Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Analyse der Chromosomensegregation, Histonacetylierung und Spindelmorphologie in Pferdeozyten

doi: 10.3791/55242 Published: May 11, 2017

Summary

Dieses Manuskript beschreibt einen experimentellen Ansatz zur morphologischen und biochemischen Charakterisierung von Pferdostozyten. Speziell veranschaulicht die vorliegende Arbeit, wie man unreife und reife Pferdoozyten durch Ultraschall-geführte Ovum-Pick-up (OPU) sammelt und wie man Chromosomensegregation, Spindelmorphologie, globale Histonacetylierung und mRNA-Expression untersucht.

Abstract

Das Feld der assistierten Reproduktion wurde entwickelt, um Unfruchtbarkeit bei Frauen, Begleittieren und gefährdeten Arten zu behandeln. Im Pferd erlaubt die assistierte Reproduktion auch die Produktion von Embryonen von Hochleistungskünstlern, ohne ihre sportliche Karriere zu unterbrechen und trägt zu einer Zunahme der Anzahl von Fohlen aus Stuten mit hohem genetischen Wert bei. Das vorliegende Manuskript beschreibt die Verfahren, die zum Sammeln von unreifen und reifen Oozyten aus Pferd Eierstöcken mit Ovum Pick-up (OPU) verwendet werden. Diese Oozyten wurden dann verwendet, um die Inzidenz von Aneuploidie durch die Anpassung eines Protokolls, das zuvor in Mäusen entwickelt wurde, zu untersuchen. Speziell wurden die Chromosomen und die Zentromere der Metaphase-II (MII) -Oozyten fluoreszenzmarkiert und auf sequentielle Fokuspläne nach konfokaler Lasermikroskop-Scanning gezählt. Diese Analyse zeigte eine höhere Inzidenz in der Aneuploidie-Rate, wenn unreife Oozyten aus den Follikeln gesammelt und in vitro im Vergleich zu reifenIn vivo Immunfärbung für Tubulin und die acetylierte Form von Histon vier an spezifischen Lysinresten zeigten auch Unterschiede in der Morphologie der meiotischen Spindel und im globalen Muster der Histonacetylierung. Schließlich wurde die Expression von mRNAs, die für Histon-Deacetylasen (HDACs) und Acetyl-Transferasen (HATs) kodieren, durch reverse Transkription und quantitative-PCR (q-PCR) untersucht. Es wurden keine Unterschiede in der relativen Expression von Transkripten zwischen in vitro und in vivo reifen Oozyten beobachtet. In Übereinstimmung mit einem allgemeinen Stummschalten der Transkriptionsaktivität während der Oozytenreifung kann die Analyse der Gesamttranskriptmenge nur die mRNA-Stabilität oder den Abbau zeigen. Daher deuten diese Befunde darauf hin, dass andere translatorische und posttranslationale Regelungen betroffen sein könnten.

Insgesamt beschreibt die vorliegende Studie einen experimentellen Ansatz zur morphologischen und biochemischen Charakterisierung der PferdeozytenLl Typ, das ist extrem schwierig zu studieren aufgrund der geringen Probenverfügbarkeit. Allerdings kann es unser Wissen über die Fortpflanzungsbiologie und Unfruchtbarkeit in monovulatorischen Spezies erweitern.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Eine breite Palette von assistierten Reproduktionstechniken wurde entwickelt, um Unfruchtbarkeit bei Frauen, Begleittieren und gefährdeten Arten zu behandeln. Eine der häufigsten Verfahren in der klinischen Umgebung ist die Abfrage von Metaphase II (MII) -Stufen-Oozyten aus den Ovarialfollikeln durch Ultraschall-geführte transvaginale Aspiration, Eizelle (OPU) 1 . Diese Oozyten werden dann in vitro (IVF) befruchtet, wobei der resultierende Embryo (s) in einen Empfänger-Uterus implantiert wird. Die MII-Stadium (reifen) Oozyten werden nach der Verabreichung von exogenen Gonadotropinen gewonnen. Allerdings ist diese Behandlung bei einigen Patienten mit der Entwicklung des Ovarialhyperstimulationssyndroms (OHSS) 2 assoziiert.

Wenn man die intrinsische Fähigkeit von ausgewachsenen, unreifen Oozyten (GV-Stadium) ausnutzt, um die Meiose nach der Isolierung aus ihren Follikeln spontan wieder aufzunehmen, ist es möglich, reife Oozyten ohne Adminis zu erhaltenGonadotropin 3 . Dieses Verfahren wird als Oozyten- In-vitro- Reifung (IVM) bezeichnet und stellt einen weniger drogenorientierten, weniger teuren und patientenfreundlichen Ansatz für die assistierte Reproduktionstechnologie dar. Allerdings ist der Erfolg der Embryo-Entwicklung mit in vitro- reifen Oozyten im Allgemeinen niedriger als bei in vivo gereiften Oozyten 4 , 5 . Eine mögliche Erklärung ist, dass in vitro gereifte Oozyten stärker von Fehlern in der Chromosomensegregation betroffen sind und die resultierende Aneuploidie die normale embryonale Entwicklung beeinträchtigt 6 .

Das Verständnis der molekularen Basis der chromosomalen Fehlsegregation während IVM würde letztlich das volle Potential dieser Technik offenlegen. In diesem Sinne wurde der experimentelle Ansatz verwendet, um die morphologischen und biochemischen Merkmale von in vitro- reifen Oozyten im Vergleich zu in vivo matur zu untersuchenEd Oozyten ist hier beschrieben 7 , 8 . Insbesondere werden die Verfahren für die OPU von unreifen und reifen Oozyten und die IVM von unreifen Oozyten unter Verwendung von erwachsenen und natürlich-radierenden Pferden als experimentelles Modell veranschaulicht. Dann werden Immunfluoreszenz und Bildanalyse verwendet, um die Chromosomensegregation, die Spindelmorphologie und das globale Muster der Histonacetylierung auf diesen Gameten zu untersuchen. Schließlich wird für die Analyse der mRNA-Expression ein Protokoll der Reverse-Transkription und der quantitativen PCR beschrieben.

Im Vergleich zu Nagetier-Tiermodellen erlauben Pferde keine genetische Manipulation, sind weniger leicht zu manipulieren und erfordern teure Wartung. Allerdings gewinnt dieses Modell ein beträchtliches Interesse für die Untersuchung der Oozytenreifung 9 , 10 aufgrund der Ähnlichkeit mit der menschlichen Eierstockphysiologie 11 , 12 </ Sup>. Darüber hinaus hat die Entwicklung von zuverlässigen Protokollen von IVM-IVF im Pferd ein erhebliches wirtschaftliches Interesse, da es eine Erhöhung der Anzahl der Fohlen von Stuten mit hohem genetischen Wert ermöglichen würde.

Eine der Einschränkungen der Durchführung von Experimenten an Oozyten, insbesondere bei monovulatorischen Spezies, ist die eingeschränkte Probenverfügbarkeit. Diese Grenze wurde hier durch die Anpassung eines bisher in Mäusen entwickelten Ansatzes an die Pferdeozyten 13 , 14 überwunden, um eine Chromosomenzählung durchzuführen, die den Probenverlust minimiert (siehe die Diskussion um einen Vergleich mit anderen verfügbaren Techniken). Darüber hinaus wurde ein Triple-Fluoreszenz-Färbeprotokoll optimiert, um mehrere Analysen auf der gleichen Probe durchzuführen, und q-PCR-Analysen wurden nur an Pools von 2 Oozyten durchgeführt.

Insgesamt beschreibt die vorliegende Studie einen experimentellen Ansatz, der auf morphologisch und biochemisch beschränkt istRacterize die Pferd-Oozyte, ein Zell-Typ, der extrem schwierig zu studieren ist aufgrund der geringen Probenverfügbarkeit. Allerdings kann es unser Wissen über die Fortpflanzungsbiologie und die Unfruchtbarkeit von monovulatorischen Spezies erweitern.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle Verfahren wurden vom Tierpflege- und Verwendungsausschuss CEEA Val de Loire Nr. 19 genehmigt und wurden gemäß den Leitlinien für die Pflege und Verwendung von Labortieren durchgeführt.

1. Oozytensammlung und in vitro Reifung

  1. Ovum Pick-up
    1. Tägliche Beurteilung durch Ultraschall der Durchmesser der Ovarialfollikel in einer Kohorte von erwachsenen Stuten. Bei der Entstehung eines Follikels ≥33 mm (dominanter Follikel) injizieren Sie die Stute mit 1.500 IE menschlichem Choriongonadotrophin (hCG) im oberen Teil der Vena jugularis (iv).
      1. Bevor Sie die Injektion durchführen, den Bereich mit Alkohol abtupfen, die Jugularfurche lokalisieren und den Daumen 2-3 cm unter die Injektionsstelle stellen, um die Vene zu veranlassen, zu steigen. Setzen Sie die Nadel fast parallel zum Hals und aspirieren, um sicherzustellen, dass die Nadel in der Vene ist (das Blut wird in die Spritze eindringen). An diesem Punkt spritzen; HCG wird das m induzierenAturation der Oozyte im dominanten Follikel.
    2. 35 h nach der hCG-Injektion die Stute mit Detomidin (15 μg / kg, iv), Butorphanoltartrat (10 μg / kg, iv) und Butylscopolaminbromat (0,2-0,3 mg / kg, 15 mL / Stute, iv) sedieren.
    3. Verbinden Sie die Nadel mit der Ultraschallsonde. Setzen Sie die Ultraschallsonde vaginal ein und halten Sie das Eierstock transsektal gegenüber der Ultraschallsonde. Weisen Sie einen Bediener an, die Nadel zu manövrieren, und der andere, um das Eierstock an Ort und Stelle zu halten, wobei die Follikel der Ultraschallsonde zugewandt ist . Beginnen Sie vom Eierstock mit dem dominanten Follikel.
    4. Punktion der Scheidenwand und der Wand des dominanten Follikels mit der Nadel (Ultraschallsonden für OPU sind mit einem Kanal für die Nadel ausgestattet, die an ein Absaugsystem angeschlossen ist); Theneedle wird im echographischen Bild sichtbar.
    5. Die Follikelflüssigkeit in einem 50-mL-Kegelrohr, das mit dem Absaugsystem verbunden ist, Gießen Sie den Inhalt der KonischenIn eine große Petrischale geben und mit einem Stereomikroskop nach dem Cumulus-Oozyten-Komplex (COC) suchen.
    6. Da der COC nicht immer mit der Follikelflüssigkeit abgerufen wird, spülen Sie den Follikel mit Dulbecco's modifizierter phosphatgepufferter Kochsalzlösung (DPBS) mit 5 IE / ml Heparinat 37 ° C ab. Untersuche DPBS für COC-Präsenz, wie zuvor für die Follikelflüssigkeit in Schritt 1.1.5 beschrieben. Spülen Sie mehrere Male, bis der COC abgerufen wird.
    7. Sobald der COC aus dem dominanten Follikel gewonnen wird, punktiert und bündig die Follikel ≥5 und ≤25 mm, wie für den dominanten Follikel in den Schritten 1.1.3-1.1.4 beschrieben; Follikel ≥5 und ≤25 nicht ausdrücken luteinisierendes Hormon / Choriogonadotropin Rezeptor (LHCGR), und daher werden ihre Oozyten nicht reifen in Reaktion auf hCG und wird in GV-Stadium (unreif) gesammelt werden. Nur COCs mit mehreren kompletten Schichten von Cumulus-Zellen und braunem, fein granuliertem Ooplasma halten. Verwerfe die anderen.
    8. Am Ende der OPU, inDie Stute mit Benzyl-Penicillin 15.000 IU / Tier zu verhindern, um eine Infektion zu verhindern.
    9. Haus die Stute in einem ruhigen, sauberen Stall für mindestens 2 h. Überprüfen Sie die Anzeichen des Bewusstseins, indem Sie die Position der Ohren, die Reaktion auf Reize ( zB Lärm) und den Gang vor der Rückkehr der Stute in die Gesellschaft anderer Tiere bestimmen.
  2. In-vitro- Reifung
    1. Warme HEPES-gepufferte TCM199 (20 mM Hepes), ergänzt mit 1.790 IE / L Heparin, 0,4% Rinderserumalbumin (BSA), Penicillin und Streptomycin auf 37 ° C. Bereiten Sie dieses Medium vorab vor. Filter-sterilisieren und bei 4 ° C bis zu 6 Monate aufbewahren.
    2. Bereiten Sie das IVM-Medium vor, indem Sie NaHCO 3- gepuffertes TCM199 (25 mM NaHCO 3 ) mit 50 ng / ml epidermalem Wachstumsfaktor (EGF) und 20% Kälberserum 7 ergänzen. Verwenden Sie NaHCO 3- gepufferte TCM199 innerhalb von 3 Wochen nach dem Öffnen einer neuen Flasche. Den EGF im Voraus als 100x Lager vorbereiten, bei -20 ° C einfrieren, Und benutze es innerhalb von 6 Monaten. 500 μl in die Vertiefungen einer 4-Well-Schale geben und in befeuchteter Luft mit 5% CO 2 bei 38,5 ° C für mindestens 2 h inkubieren.
    3. Nach dem Abrufen der COCs aus den ≥5 und ≤25 mm Follikeln legen Sie sie in eine Petrischale (3,5 cm Durchmesser), gefüllt mit 2 ml HEPES-TCM199. Bewegen Sie die COCs in verschiedene Bereiche der Schale, um die Zelltrümmer zu waschen.
    4. Übertragen Sie die COCs auf das IVM-Medium und inkubieren für 28 h in befeuchteter Luft mit 5% CO 2 bei 38,5 ° C.

2. Immunfluoreszenz und Bildanalyse

  1. Chromosomen zählen
    1. Nach der Entnahme aus dem dominanten Follikel oder am Ende des IVM inkubieren die COCs mit 100 μM Monastrol 1 h in befeuchteter Luft mit 5% CO 2 bei 38,5 ° C. Bereiten Sie Monastrol im Voraus als 100x Lager vor und lagern Sie es bei -20 ° C für bis zu 1 Jahr.
    2. Entfernen Sie die CumuluszellenIndem man sie mit 0,5% Hyaluronidase behandelt oder durch sanftes Pipettieren; Entfernen Sie die Zona Pellucida, indem Sie sie in 0,2% Pronase behandeln. Hyaluronidase und Pronase im Voraus als 10x Lager vorbereiten und bei -20 ° C für bis zu 1 Jahr aufbewahren.
    3. Fixieren Sie die Oozyten in 4% Paraformaldehyd in DPBS für 15 min bei 38,5 ° C, gefolgt von weiteren 45 min bei 4 ° C.
      VORSICHT! Bei der Handhabung von Paraformaldehyd persönliche Schutzausrüstung tragen und kontaminierte Stoffe gemäß den Entsorgungsrichtlinien entsorgen.
    4. Waschen der Oozyten durch sequentielles Übertragen in 3 Vertiefungen, gefüllt mit 500 & mgr; l DPBS, ergänzt mit 0,1% Polyvinylalkohol (PVA). Permeabilisieren in 0,3% Triton X-100 für 10 min bei Raumtemperatur (RT).
    5. Blockierung der unspezifischen Bindung durch Inkubation in DPBS, ergänzt mit 1% Rinderserumalbumin (DPBS-1% BSA) und 10% normalem Eselserum für mindestens 30 min bei RT. Proben können in einer Sperrlösung bei 4 ° C für 3-4 Tage gehalten werden.
    6. Zur Primärfärbung inkubieren die Oozyten in Kaninchen-Anti-Aurora-B-Phospho-Thr232 in DPBS, ergänzt mit 1% BSA (Verdünnung 1:50) bei 4 ° C über Nacht.
    7. Waschen Sie die Oozyten wie in Schritt 2.1.4 beschrieben. Inkubieren Sie die Oozyten in einer Lösung von Tetra-Methylrhodaminisothiocyanat (TRITC) -konjugiertem Esel-Anti-Kaninchen-IgG (1: 100 in DPBS-1% BSA) für 1 h bei RT im Dunkeln.
    8. Waschen Sie die Oozyten wie in Schritt 2.1.4 beschrieben, und legen Sie dann 3-4 Oozyten in einen Tropfen nicht härtenden, Anti-Fade-Montagemedium, ergänzt mit 20 μM YOPRO1 auf einer Glasrutsche. Wiederholen Sie den Vorgang, bis alle Oozyten montiert sind (3-4 Oozyten pro Folie).
    9. Lassen Sie die Oozyten ca. 10 min im Montagemedium absetzen und decken sie dann mit einem Deckglas ab. Um das Zerkleinern der Oozyten zu vermeiden, wenden Sie zwei Streifen doppelseitigen Klebebandes an, bevor Sie das Deckglas auf den Glasschieber legen.
      HINWEIS: Diese Vorsichtsmaßnahme wird auch dafür sorgen, dass alle Proben gleichmäßig zwischen dem Glas sli zusammengedrückt werdenDe und das Deckglas. Glasscheiben können bei -20 ° C eingefroren und während der folgenden 2-3 Tage abgebildet werden.
    10. Bild die Proben auf einem konfokalen Laser-Scanning-Mikroskop mit einem 60X-Objektiv mit den roten (centromeres) und grünen (Chromosomen) Kanälen 7 , 13 , 14 , 20 , 21 . Scannen Sie die Proben, die die gesamte metaphasische Platte auf der z-Achse überspannen, mit Stufen alle 0,35 μm. Speichern Sie die digitalisierten Bilder von jedem einzelnen Plan.
    11. Zählen Sie die Zentromer in seriellen konfokalen Abschnitten mit der Zellenzählfunktion der NIH ImageJ Software (erhältlich unter: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      HINWEIS: Vermeiden Sie eine wiederholte Anzahl von Zentromern, die auf benachbarten Abschnitten erscheinen, indem Sie die Zentromeres identifizieren, die erscheinen, bleiben und verschwinden in sequentiellen Abschnitten mit einem numerischen Code.
    12. Wiederholen Sie die chromosomale coUntätig in Schritt 2.1.11 mit einem unabhängigen Betreiber.
      HINWEIS: Die Oozyten als Euploide (32 Chromosomen), Hyperploid (> 32) oder Hypoploid (<32) klassifizieren.
  2. Spindelmorphologie und Histonacetylierung
    1. Nach der Entnahme aus dem dominanten Follikel oder am Ende des IVM entfernen Sie die Cumuluszellen durch Behandlung in 0,5% Hyaluronidase oder durch sanftes Pipettieren, wie in Schritt 2.1.2 beschrieben.
    2. Die Oozyten in DPBS-PVA wie in Schritt 2.1.4 waschen und in 2,5% Paraformaldehyd für 20 min bei 38 ° C fixieren. Ausgedehntes Waschen, wie in Schritt 2.1.4 beschrieben, und permeabilisieren in 0,1% Triton X-100 für 5 min bei RT.
      HINWEIS: Bei der Handhabung von Paraformaldehyd persönliche Schutzausrüstung tragen und kontaminierte Stoffe gemäß den Entsorgungsrichtlinien entsorgen.
    3. Blockierung der unspezifischen Bindung durch Inkubation in DPBS, ergänzt mit 2% Rinderserumalbumin (DPBS - 2% BSA), 0,05% Saponin und 10% normalem Eselserum foR 2 h bei RT
      HINWEIS: Die Proben können bei 4 ° C für 3 - 4 Tage in Blockierungslösung gehalten werden.
    4. Zur Primärfärbung inkubieren die Oozyten in Maus-anti-alpha-Tubulin (1: 150) und Kaninchen anti-acH4K16 (1: 250) in DPBS-2% BSA mit 0,05% Saponin bei 4 ° C über Nacht.
    5. Die Oozyten wie in Schritt 2.1.4 waschen. Inkubieren Sie die Oozyten in einer Lösung von grünem fluoreszierendem Farbstoff-konjugiertem Esel-anti-Maus-IgG (1: 500) und TRITC-konjugiertem Esel-Anti-Kaninchen-IgG (1: 100) in DPBS-2% BSA mit 0,05% Saponin für 1 h RT im Dunkeln.
    6. Waschen Sie die Oozyten wie in Schritt 2.1.4 und legen Sie dann 3-4 Oozyten in einen Tropfen des nicht härtenden, Anti-Fade-Montagemediums, ergänzt mit 1 μg / ml 4 ', 6-Diamidino-2-phenylindol (DAPI) Auf einer Glasrutsche
    7. Montieren Sie die Oozyten auf Glasplättchen wie in Schritt 2.1.8 beschrieben.
    8. Bild die Proben auf einem konfokalen Laser-Scanning-Mikroskop mit einem 60-fachen Objektiv unter Verwendung der roten (acH4K16), grünen (alpha-tubulin) und blauen (DNA) Kanäle.
      HINWEIS: Halten Sie die Lasereinstellungen für die roten und blauen Kanäle während der Erfassung aller Proben konstant. Scannen Sie die Proben, die die gesamte meiotische Spindel und die metaphasische Platte auf der z-Achse überspannen, mit Stufen alle 0,35 μm. Speichern Sie die digitalisierten Bilder (einzelne Pläne und projiziertes 3D-Bild).
    9. Messen Sie die Pol-zu-Pol-Spindellänge und den Spindeldurchmesser bei der maximalen Breite des projizierten Bildes mit der Messfunktion der NIH ImageJ-Software (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Wiederholen Sie alle 3 mal und berechnen Sie den Mittelwert.
    10. Quantifizieren Sie die relative Fluoreszenz von acH4K16 mit der integrierten Dichtefunktion der NIH ImageJ Software (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normalisieren Sie es für die integrierte Dichte der DAPI-Färbung.

3. Analyse der mRNA-Expression

  1. Nachdem die COCs aus den 5 bis 25 mm Follikeln gewonnen wurden, sammle die Granulosazelle sUspension, die in der Petrischale blieb und zweimal in kaltem DPBS durch zweifache Zentrifugation bei 10.600 xg für 2 min waschen. Einfrieren in flüssigem Stickstoff einfrieren Die Proben bei -80 ° C für bis zu 6 Monate aufbewahren; Die Zellen dienen der Standardkurve.
  2. Entfernen Sie vorsichtig alle Cumuluszellen, wie in Schritt 2.1.2 beschrieben, aus unreifen (GV), in vitro gereiften und in vivo gereiften Oozyten.
  3. Waschen der Oozyten, wie in 2.1.4 beschrieben, in DPBS-PVA, sammeln sie einzeln in 1 μl Volumen und legen 2 μl RNALater auf die Oberseite. Snap-Freeze in flüssigem Stickstoff. Die Proben bei -80 ° C für bis zu 6 Monate aufbewahren.
  4. Füge 2 pg Luciferase- RNA zu jeder Probe als Spike-In hinzu . Pool die Oozyten 2 x 2 und extrahiere die Gesamt-RNA unter Verwendung eines Siliciumdioxid-Membran-Filter-basierten Kits, der geeignet ist, RNA aus kleinen Proben zu gewinnen.
  5. Reverse-transkribieren die RNA in 10 & mgr; l mit 0,25 & mgr; g zufälligen Hexameren und Maus Moloney Leukämie Virus Reverse Transkriptase für 1 Stunde bei 37 & 176; Die Proben bei -20 ° C für bis zu 6 Monate aufbewahren.
  6. Die cDNA aus den Granulosazellen in RNAse-freiem Wasser auf 50 ng / μl verdünnen. Seriell verdünnen diese Lösung 1:10, um 5 ng / & mgr; l, 0,5 ng / & mgr; l, 0,05 ng / & mgr; l und 0,005 ng / & mgr; l Lösungen zu erhalten.
  7. Zusammensetzen von Reaktionen in dreifacher Ausfertigung in einem Gesamtvolumen von 20 & mgr; l pro Reaktion unter Verwendung von cDNA, die 0,05 Oozyten entspricht, als Substrat oder 5 & mgr; l der seriellen Verdünnungen der Granulosazell-cDNA, 10 & mgr; l SYBR-Grün-Supermix und 0,3 & mgr; M jedes spezifischen Primers ( Tabelle 1 ).
  8. Die Reaktion wird in einem Thermocycler unter Verwendung eines 3-stufigen Protokolls durchgeführt: 95 ° C für 30 s, 60 ° C für 30 s und 72 ° C für 20 s, 40 mal wiederholt. Schließlich erwerben Sie die Schmelzkurve ab 60 ° C und erhöhen die Temperatur um 0,5 ° C alle 20 s bis 95 ° C.
  9. Beurteilen Sie die Ausgangsmenge (SQ) der spezifischen mRNA in den Oozytenproben unter Verwendung der StandardkurveF "> 15, berechnet auf der Basis der Granulosazellprobe. Die Daten als das Verhältnis zwischen dem SQ des Gens von Interesse und dem SQ der Haushaltungsgene ausdrücken.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die ursprünglichen Befunde dieser Experimente wurden bisher in der Tiefe 7 beschrieben und werden hier als ein Beispiel von Ergebnissen beschrieben, die unter Verwendung der beschriebenen Protokolle erhalten werden können.

Reifungsrate

Von den 32 COCs, die von OPU von dominanten Follikeln abgerufen wurden, waren 28 (88%) im MII-Stadium. Vierzehn der 58 COCs, die von Follikeln von 5-25 mm gesammelt wurden, wurden sofort als unreife Oozyten für die mRNA-Expressionsstudie eingefroren. Die restlichen 44 wurden in vitro gereift, und 37 erreichten die MII-Stufe (85%). Die Effizienz der Reifung war in den beiden Gruppen nicht signifikant unterschiedlich (Fisher's exakter Test P> 0,05).

Aneuploidie-Rate

Um zu untersuchen, ob IVM caN die gläubige chromosomale Trennung zwischen der sekundären Oozyte und dem ersten polaren Körper, wurde die Anzahl der Chromosomen im MII-Stadium gezählt, da sie das Ergebnis der Chromosomensegregation während der Meiose I darstellt. Wie in Fig. 1A gezeigt , ist die Anti-Aurora B Phospho-Thr232-Antikörper spezifisch die Zentromerregion in Pferdoozyten gefärbt, so dass man die Anzahl der Chromosomen zählen kann. In vitro- genutzte Oozyten waren signifikant stärker von Aneuploidie (5/11) im Vergleich zu in vivo gereiften Oozyten betroffen (0/12; Fisher's exakter Test, P <0,05, Abbildung 1B ). Die meisten der aneuploiden Oozyten (4/5) waren hyperploid; Daher ergibt sich die Aneuploidie nicht aus Artefakten bei der Vorbereitung der Probe, die den chromosomalen Verlust bestimmt, wie es bei chromosomalen Spreads der Fall ist. Die Immunfärbung der Zentromerregion wurde auch mit den Anti-CENPA- und Anti-AURKB-Antikörpern versucht, aber kein Signal war visUalisiert in beiden Fällen (Daten nicht gezeigt).

Spindelmorphologie und Acetylierung von H4K16

Die Pol-zu-Pol-Spindellänge und der Durchmesser der Spindel bei der maximalen Breite wurden gemessen, wie in Fig. 2 dargestellt. Nach diesen Messungen waren in vitro- gefärbte Oozyten signifikant länger (19,89 ± 1,15 μm) und breiter (17,28 ± 0,81 μm) im Vergleich zu in vivo gereiften Oozyten (14,57 ± 1,7 μm in der Länge und 13,56 ± 0,91 μm im Durchmesser, ungepaart t -test, P <0,05). Bei den gleichen Proben wurde auch der globale Acetylierungsgrad von H4K16 gemessen, was bestätigt, dass die Acetylierung bei H4K16 im Vergleich zu ihren in vivo- Pendants signifikant niedriger war (Abbildung 2 , rot).

Ausdruck von tranSkripte, die für Histon-Acetyltransferasen und Deacetylasen kodieren

Ob die Expression von Genen, die an dem Histon-Acetylierungs-Deacetylierungsverfahren beteiligt waren, in in vitro- reifen Oozyten verändert wurde, wurde durch q-PCR untersucht. Histon-Acetyl-Transferase 1 ( HAT1 ), K-Acetyltransferase 8 (KAT8 ), Histon-Deacetylase 1 (HDAC1) und NAD-abhängiges Protein-Deacetylase-Sirtuin 1 ( SIRT1 ) wurden als mutmaßliche Ziele identifiziert. Signifikante Unterschiede in der Expression dieser Transkripte in unreifen, in vitro gereiften und in vivo gereiften Oozyten wurden nicht beobachtet, unabhängig von der verwendeten Normalisierung. Insbesondere wurden die Ergebnisse der in 3 gemeldeten Transkript-Expressionsanalyse mit einer Standardkurve unter Verwendung des SQ-Verfahrens berechnet und für die Hauswirtschaft-Glyceraldehyd-3-phosphat-Dehydrogenase ( GAPDH ) normalisiert. Ebenso kein UnterschiedWiederholungen wurden beobachtet, wenn die Ergebnisse, die für die Spike in der Luciferase normalisiert wurden oder wenn das ΔΔct-Verfahren verwendet wurde (nicht gezeigt).

Ziel Fw-Grundierung Rv-Grundierung Amplicon Größe
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
Luciferase TCATTCTTCGCCAAAAGCACTCTG D> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tabelle 1: Grundierung setails. Die 5 '> 3'-Sequenz der Vorwärts- (Fw) - und (Rv) -Primer und der erwarteten Amplikongröße sind für jedes untersuchte Transkript angegeben: Glyceraldehyd-3-phosphat-Dehydrogenase ( GAPDH ) , Histon-Acetyl-Transferase 1 ( HAT1 ) , Histon Deacetylase 1 (HDAC1) , K-Acetyltransferase 8 ( KAT8 ) , Luciferase und NAD-abhängiges Protein Deacetylase Sirtuin 1 ( SIRT1 ). Nachdruck mit Genehmigung aus Ziffer 7 .

/55242fig1.jpg "/>
Abbildung 1: Aneuploidie-Rate in in vivo- und in vitro- reifen Pferd Oozyten. ( A ) Repräsentative Bilder, die die Aurora B phospho-Thr232 (rot) und die DNA (grün) Färbung einer mit Monastrol behandelten MII-Stage-Pferd-Oozyte zeigen. Eine euploide Oozyte (32 Chromosomen) wird gezeigt. Maßstab = 5 μm. ( B ) Das Balkendiagramm repräsentiert die Verteilung von euploiden und aneuploiden MII-Stadium-Oozyten in vivo (n = 12) und in vitro (n = 11) gereifte Oozyten. * Zeigt einen signifikanten Unterschied in der Aneuploidie-Rate an (Fisher's exakter Test, P <0,05). Nachdruck mit Erlaubnis von Referenz 7. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2 Abbildung 2: Spindelmessung und H4K16-Acetylierung in in vivo- und in vitro- reifen Pferdeozyten. Repräsentative Bilder mit Tubulin (grün), acetyliertem H4K16 (rot) und DNA (blau) in MII-Oozyten nach in vivo (n = 4) oder in vitro (n = 14) Reifung. Die Tubulinbilder zeigen die für Spindel- und Durchmessermessungen verwendeten Achsen. Maßstab = 5 μm. Geändert aus Referenz 7 . Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 3
Abbildung 3: Ausdruck von KAT8 , SIRT1 , HAT1 , Und HDAC1 in ImmatuRe, In vivo , Und in vitro gereifte Oozyten. Die Balkendiagramme repräsentieren den Mittelwert ± SEM der relativen mRNA-Expression von KAT8 , SIRT1 , HAT1 , Und HDAC1 , Ausgedrückt als Ausgangsmenge (SQ) des Transkriptes von Interesse im Vergleich zum SQ von GAPDH , als Hauswirtschaft verwendet. Es wurden keine statistischen Unterschiede zwischen unreifen (GV, n = 14), in vivo (n = 14) und in vitro (n = 12) gereifte Oozyten (Einweg-ANOVA, P > 0,05) beobachtet. Nachdruck mit Genehmigung aus Ziffer 7 . Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Obwohl IVM seit mehr als 20 Jahren bei Pferden aufgeführt ist, wissen wir noch nicht, ob die Oozyte der Ursprung der embryonalen Aneuploidie sein kann, wie es für den Menschen vorgeschlagen wurde. Der Grund dafür ist wahrscheinlich, dass die Vorbereitung der Oozytenaufstriche für die Chromosomenzählung zu einem erheblichen Probenverlust führt. In diesem Sinne wurde eine Übersicht über die Methoden, die für die Untersuchung von Fehlern in der Chromosomensegregation verwendet wurden, durchgeführt, um nach der am besten geeigneten Technik zu suchen, um auf Pferdeozyten anzuwenden. In der wissenschaftlichen Literatur wurden vier Haupttechniken gefunden: 1) chromosomale Spreads 5 , 18 , 19 , 2) Fluoreszenz in situ Hybridisierung (FISH) 4 , 6 , 17 , 20 , 3) Zentromerzahl auf monastrol-kollabierten Spindeln , 14 , 21 , 22 und 4) Chromosomenfluoreszenzfärbung ohne Chromosomenzahl 23 , 24 , 25 .

Wie bereits erwähnt, wird die Herstellung von chromosomalen Aufstrichen, gefolgt von Giemsa-Färbung, durch eine hohe Probenverlustrate kompliziert. Diese Methode wurde in vielen Fällen durch FISH ersetzt, die spezifische Sonden verwendet, um verschiedene Chromosomen abzubilden. Ein Nachteil von FISH-Techniken besteht darin, dass, wenn eine kleine Anzahl von Sonden verwendet wird, die Inzidenz eines falschen Negativs zunehmen kann ( dh, als normal eine Zelle zu identifizieren, die aneuploid ist, weil das fehlende oder überzählige Chromosom nicht untersucht worden ist). Die zuverlässige Verwendung von FISH basiert daher weitgehend auf dem Wissen a priori der Chromosomen, die häufiger von der Aneuploidie betroffen sind ( z., Chromosom 21 bei Menschen). FISH wurde bisher verwendet, um chromosomale Anomalien in Pferdeembryonen unter Verwendung von 2 Sonden, gegen Chromosom 2 und Chromosom 4 20 zu untersuchen. Nach diesen Experimenten sind die Kerne von in vitro produzierten Embryonen eher von chromosomalen Anomalien betroffen als in vivo produzierten Embryonen. Dieser Befund stimmt mit der oben beschriebenen Beobachtung überein, wobei die Monastrol-Kollaps-Methode in IVM-Oozyten verwendet wird. Allerdings war die Inzidenz von Aneuploidie in IVM-Oozyten sogar höher als die, die unter Verwendung von FISH in in vitro- produzierten Embryonen 20 berichteten. Diese partielle Diskrepanz lässt sich durch die Tatsache erklären, dass für die FISH-Experimente nur zwei chromosomspezifische Sonden verwendet wurden. Dieser Ansatz könnte die Inzidenz von Aneuploidie mit anderen Chromosomen unterschätzt haben, besonders wenn man bedenkt, dass Pferde 32 Chromosomen haben. Es kann jedoch nicht ausgeschlossen werden, dass schwere aneuPloidien, die in den Oozyten nachweisbar sind, werden in den Embryonen nicht beibehalten, da Gameten, die von kritischen genetischen Anomalien betroffen sind, sich nicht weiter entwickeln können.

Die Kombination von Monastrol-Behandlung, Chromosom- und Zentromer-Färbung und konfokaler Mikroskopie ermöglichte die gleichbleibende Anzahl der Chromosomenzahlen in MII-Stadium-Oozyten mit minimalem Probenverlust. Die technische Begrenzung, die bei der Entwicklung dieser Technik für Pferdeozyten auftrat, war die Verfügbarkeit von Pferdespezifischen Antikörpern. Vor der Verwendung von Aurora B Phospho- (Thr232) produzierten zwei weitere Antikörper (Anti-Aurora B und Anti-CENPA) keinen Zentromer-Fleck. Bemerkenswerterweise wurden Anti-Aurora B und Anti-CENPA bereits erfolgreich in Rinder- und menschlichen Zellen eingesetzt 26 , 27 , 28 ; Daher wurde geschlossen, dass sie nicht spezifisch für das Pferd waren. Diese Technik kann auch durch die Verfügbarkeit eines konfokalen Lasersc begrenzt werdenAnning mikroskop und bildanalyse software. Auch ist die Blindzählung von zwei unabhängigen Operatoren wesentlich, um vom Operator induzierte Artefakte auszuschließen. Obwohl die chromosomale Zählung einer monastrol-kollabierten Spindel ein Ansatz ist, der die Morphologie der Zelle besser bewahrt und den Probenverlust verhindert, erlaubt diese Technik nur die Beobachtung von Unterschieden in der Grundzahl der Chromosomen; Es ist nicht informativ über andere chromosomale Anomalien ( z. B. Translokationen, segmentale Vermittlungen etc. ), die stattdessen durch Karyotypisierung und in einigen Fällen durch FISH aufgedeckt werden können.

Fehler in der Chromosomensegregation wurden auch durch Spindel- und Chromosomen-Immunfluoreszenz untersucht, ohne eine Chromosomenzahl 23 , 24 , 25 durchzuführen. In diesem Fall werden Spindeln mit schweren Anomalien und nachgelagerten oder gestreuten Chromosomen als Zeichen eines unregelmäßigen Chromosos betrachtetIch segregation Dementsprechend wurden Chromosomen, die aus der Spindel gestreut wurden, in in vitro gereiften Oozyten 7 beobachtet (die Klasse, die eher von einer Aneuploidie betroffen ist). Das chromosomale Zählen hat jedoch den Vorteil, quantifizierbare Informationen zu transportieren.

Zusammenfassend lässt sich feststellen, dass im Vergleich zu den anderen beschriebenen Techniken die Verwendung von Monastrol- und Zentromer-Färbung den Vorteil hat, den Probenverlust zu verhindern, das Auftreten von falschen Negativen zu minimieren und quantifizierbar zu sein.

Die Veränderung der epigenetischen Modifikationen wurde als ein möglicher Mechanismus bei Beginn der Oozyten-Aneuploidie 18 , 24 , 25 vorgeschlagen. Mit einem dreifachen fluoreszierenden Fleck war es möglich, die meiotische Spindel zu visualisieren und zu messen und die verbleibenden / gestreuten Chromosomen zu beobachten. Zur gleichen Zeit, dank der Entwicklung von Antikörpern, dieSpezifische Restmodifikationen zu erkennen, wurde der Acetylierungsgrad von H4K16 auf der gleichen Probe durchgeführt. Dieser Ansatz diente dem doppelten Zweck, die für die Analyse notwendige Menge an Oozyten zu reduzieren und die H4-Acetylierung mit der Morphologie der Spindel zu korrelieren.

Die Quantifizierung von kovalenten Proteinmodifikationen kann durch Western Blot durchgeführt werden. Allerdings erfordert diese Technik eine größere Probengröße und bewahrt nicht die Integrität der Probe für morphologische Studien. Der Triple-Fluoreszenz-Färbeansatz kann auf andere Histon-Modifikationen und möglicherweise auf jedes Protein angewendet werden, das von verschiedenen sekundären Antikörpern 8 erkannt werden kann; Der einzige limitierende Faktor ist die Verfügbarkeit von Pferdespezifischen Antikörpern. In diesem Zusammenhang hoffen die Autoren, dass die Aufmerksamkeit auf das Pferdemodell das Interesse an der Untersuchung der grundlegenden biologischen Mechanismen in dieser Art und damit in der Entwicklung verstärken wirdVon dedizierten Werkzeugen.

Schließlich wird auch die Expressionsstudie von mRNAs, die für Histon-Deacetylasen (HDACs) und Acetyl-Transferasen (HATs) kodieren, die durch reverse Transkription und quantitative-PCR (q-PCR) durchgeführt wurden, beschrieben. Q-PCR ist eine weit verbreitete Technik; Allerdings ist seine Verwendung für Pferd Oozyten nicht diffus. Es ist wesentlich zu spezifizieren, dass aufgrund der allgemeinen Stummschaltung der Transkriptionsaktivität während der Oozytenreifung 29 die Analyse der Gesamttranskriptmenge nur mRNA-Stabilität oder Abbau in diesem Hintergrund 30 , 31 zeigen kann . Unterschiede in der relativen Expression von Transkripten zwischen in vitro und in vivo Reifung wurden nicht beobachtet. Diese Ergebnisse deuten darauf hin, dass translatorische und posttranslationale Regelungen von IVM betroffen sein könnten, wobei auf die Notwendigkeit der Entwicklung anderer experimenteller Ansätze zur Untersuchung von Translations- und Po-St-translationalen Mechanismen auf Einzelzellenebene.

Insgesamt beschreibt die vorliegende Studie einen experimentellen Ansatz zur morphologischen und biochemischen Charakterisierung von Pferdostozyten. Dieser Ansatz kann auf Oozyten anderer Arten angewendet werden, die ähnlich von einer niedrigen Erholungsrate betroffen sind, einschließlich Menschen oder gefährdeten Arten. Diese Studien werden unser Wissen über die Fortpflanzungsbiologie von Säugetieren erweitern und zu unserem Verständnis der Unfruchtbarkeit beitragen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Die Autoren danken Fabrice Vincent für die Unterstützung bei der Laserscanning-konfokalen Mikroskopie (LSCM) und Philippe Barrière und Thierry Blard für die tägliche Ultraschall-Ovarial-Scanning und hCG-Injektion. Diese Arbeit wurde teilweise durch das Projekt "Regione Sardegna und Regione Lombardia" "Ex Ovo Omnia" (Zuschuss Nr. 26096200 an AML) unterstützt; Die "L'Oreal Italia per le Donne e la Scienza 2012" Stipendium (Vertrag 2012 bis FF), FP7-PEOPLE-2011- CIG, Forschungsausschuss (REA) "Pro-Ovum" (Zuschuss Nr. 303640 bis VL); Und durch die vom Europäischen Sozialfonds kofinanzierte Postdoktorandenschule für Landwirtschaft und Veterinärmedizin, Sektorielles operationelles Programm für die Entwicklung der Humanressourcen 2007-2013 (Vertrag Nr. POSDRU / 89 / 1.5 / S / 62371 bis IM). Die In-vivo- Oozyten-Sammlung wurde vom Institut Français du Cheval et de l'Equitation finanziert.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analyse der Chromosomensegregation, Histonacetylierung und Spindelmorphologie in Pferdeozyten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter