Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Analyse van Chromosoom Segregatie, Histon Acetylatie, En Spindel Morfologie In Paard Oocyten

doi: 10.3791/55242 Published: May 11, 2017

Summary

Dit manuscript beschrijft een experimentele aanpak om paardocyten morfologisch en biochemisch te karakteriseren. Specifiek illustreert het onderhavige werk hoe u onrijpe en volwassen paardocyten verzamelt door middel van ultrageluidgeleide ovumopname (OPU) en hoe u chromosoom-segregatie, spindemorfologie, globale histonacetylering en mRNA-expressie kunt onderzoeken.

Abstract

Het gebied van geassisteerde voortplanting is ontwikkeld om onvruchtbaarheid bij vrouwen, gezelschapsdieren en bedreigde soorten te behandelen. In het paard zorgt geassisteerde voortplanting ook voor de productie van embryo's van hoge performers zonder hun sportcarrière te onderbreken en draagt ​​bij aan een toename van het aantal veulen van merries van hoge genetische waarde. Het huidige manuscript beschrijft de procedures die worden gebruikt voor het verzamelen van onvolwassen en rijpe oocyten uit paard eierstokken met behulp van ovum pick-up (OPU). Deze oocyten werden vervolgens gebruikt om de incidentie van aneuploïdie te onderzoeken door een protocol dat eerder is ontwikkeld in muizen aan te passen. Specifiek werden de chromosomen en de centromeren van metafase II (MII) oocyten fluorescent gelabeld en geteld op sequentiële brandpuntsplannen na confocale lasermicroscoopscanning. Deze analyse onthulde een hogere incidentie in de aneuploïditempo wanneer onvolwassen oocyten uit de follikels werden verzameld en in vitro gerijpte vergeleken metIn vivo. Immunostaining voor tubuline en de geacyleerde vorm van histon vier bij specifieke lysine residuen bleek ook verschillen in de morfologie van de meiotische spindel en in het globale patroon van histon acetylering. Tenslotte werd de expressie van mRNA's die coderen voor histon-deacetylasen (HDAC's) en acetyltransferases (HAT's) onderzocht door reverse transcriptie en kwantitatieve-PCR (q-PCR). Geen verschillen in de relatieve expressie van transcripten werden waargenomen tussen in vitro en in vivo rijpe oocyten. In overeenstemming met een algemene stilzetting van de transcriptieactiviteit tijdens oocytmaturatie, kan de analyse van het totale transcriptiemengsel alleen mRNA stabiliteit of afbraak onthullen. Daarom wijzen deze bevindingen erop dat andere vertaal- en post-translationele regelingen zouden kunnen worden beïnvloed.

In het algemeen beschrijft de onderhavige studie een experimentele aanpak om de paardococyt morfologisch en biochemisch te karakteriseren, een ceHet type dat uitermate uitdagend is om te studeren, is vanwege de lage beschikbaarheid van het monster. Het kan echter onze kennis uitbreiden over de voortplantingsbiologie en onvruchtbaarheid bij monovulatoire soorten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Een groot aantal geassisteerde voortplantingstechnieken is ontwikkeld om onvruchtbaarheid bij vrouwen, gezelschapsdieren en bedreigde diersoorten te behandelen. Een van de meest voorkomende procedures in klinische instellingen is het ophalen van metafase II (MII) -stage-oocyten uit de ovariumfollikels door middel van ultrageluidgeleide transvaginale aspiratie, Ovumopname (OPU) 1 . Deze oocyten worden vervolgens in vitro (IVF) bevrucht, waarbij de resulterende embryo's in een ontvanger van de ontvanger geïmplanteerd worden. De MII-fase (rijpe) oocyten worden opgehaald na de toediening van exogene gonadotropinen. Deze behandeling is echter bij sommige patiënten geassocieerd met de ontwikkeling van ovarium hyperstimulatie syndroom (OHSS) 2 .

Profiteer van het intrinsieke vermogen van volgroeide, onvolwassen oocyten (GV-stadium) om meiosis spontaan te hervatten zodra ze zijn geïsoleerd uit hun follikels, het is mogelijk om volwassen oocyten te verkrijgen zonder adminisGonadotropine 3 . Deze procedure heet oocyt in vitro rijping (IVM) en vertegenwoordigt een minder geneesmiddelgeoriënteerde, goedkopere en meer patiëntvriendelijke aanpak van geassisteerde voortplantingstechnologie. Echter, het succes van embryo-ontwikkeling met in vitro- veroude oocyten is in het algemeen lager dan bij in vivo gerijpte oocyten 4 , 5 . Een mogelijke verklaring is dat in vitro rijpende oocyten meer getroffen worden door fouten bij chromosomsegregatie, en de resulterende aneuploïdie vermindert de normale embryonale ontwikkeling 6 .

Het begrijpen van de moleculaire basis van chromosomale mis-segregatie tijdens IVM zou uiteindelijk het volledige potentieel van deze techniek onthullen. In deze ader gebruikte de experimentele aanpak de morfologische en biochemische kenmerken van in vitro- veroude oocyten, in vergelijking met in vivo maturEd oocyten wordt hier beschreven 7 , 8 . Specifiek worden de procedures voor de OPU van onvolwassen en rijpe oocyten en de IVM van onrijpe oocyten geïllustreerd met behulp van volwassen en natuurlijk fietsende paarden als een experimenteel model. Daarna worden immunofluorescentie en beeldanalyse gebruikt om chromosomsegmentatie, spindelmorfologie en het globale patroon van histonacetylering op deze gameten te onderzoeken. Tenslotte wordt een protocol van omgekeerde transcriptie en kwantitatieve PCR beschreven voor de analyse van mRNA expressie.

In vergelijking met knaagdierdiermodellen, laten paarden geen genetische manipulatie toe, zijn ze minder makkelijk te manipuleren en duur onderhoud nodig. Dit model krijgt echter grote belangstelling voor de studie van oocytematuratie 9 , 10 door de gelijkenis met menselijke eierstokkenfysiologie 11 , 12 </ Sup>. Bovendien heeft de ontwikkeling van betrouwbare protocollen van IVM-IVF in het paard een aanzienlijk economisch belang, aangezien het het aantal veulen van merries van hoge genetische waarde zou kunnen verhogen.

Een van de beperkingen van het uitvoeren van experimenten op oocyten, vooral bij monovulatoire soorten, is de beperkte beschikbaarheid van het monster. Deze limiet is hier overwonnen door een aanpak, die eerder in muizen is ontwikkeld, aan te passen aan paardocyten 13 , 14 om chromosoomtelling te verrichten die het monsterverlies minimaliseert (zie de bespreking voor een vergelijking met andere beschikbare technieken). Bovendien is een triple-fluorescentie kleuring protocol geoptimaliseerd om meerdere analyses op hetzelfde monster te voeren en q-PCR analyses werden alleen uitgevoerd op pools van 2 oocyten.

Over het geheel genomen beschrijft de onderhavige studie een experimentele aanpak gericht op morfologisch en biochemisch chaRacterize het paard oocyt, een celtype dat uitermate uitdagend is om te studeren door de lage beschikbaarheid van het monster. Het kan echter onze kennis van de voortplantingsbiologie en onvruchtbaarheid van monovulatoire soorten uitbreiden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle procedures werden goedgekeurd door het Comité Animal Care and Use CEEA Val de Loire nummer 19 en werden uitgevoerd volgens de richtlijnen voor de zorg en het gebruik van laboratoriumdieren.

1. Oocyt Verzameling en In Vitro Maturatie

  1. Ovum pick-up
    1. Dagelijks beoordelen door middel van echografie de diameter van ovariale follikels in een cohort van volwassen merries. Bij de opkomst van een follikel ≥33 mm (dominante follikel) injecteer de merrie met 1.500 IE van menselijke chorionische gonadotrophine (hCG) in het bovenste gedeelte van de jugulaire ader (iv).
      1. Voordat u de injectie uitvoert, zwaait het gebied met alcohol, plaats de vaatje en plaats de duim 2-3 cm onder de injectieplaats om de ader te laten stijgen. Steek de naald bijna evenwijdig aan de nek in en haal hem op om ervoor te zorgen dat de naald in de ader zit (het bloed komt in de spuit). Op dit moment injecteer; HCG zal de m inducerenAturatie van de oocyt in de dominante follikel.
    2. 35 uur na de hCG-injectie sederen de merrie met detomidine (15 μg / kg, iv), butorfanoltartraat (10 μg / kg, iv) en butylscopolamine-broom (0,2-0,3 mg / kg, 15 ml / mer, iv).
    3. Sluit de naald aan op de ultrageluid sonde. Plaats de ultrageluid sonde vaginally en houd de ovier transrectaal in de richting van de ultrageluid sonde. Geef een operator aan om de naald te manoeuvreren en de andere om de eierstok op zijn plaats te houden, met de follikel naar de ultrasone sonde . Begin van de eierstok met de dominante follikel.
    4. Punt de vaginale wand en de muur van de dominante follikel met de naald (ultrasone probes voor OPU zijn uitgerust met een kanaal voor de naald die is verbonden met een zuigsysteem); Theneedle zal zichtbaar zijn in het echografische beeld.
    5. Aspiratie van de folliculaire vloeistof in een 50 ml conische buis verbonden met het zuigsysteem. Giet de inhoud van de conischeBuis in een grote petrischaal en zoek naar het cumulus-oocytcomplex (COC) met behulp van een stereomicroscoop.
    6. Aangezien de COC niet altijd met het folliculaire vloeistof wordt teruggehaald, spoel de follikel met Dulbecco's gemodificeerde fosfaatgebufferde zoutoplossing (DPBS) die 5 IE / ml heparineat 37 ° C bevat. Onderzoek DPBS voor COC aanwezigheid, zoals eerder beschreven voor de folliculaire vloeistof in stap 1.1.5. Spoel meerdere keren tot de COC wordt opgehaald.
    7. Zodra de COC van de dominante follikel is opgehaald, steek de follikels ≥5 en ≤25 mm op, zoals beschreven voor de dominante follikel in stappen 1.1.3-1.1.4; Follikels ≥5 en ≤25 drukken geen luteïniserend hormoon / choriogonadotropinereceptor (LHCGR) uit, en daarom zullen hun oocyten niet opgroeien als gevolg van hCG en zullen ze op GV-stadium (onvolwassen) verzameld worden. Bewaar alleen COC's met verscheidene complete lagen cumuluscellen en bruin, fijngranulair openlasm. Weggooi de anderen.
    8. Aan het einde van de OPU, inBreng de merrie met benzyl-penicilline 15.000 IE / dier om infectie te voorkomen.
    9. Houd de merrie voor minstens 2 uur in een stille, schone stal. Controleer tekenen van bewustzijn door de positie van de oren, reactie op stimuli (bijvoorbeeld geluid) te bepalen en gait voordat u de merrie naar het bedrijf van andere dieren terugstuurt.
  2. In vitro rijping
    1. Warme HEPES-gebufferde TCM199 (20 mM Hepes) aangevuld met 1,790 IE / L heparine, 0,4% runder serumalbumine (BSA), penicilline en streptomycine tot 37 ° C. Bereid dit medium vooraf voor. Filter-steriliseren en houd het bij 4 ° C gedurende maximaal 6 maanden.
    2. Bereid het IVM-medium op door NaHCO3-gebufferde TCM199 (25 mM NaHCO3) aan te vullen met 50 ng / ml epidermale groeifactor (EGF) en 20% kalfserum 7 . Gebruik NaHCO 3- buffer TCM199 binnen 3 weken na het openen van een nieuwe fles. Bereid het EGF voorop als 100x voorraden, vries het bij -20 ° C, En gebruik het binnen 6 maanden. Spoel 500 μL in de putjes van een 4-putschotel en incubeer gedurende 2 uur in bevochtigde lucht met 5% CO2 bij 38,5 ° C.
    3. Na het ophalen van de COC's van de ≥5 en ≤25 mm follikels, zet ze in een petri schotel (3,5 cm diameter) gevuld met 2 ml HEPES-TCM199. Verplaats de COC's naar verschillende delen van het gerecht om de cellulaire rommel weg te spoelen.
    4. Breng de COC's over naar het IVM-medium en incubeer gedurende 28 uur in bevochtigde lucht met 5% CO 2 bij 38,5 ° C.

2. Immunofluorescentie en beeldanalyse

  1. Chromosoom telling
    1. Na het verzamelen van de dominante follikel of aan het einde van IVM, incuberen de COC's met 100 μM monastrol gedurende 1 uur in bevochtigde lucht met 5% CO2 bij 38,5 ° C. Bereid monastrol vooraf als 100x voorraden en houd deze bij -20 ° C gedurende maximaal 1 jaar.
    2. Verwijder de cumuluscellenDoor ze te behandelen met 0,5% hyaluronidase of door zacht pipettering; Verwijder de zona pellucida door het te behandelen in 0,2% pronase. Bereid hyaluronidase voor en pronage als 10x voorraden en houd ze bij -20 ° C gedurende maximaal 1 jaar.
    3. Fix de oocyten in 4% paraformaldehyde in DPBS gedurende 15 minuten bij 38,5 ° C, gevolgd door nog 45 minuten bij 4 ° C.
      VOORZICHTIGHEID! Draag persoonlijke beschermingsmiddelen bij het hanteren van paraformaldehyde, en verwijder verontreinigde materialen volgens de richtlijnen voor de verwijdering van gevaarlijke afvalstoffen.
    4. Was de oocyten door opeenvolgend over te brengen in 3 putjes gevuld met 500 μL DPBS aangevuld met 0,1% polyvinylalcohol (PVA). Permeabiliseer in 0,3% Triton X-100 gedurende 10 minuten bij kamertemperatuur (RT).
    5. Blok niet-specifieke binding door incubatie in DPBS aangevuld met 1% runder serumalbumine (DPBS-1% BSA) en 10% normaal ezelserum gedurende tenminste 30 min bij RT. Monsters kunnen gedurende 3 tot 4 dagen in blokkerende oplossing bij 4 ° C worden gehouden.
    6. Voor primaire kleuring incuberen de oocyten in konijn anti-Aurora B fosfo-Thr232 in DPBS aangevuld met 1% BSA (verdunning 1:50) bij 4 ° C overnacht.
    7. Was de oocyten zoals beschreven in stap 2.1.4. Incubeer de oocyten in een oplossing van tetra-methylrhodamine isothiocyanaat (TRITC) geconjugeerde ezel anti-konijn IgG (1: 100 in DPBS-1% BSA) gedurende 1 uur bij RT in het donker.
    8. Was de oocyten zoals beschreven in stap 2.1.4, en plaats dan 3-4 oocyten in een druppel niet-verhardend, anti-fade montage medium aangevuld met 20 μM YOPRO1 op een glazen glijbaan. Herhaal de procedure totdat alle oocyten zijn gemonteerd (3-4 oocyten per dia).
    9. Laat de oocyten ongeveer 10 minuten in het montagemedium vestigen en bedek ze vervolgens met een deklaag. Om de oocyten te verpletteren, moet u twee stroken dubbelzijdige tape aanbrengen voordat u de deklaag op de glazen glijbaan legt.
      OPMERKING: Deze voorzorgsmaatregel zal er ook voor zorgen dat alle monsters gelijk worden samengeperst tussen de glazen sliDe en de deklaag. De glazen glijbanen kunnen bij -20 ° C worden bevroren en worden gedurende de volgende 2-3 dagen afgebeeld.
    10. Afbeelding van de monsters op een confocal laser scanningsmicroscoop met een 60X objectief met behulp van de kanalen 7 , 13 , 14 , 20 , 21 van de rode (centromere) en groene (chromosomen) kanalen. Scan de monsters die de hele metafasische plaat uitstrekken op de z-as, met stappen elke 0.35 μm. Sla de gedigitaliseerde afbeeldingen van elk enkel plan op.
    11. Tel de centromeren in seriële confocale secties met behulp van de celtellingfunctie van de NIH ImageJ-software (verkrijgbaar op: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      OPMERKING: Vermijd een herhaalde telling van centromeren die verschijnen op aangrenzende secties door de centromeren te identificeren die verschijnen, blijven en verdwijnen in opeenvolgende secties met een numerieke code.
    12. Herhaal de chromosomale coLoslaten in stap 2.1.11 met een onafhankelijke operator.
      OPMERKING: Klasseer de oocyten als euploïde (32 chromosomen), hyperploïde (> 32) of hypoploïde (<32).
  2. Spindel morfologie en histon acetylering
    1. Na het verzamelen van de dominante follikel of aan het einde van de IVM, verwijder de cumuluscellen door behandeling in 0,5% hyaluronidase of door zacht pipettering, zoals beschreven in stap 2.1.2.
    2. Was de oocyten in DPBS-PVA, zoals in stap 2.1.4, en fixeer ze in 2,5% paraformaldehyde gedurende 20 minuten bij 38 ° C. Wassen grondig, zoals beschreven in stap 2.1.4, en gedurende 5 min bij 0,1 ° C in 0,1% Triton X-100 permeabiliseren.
      OPMERKING: Draag persoonlijke beschermingsmiddelen bij het hanteren van paraformaldehyde en verwijder verontreinigde materialen volgens de richtlijnen voor het verwijderen van gevaarlijke afvalstoffen.
    3. Blok niet-specifieke binding door incubatie in DPBS aangevuld met 2% boviene serumalbumine (DPBS - 2% BSA), 0,05% saponine en 10% normaal ezel serum fo2 uur bij RT.
      OPMERKING: Monsters kunnen gedurende 3 - 4 dagen in blokkerende oplossing bij 4 ° C worden gehouden.
    4. Voor primaire kleuring incuberen de oocyten in muis anti-alfa-tubuline (1: 150) en konijn anti-acH4K16 (1: 250) in DPBS-2% BSA met 0,05% saponine bij 4 ° C overnacht.
    5. Was de oocyten zoals in stap 2.1.4. Incubeer de oocyten in een oplossing van groene fluorescerende kleurstof-geconjugeerde ezel anti-muis IgG (1: 500) en TRITC-geconjugeerde ezel anti-konijnen IgG (1: 100) in DPBS-2% BSA met 0,05% saponine gedurende 1 uur bij RT in het donker.
    6. Was de oocyten zoals in stap 2.1.4, en plaats dan 3-4 oocyten in een druppel van het niet-verhardende, anti-fade montage medium aangevuld met 1 μg / mL 4 ', 6-diamidino-2-fenylindool (DAPI) Op een glazen glijbaan.
    7. Monteer de oocyten op glazen glijbanen zoals beschreven in stap 2.1.8.
    8. Beeld de monsters op een confocal laser scanningsmicroscoop met een 60x objectief met behulp van de rode (acH4K16), groene (alfa-tubuline) en blauwe (DNA) kanalen.
      OPMERKING: Houd de laserinstellingen voor de rode en blauwe zenders constant tijdens de aanschaf van alle monsters. Scan de monsters die de hele meiotische spindel en metafasische plaat uitstrekken op de z-as, met stappen van elke 0.35 μm. Bewaar de gedigitaliseerde afbeeldingen (enkele plannen en geprojecteerde 3D-afbeelding).
    9. Meet de poolpoolpoollengte en de spildiameter op de maximale breedte van het geprojecteerde beeld met behulp van de meetfunctie van de NIH ImageJ-software (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Herhaal elke 3 keer en bereken het gemiddelde.
    10. Kwantificeer de relatieve fluorescentie van acH4K16 met behulp van de geïntegreerde dichtheidsfunctie van de NIH ImageJ-software (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normaliseer het voor de geïntegreerde dichtheid van de DAPI-kleuring.

3. Analyse van mRNA-expressie

  1. Nadat de COC's zijn opgehaald van de 5 tot 25 mm follikels, verzamelt u de granulosa celUspension die bleef in de Petri schotel en was het tweemaal in koude DPBS door centrifugeren bij 10.600 xg gedurende 2 minuten. Vries in vloeibare stikstof. Bewaar de monsters bij -80 ° C gedurende maximaal 6 maanden; De cellen zullen dienen voor de standaardkromme.
  2. Verwijder alle cumuluscellen zorgvuldig, zoals beschreven in stap 2.1.2, van onvolwassen (GV), in vitro gerijpte en in vivo gerijpte oocyten.
  3. Was de oocyten, zoals beschreven in 2.1.4, in DPBS-PVA, verzamel ze alleen in 1 μl volumes en leg 2 μL RNALater bovenop. Snap-freeze in vloeibare stikstof. Bewaar de monsters bij -80 ° C gedurende maximaal 6 maanden.
  4. Voeg 2 pg Luciferase RNA toe aan elk monster als een spike-in. Pool de oocyten 2 x 2 en trek het totale RNA uit met behulp van een siliciummembraanfilter-gebaseerde kit die geschikt is om RNA uit kleine monsters te herstellen.
  5. Reverse-transcribe het RNA in 10 μL met 0,25 μg willekeurige hexameren en muizen Moloney leukemie virus reverse transcriptase gedurende 1 uur bij 37 & # 176; C. Bewaar de monsters bij -20 ° C gedurende maximaal 6 maanden.
  6. Verdun het cDNA uit de granulosa cellen in RNAse-vrij water tot 50 ng / μl. Verdun deze oplossing 1:10 tijdelijk om 5 ng / μl, 0,5 ng / μl, 0,05 ng / μl en 0,005 ng / μL oplossingen te verkrijgen.
  7. Reacties in triplicaat samenstellen in een totaal volume van 20 μl per reactie, waarbij cDNA equivalent is aan 0,05 oocyten als het substraat, of 5 μL van de seriële verdunningen van granulosa cel cDNA, 10 μL SYBR groene supermix en 0,3 μM van elke specifieke primer Tabel 1 ).
  8. Doe de reactie in een thermische cyclus met een 3-stappen protocol: 95 ° C gedurende 30 s, 60 ° C gedurende 30 s en 72 ° C gedurende 20 s, herhaald 40 keer. Uiteindelijk, verwerven de smeltcurve vanaf 60 ° C en verhoog de temperatuur met 0,5 ° C elke 20 s tot 95 ° C.
  9. Bepaal de starthoeveelheid (SQ) van het specifieke mRNA in de oocytmonsters met behulp van de standaardkrommeF "> 15 berekend op basis van het granulosa celmonster. Express de data als de verhouding tussen de SQ van het gen van belang en de SQ van de huishoudende genen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De oorspronkelijke bevindingen van deze experimenten werden eerder beschreven in de diepte en worden hierin beschreven als een voorbeeld van resultaten die kunnen worden verkregen met behulp van de beschreven protocollen.

Rijpingspercentage

Van de 32 COC's die door OPU werden verkregen van dominante follikels, waren 28 (88%) in de MII-fase. Veertien van de 58 COC's, verzameld uit follikels van 5-25 mm in grootte, werden onmiddellijk gesneden als onvolwassen oocyten voor het mRNA-expressieonderzoek. De resterende 44 werden in vitro gerijpt en 37 bereikte het MII stadium (85%). De efficiëntie van rijping was niet significant verschillend in de twee groepen (Fisher's exacte test P> 0,05).

Aneuploidy tarief

Om te bestuderen of IVM ca.N de trouwe chromosomale verdeling tussen de secundaire oocyt en het eerste polaire lichaam verstoren, werd het aantal chromosomen in het MII-stadium geteld, aangezien het het resultaat is van chromosoom-segregatie tijdens meiose I. Zoals getoond in Figuur 1A is de anti-Aurora B Fosfo-Thr232 antilichaam specifiek de centromere regio in paard-oocyten bevlekt, waardoor men het aantal chromosomen kan tellen. In vitro- veroude oocyten werden significant beïnvloed door aneuploïdie (5/11) in vergelijking met in vivo rijpe oocyten (0/12; Fisher's exacte test, P <0,05; Figuur 1B ). De meeste aneuploïde oocyten (4/5) waren hyperploïde; Daarom komt de aneuploïditempo niet voort uit artefacten bij de bereiding van het monsterbepalende chromosomale verlies, zoals bij chromosomale spreads gebeurt. Immunostaining van het centromerische gebied werd ook geprobeerd met de anti-CENPA en anti-AURKB antilichamen, maar geen signaal was visIn beide gevallen geëaliseerd (gegevens niet getoond).

Spindel morfologie en acetylering van H4K16

De poolpoolpoollengte en de diameter van de spil bij de maximale breedte werden gemeten, zoals geïllustreerd in figuur 2 . Volgens deze metingen waren inocumenten in vitro gemeten significant langer (19,89 ± 1,15 μm) en ruimer (17,28 ± 0,81 μm) in vergelijking met in vivo rijpe oocyten (14,57 ± 1,7 μm in lengte en 13,56 ± 0,91 μm in diameter; ongepaarde t -test, P <0,05). Op dezelfde monsters werd ook het globale acetyleringsniveau van H4K16 gemeten, waaruit blijkt dat acetylering bij H4K16 significant lager was in IVM-oocyten in vergelijking met hun in vivo tegenhangers ( Figuur 2 , rood).

Expressie van tranScripts die coderen voor histon acetyltransferases en deacetylasen

Of de expressie van genen die betrokken zijn bij het acetonisatie-deacetyleringsproces van histonen in in vitro- verouderde oocyten is veranderd, werd onderzocht door q-PCR. Histonacetyltransferase 1 ( HAT1 ), K-acetyltransferase 8 (KAT8 ), histone-deacetylase 1 ( HDAC1 ) en NAD-afhankelijke eiwitdeacetylase sirtuin 1 ( SIRT1 ) werden geïdentificeerd als vermeende doelstellingen. Significante verschillen in de expressie van deze transcripten in onvolwassen, in vitro gerijpte en in vivo gerijpte oocyten werden niet waargenomen, onafhankelijk van de gebruikte normalisatie. Specifiek werden de resultaten van de transcriptie-expressieanalyse gemeld in Figuur 3 berekend tegen een standaardkromme met behulp van de SQ-methode en genormaliseerd voor huishoudelijke glyceraldehyde-3-fosfaatdehydrogenase ( GAPDH ). Zo ook niet andersRenzen werden waargenomen wanneer de resultaten waar genormaliseerd voor de piek in luciferase of wanneer de ΔΔct methode werd gebruikt (niet getoond).

Doel Fw primer Rv primer Amplicon grootte
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
hat1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
luciferase TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tabel 1: Primer Setails. De 5 '> 3' sequentie van de voorwaartse (Fw) en (Rv) primers en de verwachte amplicongrootte worden gegeven voor elk transcript geanalyseerd: glyceraldehyde-3-fosfaat dehydrogenase ( GAPDH ) , histone acetyltransferase 1 ( HAT1 ) , histon Deacetylase 1 ( HDAC1 ) , K-acetyltransferase 8 ( KAT8 ) , luciferase en NAD-afhankelijke eiwitdeacetylase sirtuin 1 ( SIRT1 ). Reprinted met toestemming van referentie 7 .

/55242fig1.jpg "/>
Figuur 1: Aneuploidy Rate In In Vivo- en In Vitro- Gemaakte Paard Oocyten. ( A ) Representatieve beelden die aurora B fosfo-Thr232 (rood) en DNA (groen) tonen van een MII-stadium paardococyt behandeld met monastrol tonen. Er wordt een euploïde oocyt (32 chromosomen) getoond. Schaalbalk = 5 μm. ( B ) De staafgrafiek vertegenwoordigt de verdeling van euploïde en aneuploïde MII-stadium oocyten in in vivo (n = 12) en in vitro (n = 11) rijpte oocyten. * Duidt op een significant verschil in de aneuploïditempo (Fisher's exacte test, P <0,05). Reprinted met toestemming van Referentie 7. Klik hier om een ​​grotere versie van deze figuur te zien.

Figuur 2 Figuur 2: Spindelmeting en H4K16-acetylering in Vivo- en In Vitro- gemodificeerde paardenocyten. Representatieve beelden die tubuline (groen), geacyleerde H4K16 (rood) en DNA (blauw) in MII-oocyten tonen na in vivo (n = 4) of in vitro (n = 14) rijping. De tubulijnafbeeldingen tonen de assen die worden gebruikt voor de lengte van de spindel en de diameter. Schaalbalk = 5 μm. Gewijzigd vanuit referentie 7 . Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3: Uitdrukking van KAT8 , SIRT1 , HAT1 , En HDAC1 in ImmatuRe, in vivo En In Vitro Matured Oocytes. De staafdiagrammen vertegenwoordigen de gemiddelde ± SEM van de relatieve mRNA expressie van KAT8 , SIRT1 , HAT1 , En HDAC1 , Uitgedrukt als de starthoeveelheid (SQ) van het transcript van belang in vergelijking met het SQ van GAPDH , gebruikt als huishoudelijk gebruik. Er werden geen statistische verschillen waargenomen tussen onvolwassenen (GV, n = 14), in vivo (n = 14) en in vitro (n = 12) volwassen oocyten (eenrichtings ANOVA, P > 0,05). Reprinted met toestemming van referentie 7 . Klik hier om een ​​grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hoewel IVM al meer dan 20 jaar 16 is uitgevoerd in paarden, weten we nog niet of de oocyt de oorsprong kan zijn van embryonale aneuploïdie, zoals voor mensen is voorgesteld 17 . De reden is waarschijnlijk dat de bereiding van oocytspreidingen voor chromosoomtelling resulteert in aanzienlijk monsterverlies. Met dit in het achterhoofd werd een onderzoek uitgevoerd naar de methoden die gebruikt werden om fouten bij chromosoom-segregatie te onderzoeken om te zoeken naar de meest geschikte techniek om op eicellen van paarden toe te passen. In de wetenschappelijke literatuur werden vier hoofdtechnieken gevonden: 1) Chromosomale spreidingen 5 , 18 , 19 , 2) Fluorescent in situ hybridisatie (FISH) 4 , 6 , 17 , 20 , 3) Centromere telling op monastrol-ineengekomen spindels , 14 , 21 , 22 en 4) chromosoom fluorescentie kleuring zonder chromosoom telling 23 , 24 , 25 .

Zoals reeds vermeld, wordt de bereiding van chromosomale spreads gevolgd door Giemsa-kleuring gecompliceerd door een hoge mate van monsterverlies. Deze methode is in veel gevallen vervangen door FISH, die specifieke probes gebruikt om verschillende chromosomen te plannen. Een nadeel van FISH technieken is dat wanneer een klein aantal probes wordt gebruikt, de incidentie van een vals negatief kan toenemen ( dwz het identificeren van een cel die aneuploïde is, omdat het ontbrekende of supernumeraire chromosoom niet is onderzocht). Het betrouwbare gebruik van FISH is derhalve grotendeels gebaseerd op de kennis vooraf van de chromosomen die vaker door aneuploïdie worden beïnvloed ( bijv.., Chromosoom 21 bij mensen). FISH is eerder gebruikt om chromosomale abnormaliteiten in paardembryo's te onderzoeken met 2 probes, tegen chromosoom 2 en chromosoom 4 20 . Volgens deze experimenten zullen de kernen van in vitro geproduceerde embryo's waarschijnlijker worden beïnvloed door chromosomale abnormaliteiten dan in vivo geproduceerde embryo's. Deze bevinding is in overeenstemming met de hierboven gemelde waarneming met gebruikmaking van de monastrol-collapse methode in IVM oocyten. De incidentie van aneuploïdie in IVM-oocyten was evenwel hoger dan die gerapporteerd met behulp van FISH in in vitro geproduceerde embryo's 20 . Deze gedeeltelijke discrepantie kan worden verklaard door het feit dat slechts twee chromosoomspecifieke probes voor de FISH-experimenten werden gebruikt. Deze aanpak zou de incidentie van aneuploïdie met andere chromosomen kunnen onderschatten, vooral als men ervan uitgaat dat paarden 32 chromosomen hebben. Het kan echter niet worden uitgesloten dat ernstige aneuPloidies detecteerbaar in de oocyten worden niet in de embryo's gehandhaafd, omdat gametes die zijn getroffen door kritische genetische abnormaliteiten mogelijk niet verder ontwikkelen.

De combinatie van monastrolbehandeling, chromosoom- en centromere-kleuring, en confocale microscopie lieten voor consistente tellingen van het chromosoomgetal in MII-stadium paardocyten met minimaal monsterverlies toe. De technische beperking die zich voordoen bij het ontwikkelen van deze techniek voor paarseocyten was de beschikbaarheid van paardspecifieke antilichamen. Voordat Aurora B fosfo- (Thr232) werd gebruikt, produceerden twee andere antilichamen (anti-Aurora B en anti-CENPA) geen centromere vlek. In het bijzonder werden anti-Aurora B en anti-CENPA al succesvol gebruikt in runderen en menselijke cellen 26 , 27 , 28 ; Daarom werd geconcludeerd dat ze niet specifiek voor het paard waren. Deze techniek kan ook worden beperkt door de beschikbaarheid van een confocale laser scAnningmicroscoop en beeldanalysesoftware. Ook blinde tellen door twee onafhankelijke operatoren is essentieel om operator-geïnduceerde artefacten uit te sluiten. Hoewel de chromosomale telling van een monastrol-ineenstortende spindel een aanpak is die de morfologie van de cel beter bewaar en het monsterverlies voorkomt, maakt deze techniek alleen de waarneming van verschillen in het basis aantal chromosomen mogelijk; Het is niet informatief over andere chromosomale afwijkingen ( bijv. Translocaties, segmentale uitwisselingen, enz. ) Die in plaats daarvan door karyotypen en in sommige gevallen door FISH kunnen worden onthuld.

Fouten bij chromosoom-segregatie zijn ook onderzocht door spindel- en chromosoomimmunofluorescentie, zonder een chromosomale telling 23 , 24 , 25 te verrichten. In dit geval worden spindels met ernstige anomalieën en achterliggende of verstrooide chromosomen beschouwd als tekenen van wisselvallige chromosoIk segregatie Bijgevolg werden chromosomen die verstrooid werden uit de spindel waargenomen in in vitro rijpe oocyten 7 (de klasse die waarschijnlijker is geraakt door aneuploïdie). Chromosomale tellen hebben echter het voordeel om kwantificeerbare informatie te vervoeren.

Samenvattend, in vergelijking met de andere beschreven technieken, heeft het gebruik van monastrol- en centromere-kleuring het voordeel om monsterverlies te voorkomen, de incidentie van valse negatieven te minimaliseren en kwantificeerbaar te zijn.

De wijziging van de epigenetische modificaties is voorgesteld als een mogelijk mechanisme bij het ontstaan ​​van oocyt aneuploïdie 18 , 24 , 25 . Met behulp van een driedubbele fluorescerende vlek, was het mogelijk om de meiotische spindel te visualiseren en te meten en om de achterliggende / verstrooide chromosomen te waarnemen. Tegelijkertijd, dankzij de ontwikkeling van antilichamen dieHerken specifieke residu modificaties, het acetyleringsniveau van H4K16 werd uitgevoerd op hetzelfde monster. Deze aanpak diende het dubbele doel om de hoeveelheid oocyten die nodig zijn voor de analyse te verminderen en de H4-acetylering te correleren met de morfologie van de spindel.

De kwantificering van covalente eiwitmodificaties kan worden uitgevoerd door Western blot. Deze techniek vereist echter een grotere monstergrootte en behoudt de integriteit van het monster niet voor morfologische studies. De triple-fluorescerende kleuring benadering kan toegepast worden op andere histon-modificaties en mogelijk aan elk eiwit dat herkend kan worden door verschillende secundaire antilichamen 8 ; De enige beperkende factor is de beschikbaarheid van paardspecifieke antilichamen. In deze context hopen de auteurs dat de aandacht op het paardenmodel de belangstelling voor het onderzoek van basis biologische mechanismen in deze soort zal vergroten, en daarom in de ontwikkelingenEnt van toegewijde gereedschappen.

Tenslotte wordt ook de expressie studie van mRNA's die coderen voor histon-deacetylasen (HDAC's) en acetyltransferases (HAT's) uitgevoerd door omgekeerde transcriptie en kwantitatieve-PCR (q-PCR) beschreven. Q-PCR is een breed verspreide techniek; Het gebruik ervan voor paardocyten is echter niet diffuus. Het is essentieel om te specificeren dat door de algemene stilzetting van transcriptieve activiteit tijdens oocytematuratie 29 de analyse van het totale transcriptiemengsel alleen mRNA stabiliteit of afbraak in deze achtergrond 30 , 31 kan onthullen. Verschillen in de relatieve expressie van transcripties tussen in vitro en in vivo rijping werden niet waargenomen. Deze bevindingen wijzen erop dat translationele en post-translationele regelingen door IVM beïnvloed kunnen worden, en wijzen op de noodzaak van de ontwikkeling van andere experimentele benaderingen die gericht zijn op het onderzoeken van translatie en poSt-translatie mechanismen op het single-cel niveau.

In het algemeen beschrijft de onderhavige studie een experimentele aanpak om paardocyten morfologisch en biochemisch te karakteriseren. Deze aanpak kan worden toegepast op oocyten van andere soorten die op soortgelijke wijze beïnvloed worden door een laag herstelpercentage, waaronder mensen of bedreigde soorten. Deze studies zullen onze kennis van zoogdieren voortplantingsbiologie uitbreiden en zullen bijdragen aan ons begrip van onvruchtbaarheid.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs willen Fabrice Vincent bedanken voor de ondersteuning met laserscanning confocal microscopy (LSCM) , en Philippe Barrière en Thierry Blard voor het uitvoeren van dagelijkse ultrasone ovarium scan en hCG injectie. Dit werk werd gedeeltelijk ondersteund door het project "Ex-Ovo Omnia", "Regione Sardegna en Regione Lombardia" (subsidie ​​nr. 26096200 naar AML); De "L'Oreal Italia per le Donne e la Scienza 2012" gemeenschap (Contract 2012 tot FF), FP7-PEOPLE-2011- CIG, Research Executive Agency (REA) "Pro-Ovum" (Toekenning nr. 303640 tot VL); En door de Postdoctorale School van Landbouw en Veterinaire Geneeskunde, mede gefinancierd door het Europees Sociaal Fonds, Sectorieel Operationeel Programma voor Personeelsontwikkeling 2007-2013 (Contractnummer POSDRU / 89 / 1.5 / S / 62371 tot IM). De in vivo oocyt collectie werd gefinancierd door de Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analyse van Chromosoom Segregatie, Histon Acetylatie, En Spindel Morfologie In Paard Oocyten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter