحدات التخزين ميكرولتر، ووضع 2 ميكرولتر رنالاتر على القمة. المفاجئة تجميد في النيتروجين السائل. تخزين العينات في -80 درجة مئوية لمدة تصل إلى 6 أشهر.
  4. إضافة 2 خريج من الحمض النووي الريبي لوسيفيراس إلى كل عينة كما ارتفاع في. تجمع البويضات 2 × 2 واستخراج الحمض النووي الريبي مجموع باستخدام مجموعة غشاء السيليكا القائم على فلتر مناسبة لاستعادة الحمض النووي الريبي من عينات صغيرة.
  5. عكس نسخ الحمض النووي الريبي في 10 ميكرولتر مع 0.25 ميكروغرام هيكسامرز عشوائية والفأر مولوني فيروس سرطان الدم النسخ العكسي ترانسكريبتاس لمدة 1 ساعة في 37 و # 176، C. تخزين العينات في -20 درجة مئوية لمدة تصل إلى 6 أشهر.
  6. تمييع [كدنا] من الخلايا الحبيبية في المياه خالية من ريبونوكلياز إلى 50 نانوغرام / ميكرولتر. تمييع متسلسل هذا الحل 1:10 للحصول على 5 نانوغرام / ميكرولتر، 0.5 نانوغرام / ميكرولتر، 0.05 نانوغرام / ميكرولتر، و 0.005 نانوغرام / ميكرولتر الحلول.
  7. تجميع ردود الفعل في ثلاث نسخ في حجم ما مجموعه 20 ميكرولتر لكل رد فعل باستخدام كدنا يعادل 0.05 البويضات كما الركيزة، أو 5 ميكرولتر من التخفيفات المسلسل من كدنا الخلية غرانولوسا، 10 ميكرولتر من سبرميكس الأخضر سيبر، و 0.3 ميكرومتر من كل التمهيدي محددة ( الجدول 1 ).
  8. تشغيل رد فعل في سيكلر الحرارية باستخدام بروتوكول 3 خطوات: 95 درجة مئوية لمدة 30 ثانية، 60 درجة مئوية لمدة 30 ثانية، و 72 درجة مئوية لمدة 20 ثانية، وكرر 40 مرة. وأخيرا، والحصول على منحنى ذوبان، بدءا من 60 درجة مئوية، وزيادة درجة الحرارة بنسبة 0.5 درجة مئوية كل 20 ثانية تصل إلى 95 درجة مئوية.
  9. تقييم كمية البداية (سك) من مرنا محددة في عينات البويضة باستخدام منحنى القياسيةf "> 15 محسوبة على أساس عينة الخلايا الحبيبية.عبر عن البيانات كنسبة بين سك من الجينات في المصالح والمربع من جينات التدبير المنزلي.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تم وصف النتائج الأصلية لهذه التجارب في العمق سابقا 7 ويتم الإبلاغ عنها هنا كمثال على النتائج التي يمكن الحصول عليها باستخدام البروتوكولات وصفها.

معدل النضج

من بين 32 كوك التي استعادها أوبو من المسام المهيمنة، كان 28 (88٪) في مرحلة مي. أربعة عشر من 58 كوك التي تم جمعها من الجريبات 5-25 ملم في الحجم على الفور المفاجئة المجمدة والبويضات غير الناضجة لدراسة التعبير مرنا. كانت البقية 44 في المختبر نضجت، و 37 وصلت إلى مرحلة مي (85٪). لم تكن كفاءة النضج مختلفة بشكل كبير في المجموعتين (اختبار فيشر الدقيق P> 0.05).

معدل أنيوبلوادي

من أجل دراسة ما إذا كان إيفم كاليفورنيان اضطراب تقسيم الكروموسومات المؤمنين بين البويضة الثانوية والجسم القطبي الأول، تم عد عدد الكروموسومات في مرحلة مي، لأنها تمثل نتيجة فصل الكروموسوم خلال الانقسام الاختناقي I. كما هو مبين في الشكل 1A ، ومكافحة أورورا B فسفو-Thr232 الأجسام المضادة الملون على وجه التحديد المنطقة سنترومريك في البويضات الحصان، مما يسمح واحد لحساب عدد الكروموسومات. في البويضات -mured في المختبر كانت أكثر تأثرا بشكل ملحوظ من قبل أنيوبلوادي (5/11) مقارنة في الجسم الحي نضجت البويضات (0/12؛ اختبار فيشر الدقيق، P <0.05؛ الشكل 1B ). وكانت معظم البويضات الصبغية (4/5) هيبيربلويد. وبالتالي، فإن معدل أنيوبلوادي لا ينتج عن التحف في إعداد العينة تحديد الخسارة الكروموسومية، كما يحدث مع فروق الكروموسومات. وقد حاولت أيضا إمونوستينينغ المنطقة سينتروميريك مع مكافحة سينبا والأجسام المضادة لل أوركب، ولكن لم تكن هناك إشارة فيسفي كلتا الحالتين (لا تظهر البيانات).

المغزل مورفولوجيا و أستيلاتيون من H4K16

تم قياس طول المغزل من القطب إلى القطب وقطر المغزل عند أقصى عرض، كما هو موضح في الشكل 2 . وفقا لهذه القياسات، كانت البويضات في المختبر -mureded أطول بكثير (19.89 ± 1.15 ميكرون) وأوسع (17.28 ± 0.81 ميكرون) مقارنة في الجسم الحي النضج البويضات (14.57 ± 1.7 ميكرون في الطول و 13.56 ± 0.91 ميكرون في القطر؛ -test، P <0.05). على نفس العينات، كما تم قياس مستوى الأسيتلات العالمية من H4K16، مؤكدا أن الاستمناء في H4K16 كان أقل بكثير في البويضات إيفم مقارنة مع نظرائهم في الجسم الحي ( الشكل 2 ، والأحمر).

التعبير عن ترانمخطوطات الترميز ل هيستون أستيلترانزفيراسيس و ديستيلاسيس

ما إذا كان قد تم تغيير التعبير عن الجينات المشاركة في عملية هيستيون أسيتيلاتيون ديسيتيلاتيون في البويضات في المختبر -matured بواسطة q- ير. تم تحديد هيستون أسيتيل-ترانسفيراز 1 ( HAT1 )، K-أسيتيلترانزفيراس 8 (KAT8 )، هيستون ديستيلاز 1 ( HDAC1 )، و ناد تعتمد على بروتين ديستيلاز سيرتوين 1 (SIRT1) كأهداف مفترضة. وقد لوحظت اختلافات كبيرة في التعبير عن هذه النصوص في غير ناضجة، في المختبر نضجت، وفي الجسم الحي نضجت البويضات، مستقلة عن التطبيع المستخدمة. على وجه التحديد، تم حساب نتائج تحليل التعبير النص الوارد في الشكل 3 مقابل منحنى قياسي باستخدام طريقة سك وتطبيع ل ديهيدروجيناس غليسيرالدهيد 3-فوسفات التدبير المنزلي (غابد). وبالمثل، لا يوجد فرقرنسس عندما كانت النتائج حيث تطبيع للارتفاع في لوسيفيراس أو عندما تم استخدام طريقة ΔΔct (لا يظهر).

استهداف فو التمهيدي رف التمهيدي حجم أمبليكون
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 بب
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 بب
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 بب
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 بب
وسيفيراز TCATTCTTCGCCAAAAGCACTCTG د> AGCCCATATCCTTGTCGTATCCC 148 بب
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 بب

الجدول 1: تفاصيل التمهيدي. يتم إعطاء تسلسل 5 '> 3' من الأمام (فو) و (رف) الاشعال وحجم أمبليكون المتوقع لكل محضر تحليل: غليسيردهيد 3-فوسفات نازعة (غابد) ، هيستون الأسيتيل-ترانسفيراز 1 ( HAT1 ) ، هيستون ديستيلاز 1 ( HDAC1 ) ، K-أسيتيلترانزفيراس 8 ( KAT8 ) ، لوسيفيراس ، و ناد تعتمد على بروتين ديستيلاز سيرتوين 1 (SIRT1). أعيد طباعته بإذن من المرجع 7 .

/55242fig1.jpg "/>
الشكل 1: أنيوبلوادي معدل في في Vivo- وفي المختبر -mured الحصان البويضات. ( A ) صور الممثل تظهر الشفق B فوسفهو-Thr232 (الأحمر) والحمض النووي (الأخضر) تلطيخ من البويضة الحصان مرحلة مي تعامل مع موناسترول. ويظهر البويضة وبلويد (32 كروموسوم). شريط مقياس = 5 ميكرون. ( B ) يمثل الرسم البياني شريط توزيع البويضات ووب الورم الصبغي مي مرحلة البويضات في الجسم الحي (ن = 12) وفي المختبر (ن = 11) نضجت البويضات. * يشير إلى اختلاف كبير في معدل أنيوبلوادي (فيشر في الاختبار الدقيق، P <0.05). أعيد طباعتها بإذن من المرجع 7. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2 الشكل 2: قياس المغزل و H4K16 أسيتيلاتيون في فيفو و في المختبر -mured الحصان البويضات. صور ممثل تبين أنبولين (الأخضر)، H4K16 أسيتيلد (الأحمر)، والحمض النووي (الأزرق) في البويضات مي بعد في الجسم الحي (ن = 4) أو في المختبر (ن = 14) النضج. تظهر صور توبولين المحاور المستخدمة في طول المغزل وقياسات القطر. شريط مقياس = 5 ميكرون. معدلة من المرجع 7 . الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 3
الشكل 3: التعبير عن KAT8 ، SIRT1 ، HAT1 ، و HDAC1 في إماتوإعادة، في فيفو ، و في المختبر نضجت البويضات. تمثل الرسوم البيانية شريط متوسط ​​± سيم من التعبير مرنا النسبي من KAT8 ، SIRT1 ، HAT1 ، و HDAC1 ، ويعبر عنه بكمية البدء (سك) من نص الفائدة مقارنة مع سك من غابد، وتستخدم كتدبير منزلي. لم يلاحظ وجود فروق ذات دلالة إحصائية بين الناضجة (غف، ن = 14)، في الجسم الحي (ن = 14)، وفي المختبر (ن = 12) النضج البويضات (اتجاه واحد أنوفا، P > 0.05). أعيد طباعته بإذن من المرجع 7 . الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

على الرغم من أن إيفم قد أجريت في الخيول لأكثر من 20 عاما 16 ، ونحن لا نعرف حتى الآن ما إذا كان البويضة يمكن أن يكون أصل أنيوبلوادي الغدة الجنينية، كما اقترح للبشر 17 . والسبب هو على الأرجح أن إعداد ينتشر البويضة لنتائج العد الكروموسوم في فقدان عينة كبيرة. مع هذا في الاعتبار، تم إجراء مسح للأساليب المستخدمة في التحقيق في الأخطاء في الفصل الكروموسوم للبحث عن أنسب التقنيات لتطبيقها على البويضات الحصان. تم العثور على أربعة تقنيات رئيسية في المؤلفات العلمية: 1) ينتشر الكروموسومات 5 ، 18 ، 19 ، 2) الفلورسنت في الموقع التهجين (فيش) 4 ، 6 ، 17 ، 20 ، 3) العد سينترومير على المغزل المنهروسات المنهارة ، 14 ، 21 ، 22 ، أند 4) كروموسوم تلطيخ مضان دون كروموسوم العد 23 ، 24 ، 25 .

كما سبق ذكره، وإعداد فروق الكروموسومات تليها تلطيخ جيمزا معقدة بسبب ارتفاع معدل فقدان العينة. وقد تم استبدال هذه الطريقة في كثير من الحالات من قبل فيش، والذي يستخدم تحقيقات محددة لتعيين الكروموسومات المختلفة. عيب تقنيات فيش هو أنه عندما يتم استخدام عدد صغير من تحقيقات، قد يحدث حدوث سلبي كاذبة ( أي، تحديد الخلية العادية التي هي الصيغة الصبغية لأنه لم يتم التحقيق في الكروموسوم المفقود أو الزائدة). ولذلك يعتمد الاستخدام الموثوق به لصيد الأسماك إلى حد كبير على المعرفة المسبقة للكروموسومات التي تتأثر بشكل أكثر تواترا بالخلل الصيغة الصبغية (على سبيل المثال.، كروموسوم 21 في البشر). وقد استخدمت فيش سابقا للتحقيق في شذوذ الكروموسومات في أجنة الحصان باستخدام 2 تحقيقات، ضد كروموسوم 2 والكروموسوم 4 20 . وفقا لهذه التجارب، نوى في المختبر تنتج الأجنة هي أكثر عرضة للتأثر الشذوذ الكروموسومات من في الجسم الحي المنتجة الأجنة. هذه النتيجة تتفق مع الملاحظة المذكورة أعلاه باستخدام طريقة موناسترول انهيار في البويضات إيفم. ومع ذلك، فإن حدوث اختلال الصيغة الصبغية في البويضات إيفم كان أعلى حتى من أن ذكرت باستخدام فيش في المختبر -الأجنة المنتجة 20 . ويمكن تفسير هذا التفاوت الجزئي من حقيقة أنه تم استخدام اثنين فقط من تحقيقات كروموسوم محددة لتجارب فيش. هذا النهج قد يكون قد التقليل من شأن حدوث عدم توازن الصيغة الصبغية التي تنطوي على كروموسومات أخرى، وخصوصا عندما تنظر إلى أن الخيول لديها 32 الكروموسومات. ومع ذلك، فإنه لا يمكن استبعاد أن أنيو شديدلا يتم الحفاظ على بلويدات كشفها في البويضات في الأجنة لأن غاميتس تتأثر تشوهات وراثية حرجة قد لا تتطور أكثر من ذلك.

مزيج من العلاج موناسترول، كروموسوم وتلطيخ سينترومير، والمجهر متحد البؤر يسمح لتهم متسقة من عدد كروموسوم في البويضات الحصان مرحلة مي مع الحد الأدنى من فقدان العينة. وكان التقييد التقني الذي واجه في تطوير هذه التقنية لبويضات الحصان توافر الأجسام المضادة الحصان محددة. قبل استخدام أورورا B phospho- (Thr232)، اثنين من الأجسام المضادة الأخرى (مكافحة أورورا B ومكافحة سينبا) لم تنتج وصمة عار سينتروميريك. والجدير بالذكر أن مكافحة أورورا B ومكافحة سينبا استخدمت بالفعل بنجاح في البقري والخلايا البشرية 26 ، 27 ، 28 ؛ وبالتالي، استنتج أنها ليست محددة للحصان. ويمكن أيضا أن تقتصر هذه التقنية عن طريق توفر ليزر سك متحد البؤرأنينغ المجهر وتحليل الصور البرمجيات. أيضا، العد العمياء من قبل اثنين من المشغلين المستقلين ضروري لاستبعاد التحف التي يسببها المشغل. على الرغم من أن عدد الكروموسومات من المغزل الموناسترول انهار هو النهج الذي يحافظ بشكل أفضل على التشكل من الخلية ويمنع فقدان العينة، وهذا الأسلوب يسمح فقط لمراقبة الاختلافات في العدد الأساسي من الكروموسومات. فإنه ليس من المفيد على شذوذ الكروموسومات الأخرى (على سبيل المثال، ترانزلوكاتيونس، التقاطعات القطاعية، الخ ) التي يمكن بدلا من ذلك كشفت عن طريق التنميط النووي، وفي بعض الحالات، من قبل فيش.

وقد تم أيضا التحقيق في أخطاء الفصل الكروموسوم من المغزل والكروموسوم المناعي، دون أداء عدد الكروموسومات 23 ، 24 ، 25 . في هذه الحالة، المغزل مع الشذوذ الشديد والكروموسومات متخلفة أو متناثرة تعتبر علامات على كروموسو غير منتظمةلي الفصل. وفقا لذلك، لوحظت الكروموسومات التي انتشرت خارج المغزل في البويضات الناضجة في المختبر 7 (الطبقة التي من المرجح أن تتأثر أنيوبلوادي). ولكن العد الكروموسومات لديه ميزة نقل معلومات قابلة للقياس الكمي.

لتلخيص، بالمقارنة مع التقنيات الأخرى الموصوفة، واستخدام موناسترول وتلطيخ سينترومير لديه ميزة منع فقدان العينة، والتقليل من حدوث السلبيات كاذبة، ويجري الكمي.

وقد اقترح تغيير التعديلات جينية كآلية محتملة في بداية أنيوبلويدي البويضة 18 ، 24 ، 25 . باستخدام وصمة عار الفلورسنت الثلاثي، كان من الممكن لتصور وقياس المغزل الانتصافي ومراقبة الكروموسومات متخلفة / متناثرة. وفي الوقت نفسه، وذلك بفضل تطوير الأجسام المضادة التيوالتعرف على تعديلات بقايا محددة، وقد أجريت على مستوى استواء H4K16 بها على نفس العينة.هذا النهج خدم الغرض المزدوج من تقليل كمية البويضات اللازمة للتحليل والربط H4 الاستخلاص مع التشكل من المغزل.

يمكن إجراء القياس الكمي من التعديلات التساهمية البروتين من قبل لطخة غربية. ومع ذلك، تتطلب هذه التقنية حجم عينات أكبر ولا يحافظ على سلامة العينة للدراسات المورفولوجية. نهج تلطيخ الثلاثي الفلورسنت يمكن تطبيقها على تعديلات هيستون أخرى، وربما، إلى أي بروتين التي يمكن التعرف عليها من قبل الأجسام المضادة الثانوية المختلفة 8 ؛ والعامل المحدد الوحيد هو توافر الأجسام المضادة الحصان محددة. وفي هذا السياق، يأمل المؤلفون أن رفع الانتباه إلى نموذج الحصان سيزيد من الاهتمام في التحقيق في الآليات البيولوجية الأساسية في هذا النوع، وبالتالي، في ديفيلوبممن أدوات مخصصة.

وأخيرا، وصفت دراسة التعبير عن ترميز مرناس هيستون ديستيلاسيس (هداكس) وأسيتيل-ترانسفراسيس (هاتس) التي أجريت عن طريق النسخ العكسي والكمي ير (q-ير) أيضا. q-ير هو تقنية واسعة الانتشار. ومع ذلك، واستخدامه لبويضات الحصان ليست منتشرة. فمن الضروري أن نحدد أنه نظرا لإسكات العام للنشاط النسخي خلال النضج البويضة 29 ، وتحليل مجموع المبلغ نص يمكن أن تكشف فقط استقرار مرنا أو تدهور في هذه الخلفية 30 ، 31 . لم تلاحظ الاختلافات في التعبير النسبي للنصوص بين في المختبر وفي الجسم الحي النضج. وتشير هذه النتائج إلى أن الأنظمة متعدية وما بعد متعدية قد تتأثر ب إيفم، مشيرا إلى الحاجة إلى تطوير نهج تجريبية أخرى تهدف إلى التحقيق متعدية وبوآليات ست متعدية على مستوى خلية واحدة.

وعموما، فإن هذه الدراسة تصف نهجا تجريبيا لمورفولوجيا و بيوكيميكالي تميز البويضات الحصان. ويمكن تطبيق هذا النهج على البويضات من الأنواع الأخرى التي تتأثر بالمثل من معدل الانتعاش المنخفض، بما في ذلك البشر أو الأنواع المهددة بالانقراض. وهذه الدراسات توسيع معرفتنا من البيولوجيا التناسلية الثدييات وسوف تسهم في فهمنا للعقم.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

ويود المؤلفون أن يشكروا فابريس فنسنت على الدعم الذي قدمه مع المسح الضوئي المجهري البؤري بالليزر (لم) ، وفليب بارير وتييري بلارد لأداء المسح المبيض بالموجات فوق الصوتية يوميا وحقن قوات حرس السواحل الهايتية. وأيد هذا العمل جزئيا مشروع "ريجيون سارديغنا أند ريجيون لومبارديا" "إكس أوفو أومنيا" (المنحة رقم 26096200 إلى مكافحة غسل الأموال). (العقد 2012 إلى فف)، FP7-بيوبل-2011- سيغ، الوكالة التنفيذية للبحوث (ريا) "برو-أوفوم" (المنحة رقم 303640 إلى فل)، و FP7-بيوبل-2011- سيغ. ومدرسة ما بعد الدكتوراه في الزراعة والطب البيطري، بتمويل مشترك من الصندوق الاجتماعي الأوروبي، البرنامج التشغيلي القطاعي لتنمية الموارد البشرية للفترة 2007-2013 (العقد رقم بوسدرو / 89 / 1.5 / S / 62371 إلى إدارة المعلومات). تم تمويل جمع البويضات في الجسم الحي من قبل معهد فرانسيس دو تشيفال إت دي l'إكيتاتيون.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
تحليل فصل الكروموسوم، هيستون أستيلاتيون، و مورفولوجيا المغزل في البويضات الحصان
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter