Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

क्रोमोजोम अलगाव का विश्लेषण, हिस्टोन एसिटिलेशन, और स्पिंडल मोर्फ़ोलॉजी इन हॉर्स ओक्साइट्स

doi: 10.3791/55242 Published: May 11, 2017

Summary

यह पांडुलिपि घोड़ों के लिए एक प्रयोगात्मक दृष्टिकोण का वर्णन करता है और जैविक रूप से घोड़े के oocytes को चिह्नित करता है। विशेष रूप से, वर्तमान काम से पता चलता है कि कैसे अल्ट्रासाउंड-निर्देशित अंडा पिक-अप (ओपीयू) द्वारा अपरिपक्व और परिपक्व घोड़े oocytes को इकट्ठा किया जाता है और गुणसूत्र अलगाव, स्पिन्डल मोर्फीलाजी, ग्लोबल हिस्टोन एसिटिलेशन, और एमआरएनए अभिव्यक्ति की जांच कैसे की जाती है।

Abstract

महिलाओं, साथी जानवरों और लुप्तप्राय प्रजातियों में बांझपन के इलाज के लिए सहायता प्रजनन का क्षेत्र विकसित किया गया है। घोड़े में, सहायता प्रजनन भी अपने खेल कैरियर में दखल के बिना उच्च प्रदर्शन से भ्रूण के उत्पादन के लिए अनुमति देता है और उच्च आनुवांशिक मूल्य के mares से foals की संख्या में वृद्धि के लिए योगदान देता है। वर्तमान पांडुलिपि, अंडा पिकअप (ओपीयू) का उपयोग कर घोड़े अंडाओं से अपरिपक्व और परिपक्व ओक्साइट्स एकत्र करने के लिए इस्तेमाल की जाने वाली प्रक्रियाओं का वर्णन करता है। इन अयस्केट्स का उपयोग तब चूहों में विकसित प्रोटोकॉल को अनुकूल करके एनीप्लोइड की घटनाओं की जांच के लिए किया जाता था। विशेष रूप से, क्रोमोसोम और मेटाफेस II (एमआईआई) ओक्साइट्स के centromeres को फ्लॉओससेंटली लेबल और सिलसिलेबल लेजर माइक्रोस्कोप स्कैनिंग के बाद अनुक्रमिक फोकल योजनाओं पर गिना गया। इस विश्लेषण ने एनीप्लोओइडी दर में उच्च घटना का पता लगाया जब अपरिपक्व oocytes follicles से एकत्र किए गए थे और इन विट्रो की तुलना में परिपक्वविवो में ट्यूबिलिन के लिए इम्यूनोस्टाईन और विशिष्ट लाइसिन अवशेषों पर एसिटिलेटेड हिस्टोन चार रूपों में भी मैयियटिक स्पिंडल के आकृति विज्ञान में अंतर और हिस्टोन एसिटिलेशन के वैश्विक पैटर्न में अंतर का पता चला है। अंत में, हिस्टोन डेकेटेलीज़ (एचडीएसी) और एसीटील-ट्रांसेफेस (एचएटी) के लिए कोडिंग एमआरएनए की अभिव्यक्ति की रिवर्स ट्रांसक्रिप्शन और मात्रात्मक-पीसीआर (क्यू-पीसीआर) द्वारा जांच की गई। प्रतिलिपि की रिश्तेदार अभिव्यक्ति में कोई मतभेद इन विट्रो और विवो परिपक्व ऑओसाइट्स के बीच मनाया गया था। Oocyte परिपक्वता के दौरान ट्रांसक्रिप्शनल गतिविधि के एक सामान्य चुप्पी के साथ समझौते में, कुल प्रतिलेख राशि का विश्लेषण केवल एमआरएनए स्थिरता या गिरावट को प्रकट कर सकता है। इसलिए, ये निष्कर्ष बताते हैं कि अन्य अनुवाद और पोस्ट-ट्रांसलेशन संबंधी नियमों को प्रभावित किया जा सकता है।

कुल मिलाकर, वर्तमान अध्ययन में morphologically और बायोकेमिक रूप से घोड़े oocyte, एक सीई को चिह्नित करने के लिए एक प्रयोगात्मक दृष्टिकोण का वर्णन करता हैकम नमूना उपलब्धता के कारण अध्ययन करने के लिए अत्यंत चुनौतीपूर्ण होगा। हालांकि, यह ज्ञानी प्रजातियों में प्रजनन जीव विज्ञान और बांझपन पर हमारे ज्ञान का विस्तार कर सकता है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

महिलाओं, साथी जानवरों और लुप्तप्राय प्रजातियों में बांझपन के इलाज के लिए सहायक प्रजनन तकनीकों का एक विशाल सरणी विकसित किया गया है। क्लिनिकल सेटिंग्स में सबसे आम प्रक्रियाओं में से एक है मेटाफेस II (एमआईआई) -स्टेज oocytes को अंडाशय के follicles से अल्ट्रासाउंड-निर्देशित ट्रांसीवैगन एस्पिरेशन, डिव्वल पिक-अप (ओपीयू) 1 द्वारा पुनर्प्राप्ति। इन अयस्क्यट्स को तब इन विट्रो (आईवीएफ) में निषेचित किया जाता है, जिसके परिणामस्वरूप भ्रूण को प्राप्तकर्ता गर्भाशय में प्रत्यारोपित किया जाता है। एमआईआई-स्टेज (परिपक्व) oocytes एक्सोजेन्सियस गोनाडोट्रोपिन के प्रशासन के बाद प्राप्त किये जाते हैं। हालांकि, यह उपचार कुछ रोगियों में, डिम्बग्रंथि हाइपरस्टिम्यूलेशन सिंड्रोम (ओएचएसएस) 2 के विकास के साथ जुड़ा हुआ है

पूरी तरह से विकसित, अपरिपक्व oocytes (जीवी-स्टेज) की आंतरिक क्षमता का लाभ उठाते हुए एक बार अपने रोम से अलग आयोइसिस ​​को फिर से शुरू करने के लिए, प्रशासन के बिना परिपक्व oocytes प्राप्त करना संभव हैटियरिंग गोनाडोट्रोपिन 3 इन प्रक्रियाओं को इन विट्रो परिपक्वता (आईवीएम) में ऊसाइट कहा जाता है और सहायता प्रजनन प्रौद्योगिकी के लिए कम दवा-उन्मुख, कम खर्चीली और अधिक रोगी-अनुकूल दृष्टिकोण का प्रतिनिधित्व करता है। हालांकि, इन विट्रो- मेचर्ड ऑओसाइट्स में भ्रूण के विकास की सफलता आमतौर पर विवो परिपक्व ऑओसाइट्स 4 , 5 के मुकाबले कम है। एक संभावित स्पष्टीकरण यह है कि गुणसूत्र अलगाव में त्रुटियों से इन विट्रो परिपक्व ओओसाइट्स में अधिक प्रभावित होते हैं, और जिसके परिणामस्वरूप अनयूपलोइडी सामान्य भ्रूणिक विकास 6 को प्रभावित करते हैं।

आईवीएम के दौरान क्रोमोसोमल गलत-पृथक्करण के आणविक आधार को समझना अंततः इस तकनीक की पूरी संभावना का खुलासा करेगा। इस नस में, इन विट्रो- मैक्टेरड ऑक्साईट्स में विवो मैटुर के मुकाबले तुलनात्मक रूप से आकृति विज्ञान और जैव रासायनिक विशेषताओं की जांच के लिए प्रयोगात्मक दृष्टिकोणएड oocytes यहाँ वर्णित है 7 , 8 विशेष रूप से, अपरिपक्व और परिपक्व ओक्साइट्स के ओपीयू के लिए प्रक्रियाएं और अपरिपक्व oocytes के आईवीएम को एक प्रयोगात्मक मॉडल के रूप में वयस्क और स्वाभाविक रूप से साइकिल चालन घोड़ों का उपयोग करके सचित्र किया गया है। फिर, इन जीमेटियों पर गुणसूत्र अलगाव, स्पिंडल आकृति विज्ञान, और हिस्टोन एसिटिलेशन के वैश्विक पैटर्न की जांच के लिए इम्यूनोफ्लोरेसेंस और इमेज विश्लेषण का उपयोग किया जाता है। अंत में, रिवर्स-ट्रांसक्रिप्शन और मात्रात्मक पीसीआर का एक प्रोटोकॉल एमआरएनए अभिव्यक्ति के विश्लेषण के लिए वर्णित है।

कृंतक पशु मॉडल के मुकाबले घोड़ों ने आनुवंशिक हेरफेर की अनुमति नहीं दी है, हेरफेर करने में कम आसान है, और महंगा रखरखाव की आवश्यकता होती है। हालांकि, इस मॉडल को oocyte परिपक्वता के अध्ययन के लिए काफी रुचि हो रही है 9 , 10 मानवीय शरीर विज्ञान की समानता के कारण 11 , 12 </ Sup>। इसके अलावा, घोड़े में आईवीएम-आईवीएफ के विश्वसनीय प्रोटोकॉल का विकास पर्याप्त आर्थिक हित है, क्योंकि इससे उच्च आनुवंशिक मूल्य के मार्स से फोल्स की संख्या में वृद्धि की अनुमति होगी।

Oocytes पर प्रयोग करने की विशेषताओं में से एक, खासकर monovulatory प्रजातियों में, प्रतिबंधित नमूना उपलब्धता है। यह सीमा एक दृष्टिकोण, जो पहले चूहों में विकसित की गई थी, को घोषित किया गया था, जो क्रोमोसोम की गिनती का संचालन करने के लिए घोड़े oocytes 13 , 14 के लिए होता है जो नमूना नुकसान को कम करता है (अन्य उपलब्ध तकनीकों के साथ तुलना की चर्चा देखें)। इसके अलावा, एक तिहाई प्रतिदीप्ति धुंधला प्रोटोकॉल एक ही नमूना पर कई विश्लेषकों का संचालन करने के लिए अनुकूलित किया गया है, और क्यू-पीसीआर विश्लेषण केवल 2 oocytes के पूल पर किया गया।

कुल मिलाकर, वर्तमान अध्ययन में morphologically और biochemically चा के उद्देश्य से एक प्रयोगात्मक दृष्टिकोण का वर्णन हैघोड़े का oocyte, एक सेल प्रकार है कि कम नमूना उपलब्धता के कारण अध्ययन करने के लिए बेहद चुनौतीपूर्ण है की तरह। हालांकि, यह प्रजनन जीव विज्ञान और monovulatory प्रजातियों की बांझपन के हमारे ज्ञान का विस्तार कर सकते हैं

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सभी प्रक्रियाओं को पशु देखभाल और उपयोग समिति सीईईए वैल डी लॉयर नंबर 1 द्वारा अनुमोदित किया गया था और प्रयोगशाला पशुओं की देखभाल और उपयोग के लिए गाइडिंग सिद्धांतों के अनुसार प्रदर्शन किया गया था।

1. Oocyte संग्रह और विट्रो परिपक्वता में

  1. अंडा पिक-अप
    1. अल्ट्रासाउंड द्वारा वयस्क मार्स के एक समूह में डिम्बग्रंथि के रोम के व्यास का दैनिक मूल्यांकन। एक कूप ≥ 33 मिमी (प्रमुख कूप) के उद्भव पर, गठिया नस (iv) के ऊपरी हिस्से में मानव कोरियोनिक गोनाडोट्रॉफ़िन (एचसीजी) के 1,500 आईयू के साथ घोड़ी को इंजेक्षन।
      1. इंजेक्शन लगाने से पहले, शराब के साथ क्षेत्र को छीनना, कण्ठा फुर का पता लगाया और शिरा को बढ़ने के लिए इंजेक्शन की साइट के नीचे अंगूठे 2-3 सेमी लगाए। सुई लगभग गर्दन के समानांतर सम्मिलित करें और सुनिश्चित करें कि सुई शिरा में है (रक्त सिरिंज में प्रवेश करेगा)। इस बिंदु पर, इंजेक्ट; एचसीजी एम को प्रेरित करेगाप्रमुख कूप में oocyte की अवधि
    2. एचसीजी इंजेक्शन के बाद 35 घंटे, डेटोमिडाइन (15 माइक्रोग्राम / किग्रा, iv), बीओओराफेनॉल टार्ट्रेट (10 ग्राम / किग्रा, iv) और ब्यूलेस्काकोलामाइन ब्रोमोर (0.2-0.3 मिलीग्राम / किग्रा, 15 एमएल / मारे, iv) के साथ घोड़ी को शांत करते हैं।
    3. अल्ट्रासाउंड जांच के लिए सुई कनेक्ट करें अल्ट्रासाउंड की जांच योनि में डालें और अल्ट्रासाउंड जांच का सामना करने के लिए अंडाशय को पारस्परिक रूप से रखें। अल्ट्रासाउंड जांच का सामना करने वाले कूप के साथ, एक ऑपरेटर को सुई और दूसरे को अंडाशय में रखने के लिए निर्देशित करें प्रमुख कूप के साथ अंडाशय से शुरू करें
    4. सुई के साथ योनि की दीवार और प्रमुख कूप की दीवार को पंचक करें (ओपीयू के लिए अल्ट्रासाउंड जांच एक सक्शन सिस्टम से जुड़े सुई के लिए एक चैनल से लैस हैं); इईचोग्राफिक छवि में तोइदेल दिखाई देगा
    5. चूषण प्रणाली से जुड़े 50 एमएल शंक्वाकार ट्यूब में कूपिक द्रव की तरक्की करें। शंक्वाकार की सामग्री डालोएक बड़े पेट्री डिश में ट्यूब और एक स्टिरिओमिसरोस्कोप का उपयोग करके क्यूम्यलस-ओक्साइट कॉम्प्लेक्स (सीओसी) की तलाश।
    6. चूंकि सीओसी हमेशा कूपिक्युलर तरल पदार्थ से प्राप्त नहीं होता है, इसलिए ड्यूलबेको के संशोधित फॉस्फेट-बफ़ेड खारा (डीपीबीएस) वाले कूप को 5 आईयू / एमएल हेपरिनैट 37 डिग्री सेल्सियस से युक्त किया जाता है। सीओसी की उपस्थिति के लिए डीपीबीबीएस की जांच करें, जैसा कि पहले चरण 1.1.5 में कूपिक्युलर तरल पदार्थ के लिए वर्णित है। सीओसी पुनर्प्राप्त होने तक कई बार फ्लश करें।
    7. प्रमुख कूप से सीओसी को एक बार पुनः प्राप्त किया जाता है, पंचर 5 और ≤25 मिमी फलों को फिसल जाता है, जैसा कि 1.1.3-1.1.4 चरण में प्रमुख कूप के लिए वर्णित है; रुम 5 और 2525 लूटाईिंग हार्मोन / क्लोरोजेनडोट्रोपिन रिसेप्टर (एलएचसीजीआर) को व्यक्त नहीं करते हैं, और इसलिए, एचसीजी के जवाब में उनके ओक्साइट्स परिपक्व नहीं होंगे और जीवी चरण (अपरिपक्व) पर एकत्रित किए जाएंगे। केवल सीओसी को क्यूम्यलस कोशिकाओं और भूरा, बारीक-कणिकयुक्त ऊपलाश के कई पूर्ण परतों के साथ रखें। दूसरों को त्यागें
    8. ओपीयू के अंत में, मेंसंक्रमण को रोकने के लिए बेंजीन-पेनिसिलिन 15,000 आईयू / पशु के साथ मारे का पता लगाएं।
    9. कम से कम 2 घंटे के लिए एक शांत, स्वच्छ स्थिर में घोड़ी को घर। कानों की स्थिति, उत्तेजनाओं की प्रतिक्रिया ( उदाहरण के लिए, शोर), और अन्य पशुओं की कंपनी को घोड़ी लौटने से पहले चाल के निर्धारण के माध्यम से जागरूकता के संकेतों की जांच करें।
  2. इन विट्रो परिपक्वता में
    1. 1 9 7 9 IU / L हेपरिन, 0.4% गोजातीय सीरम एल्बूमिन (बीएसए), पेनिसिलिन और स्ट्रेप्टोमाइसिन से 37 डिग्री सेल्सियस के साथ पूरक एचसीईएस-बफर टीसीएम 9 9 (20 एमएम हेप्स) पूरक। इस माध्यम को अग्रिम में तैयार करें फ़िल्टर-बाँझ और 4 डिग्री सेल्सियस तक 6 महीने तक रखें।
    2. 50 एनजी / एमएल एपिडर्मल ग्रोथ फैक्टर (ईजीएफ) और 20% बछड़ा सीरम 7 के साथ NaHCO 3- बफर टीसीएम 1 9 9 (25 एमएम नाहोको 3 ) के पूरक द्वारा आईवीएम माध्यम तैयार करें। एक नई बोतल खोलने के 3 सप्ताह के भीतर, NaHCO 3- बफर टीसीएम 1 9 9 का उपयोग करें पूर्ववर्ती ईजीएफ को 100x शेयरों के रूप में तैयार करें, यह -20 डिग्री सेल्सियस पर फ्रीज करें, और इसे 6 महीने के भीतर उपयोग करें कम से कम 2 घंटे के लिए 38 डिग्री सेल्सियस पर 5% सीओ 2 के साथ एक 4-अच्छी तरह से पकवान के कुओं में 500 μL को बांटना और humidified हवा में सेते हैं।
    3. ≥5 और ≤25 मिमी के follicles से सीओसी की पुनर्प्राप्ति के बाद, उन्हें 2 मिलीलीटर एचईपीईएस-टीसीएम 1 9 9 से भरा पेट्री डिश (3.5 सेंटीमीटर व्यास) में डाल दें। सीओसी को डिश के विभिन्न क्षेत्रों में स्थानांतरित करने के लिए सेलुलर मलबे को दूर धोने के लिए।
    4. सीओसी को आईवीएम माध्यम में स्थानांतरित करें और हवादार हवा में 28 घंटे के लिए 38% से 5% सीओ 2 पर सेवन करें।

2. Immunofluorescence और छवि विश्लेषण

  1. क्रोमोजोम गिनती
    1. प्रमुख कूप से या आईवीएम के अंत में संग्रह के बाद, सीओसी को 100 मिलीमीटर मॉन्सट्रॉल से 1 एल के लिए आर्मीड वायु में 5% सीओ 2 से 38.5 डिग्री सेल्सियस पर ले जाना चाहिए। 100 एक्स स्टॉक्स के रूप में अग्रिम रूप से मॉन्सट्रॉल तैयार करें और इसे 1 साल तक -20 डिग्री सेल्सियस पर स्टोर करें।
    2. मेघपुंज कोशिकाओं को निकालेंउन्हें 0.5% के साथ इलाज करके hyaluronidase या धीरे pipetting द्वारा; इसे 0.2% की मात्रा में इलाज करके ज़ोना पेलूसिडा को हटा दें। Hyaluronidase तैयार करें और अग्रिम में 10x शेयरों के रूप में तैयार करें और उन्हें 1 साल तक -20 डिग्री सेल्सियस पर स्टोर करें।
    3. डीपीबीएस में 4% पैराफॉर्मालाइडहाइड में 38 डिग्री सेल्सियस पर 15 मिनट के लिए ऑओसाइट्स को ठीक करें और उसके बाद 4 डिग्री सेल्सियस पर एक और 45 मिनट।
      सावधान! खतरनाक कचरा निपटान के दिशानिर्देशों के अनुसार प्रदूषित सामग्री का निपटान करते हुए पैराफॉर्मैल्डाहाइड को निपटाने के लिए व्यक्तिगत सुरक्षात्मक उपकरण पहनें और निकालें।
    4. 0.1% पॉलीविनाल अल्कोहल (पीवीए) के साथ पूरक 500 μL डीपीबीएस से भरा 3 कुओं में अनुक्रमिक रूप से स्थानांतरित करके oocytes धोएं। कमरे के तापमान (आरटी) पर 10 मिनट के लिए 0.3% ट्राइटन एक्स-100 में स्थिरता।
    5. डीपीबीएस में 1% गोजातीय सीरम एल्बूमिन (डीपीबीएस -1% बीएसए) और 10% सामान्य गधा सीरम आरटी पर कम से कम 30 मिनट के लिए पूरक के साथ गैर-विशिष्ट बाध्यकारी सेबी अवरुद्ध करें। नमूनों को अवरुद्ध समाधान में 4 डिग्री सेल्सियस पर 3-4 दिनों तक रखा जा सकता है।
    6. प्राइमरी धुंधला हो जाने के लिए, डीपीबीएस में खरगोश विरोधी-अरोड़ा बी फॉस्फो-थोर 323 में ओक्साइट्स को 1% बीएसए (कमजोर पड़ने 1:50) के साथ-साथ 4 डिग्री सेल्सियस पर रात भर में सेते हैं।
    7. चरण 2.1.4 में वर्णित अनुसार oocytes धोएं। अंधेरे में आरटी पर 1 घंटे के लिए टेट्रा-मेथिलरहादैमाइन आइसोथियोसाइनेट (टीआरआईटीसी) -संबद्ध गधा विरोधी खरगोश आईजीजी (डीपीबीएस-1% बीएसए में 1: 100) के समाधान में oocytes सेते हैं।
    8. चरण 2.1.4 में बताए अनुसार ओकसाइट्स धो लें, और फिर एक ग्लास स्लाइड पर 20 माइक्रोन के YOPRO1 के साथ पूरक गैर-सख्त, विरोधी-फीका बढ़ते माध्यम की एक बूंद में 3-4 oocytes रखें। जब तक सभी ऑक्साइट्स माउंट नहीं हो जाते, तब तक प्रक्रिया को दोहराएं (3-4 oocytes प्रति स्लाइड)।
    9. माउंटेनिंग माध्यम में oocytes को लगभग 10 मिनट के लिए व्यवस्थित करने की अनुमति दें, और फिर उन्हें कसलीप के साथ कवर करें। Oocytes को कुचलने से बचने के लिए, कांच की स्लाइड पर कंसलिप को बिछाने से पहले दो तरफा टेप के दो स्ट्रिप्स लागू करें
      नोट: यह एहतियात भी यह सुनिश्चित करेगा कि सभी नमूने ग्लास स्लि के बीच समान रूप से संकुचित किए गए हैंडी और कंसलिप ग्लास स्लाइड -20 डिग्री सेल्सियस पर जमे हुए और निम्न 2-3 दिनों के दौरान इमेज किए जा सकते हैं।
    10. लाल (सेंन्ट्रोमरेस) और हरे रंग (क्रोमोसोम) चैनल 7 , 13 , 14 , 20 , 21 का उपयोग करते हुए एक 60 एक्स उद्देश्य के साथ एक confocal लेजर स्कैनिंग माइक्रोस्कोप पर नमूने छवि। Z- अक्ष पर पूरे मेटाफिक प्लेट की फैले हुए नमूनों को स्कैन करें, प्रत्येक 0.35 माइक्रोन के चरणों के साथ। हर एक योजना की डिजिटल छवियों को सहेजें
    11. एनआईएच छवि जेएस सॉफ़्टवेयर के सेल गणित फ़ंक्शन का उपयोग करके सीरियल कॉन्फोकल अनुभागों में सेंट्रोमरों को गिनाएं (https://imagej.nih.gov/ij/plugins/cell-counter.html पर उपलब्ध)।
      नोट: बार-बार सेंन्ट्रोम से बचें, जो एक सांख्यिक कोड वाले अनुक्रमिक अनुभागों में दिखाई देने वाले, रहने और रहने वाले केंद्रों की पहचान करके आसन्न वर्गों पर दिखाई देते हैं।
    12. गुणसूत्र सह दोहराएँएक स्वतंत्र ऑपरेटर के साथ चरण 2.1.11 में खुलाना।
      नोट: ईक्लोइड (32 गुणसूत्र), हाइपरप्लाइड (> 32), या हाइपोपॉलाइड (<32) के रूप में oocytes को वर्गीकृत करें।
  2. स्पिंडल मोर्फोलॉजी और हिस्टोन एसिटिलेशन
    1. प्रमुख कूप से या आईवीएम के अंत में संग्रह करने के बाद, चरण 2.1.2 में वर्णित अनुसार, 0.5% स्राव हाइलोरोनाइडेज़ या सौम्य पिपेटिंग द्वारा इलाज द्वारा क्यूम्यलस कोशिकाओं को हटा दें।
    2. चरण 2.1.4 में डीपीबीएस-पीवीए में oocytes धो लें, और उन्हें 2.5% पैराफॉर्मालाइहाइड में 38 डिग्री सेल्सियस पर 20 मिनट के लिए तय करें। चरण 2.1.4 में वर्णित के रूप में बड़े पैमाने पर धो लें, और आरटी के 5 मिनट के लिए 0.1% ट्राइटॉन एक्स-100 में प्रचलित करें।
      नोट: खतरनाक कचरे के निपटान के दिशानिर्देशों के अनुसार प्रदूषित सामग्री के निपटान के दौरान व्यक्तिगत सुरक्षात्मक उपकरणों को पहनें और निपटान करें।
    3. 2% गोजातीय सीरम एल्बूमिन (डीपीबीएस - 2% बीएसए), 0.05% सैपोनिन, और 10% सामान्य गधा सीरम के साथ डीपीबीएस में गैर-विशिष्ट बाध्यकारी सेबी अवरुद्ध करें।आर 2 आर पर आर 2 एच
      नोट: नमूनों को अवरुद्ध समाधान में 4 डिग्री सेल्सियस 3-4 दिनों के लिए रखा जा सकता है।
    4. प्राथमिक धुंधला के लिए, माउस एंटी-अल्फा-ट्यूबिलिन (1: 150) और खरगोश विरोधी एसीएच 4 के 16 (1: 250) डीपीबीएस-2% बीएसए में 0.05% सैपोनिन के साथ 4 डिग्री सेल्सियस पर रात भर में ओकोसाइट्स सेते हैं।
    5. चरण 2.1.4 के रूप में oocytes धोएं। हरे फ्लोरोसेंट डाई संयुग्मित गधा विरोधी माउस आईजीजी (1: 500) और टीआरआईटीसी-संयुग्मित गधा विरोधी खरगोश आईजीजी (1: 100) डीपीबीएस-2% बीएसए में 1 एच के लिए 0.05% सैपोनिन के समाधान में ओक्साइट्स सेते हैं। अंधेरे में आरटी
    6. चरण 2.1.4 के रूप में oocytes धोएं, और फिर 1 μg / mL 4 ', 6-डायरीडोनो-2-फेनिलंडोल (डीएपीआई) के साथ पूरक गैर-सख्त, विरोधी-फीका बढ़ते माध्यम की एक बूंद में 3-4 oocytes रखें। एक ग्लास स्लाइड पर
    7. चरण 2.1.8 में वर्णित के अनुसार ग्लास स्लाइड पर oocytes माउंट करें।
    8. लाल (एसीएच 4 के 16), हरे (अल्फा-ट्यूबिलिन), और नीले (डीएनए) चैनलों का उपयोग करके 60x उद्देश्य के साथ एक confocal लेजर स्कैनिंग माइक्रोस्कोप पर नमूने छवि।
      नोट: सभी नमूनों के अधिग्रहण के दौरान लाल और नीले रंग के चैनलों के लिए लेजर सेटिंग्स स्थिर रखें। पूरे मेयूओटिक स्पिंडल और मेटामासिक प्लेट जेन-एक्स पर फैले नमूनों को स्कैन करें, प्रत्येक 0.35 माइक्रोन के चरणों के साथ। डिजिटल छवियों को सहेजें (सिंगल प्लान और अनुमानित 3D छवि)
    9. NIH ImageJ सॉफ़्टवेयर (https://imagej.nih.gov/ij/docs/guide/146-30) के माप फ़ंक्शन का उपयोग करके अनुमानित छवि पर अधिकतम चौड़ाई पर पोल-टू-पोल स्पिंडल लम्बाई और स्पिंडल व्यास को मापें .html)। प्रत्येक 3 बार दोहराएं और मतलब की गणना करें।
    10. NIH ImageJ सॉफ्टवेयर (https://imagej.nih.gov/ij/docs/guide/146-30.html) के एकीकृत घनत्व फ़ंक्शन का उपयोग करके एसीएच 4 के 16 के रिश्तेदार फ्लोरोसेंट को बढ़ाएं। डीएपीआई धुंधला के एकीकृत घनत्व के लिए इसे सामान्यीकृत करें

3. एमआरएनए अभिव्यक्ति का विश्लेषण

  1. सीओसी 5 से 25 मिमी के follicles से प्राप्त किया गया है के बाद, granulosa सेल एस इकट्ठापेटी डिश में बने रहना और इसे ठंडे डीपीबीएस में 2 बार के लिए 10,600 xg पर सेंटीफ्यूजिंग में दो बार धोना। तरल नाइट्रोजन में स्नैप फ्रीज नमूनों को -80 डिग्री सेल्सियस तक 6 महीने तक स्टोर करें; कक्ष मानक वक्र के लिए काम करेंगे
  2. चरण 2.1.2 में अपरिपक्व (जीवी) से, इन विट्रो परिपक्व में, और विवो परिपक्व ओओसाइट्स में वर्णित सभी क्यूम्यलस कोशिकाओं को सावधानीपूर्वक निकालें।
  3. 2.1.4 में वर्णित Oocytes को डीपीबीएस-पीवीए में धो लें, उन्हें अकेले 1 μL संस्करणों में एकत्र करें और 2 μL आरएनएलाटर को ऊपर रखें। तरल नाइट्रोजन में स्नैप-फ्रीज नमूनों को -80 डिग्री सेल्सियस तक 6 महीने तक स्टोर करें।
  4. प्रत्येक नमूना में एक स्पाइक-इन के रूप में 2 पीजी ल्यूसिफेस आरएनए जोड़ें Oocytes 2 x 2 को पूल करें और छोटे से नमूनों से आरएनए को पुनर्प्राप्त करने के लिए उपयुक्त सिलिका झिल्ली फ़िल्टर-आधारित किट का उपयोग करके कुल आरएनए निकालें।
  5. 10 μL में 0.25 माइक्रोग्राम यादृच्छिक हेक्समर्स और माउस मोलॉनी ल्यूकेमिया वायरस रिवर्स ट्रांस्क्रिप्टेज़ के साथ रिवर्स-ट्रांसक्रिप्शन 1 एच पर 37 और # 176; सी। 6 महीने तक -20 डिग्री सेल्सियस पर नमूने स्टोर करें।
  6. आरएनएसी मुक्त पानी में ग्रैन्यूलोसा कोशिकाओं से सीडीएनए को 50 एनजी / एमएल में डालना 5 एनजी / μL, 0.5 एनजी / एमएल, 0.05 एनजी / एमएल, और 0.005 एनजी / μ एल समाधान प्राप्त करने के लिए इस समाधान 1:10 को धीरे-धीरे पतला करें।
  7. सब्सट्रेट के रूप में सीडीएनए समतुल्य 0.05 ऑओकाइट्स के रूप में, या ग्रैन्यूलोसा सेल सीडीएनए के सीरियल बेलियन्स के 5 μL, एसआईबीआर हिरण सुपरमिक्स के 10 μL, और प्रत्येक विशिष्ट प्राइमर के 0.3 माइक्रोन के प्रति प्रतिक्रिया में 20 μL प्रति प्रतिक्रिया की कुल मात्रा में तीन प्रतियों में प्रतिक्रियाएं इकट्ठा करें ( तालिका 1 )
  8. एक 3-कदम प्रोटोकॉल का प्रयोग करके थर्मल साइक्लर में प्रतिक्रिया चलाएं: 30 एस के लिए 95 डिग्री सेल्सियस, 30 एस के लिए 60 डिग्री सेल्सियस, और 20 डिग्री के लिए 72 डिग्री सेल्सियस, दोहराया 40 बार। अंत में, पिघलने की अवस्था का अधिग्रहण, 60 डिग्री सेल्सियस से शुरू होता है, और तापमान 20 डिग्री सेल्सियस तक बढ़कर 95 डिग्री सेल्सियस तक बढ़ जाता है।
  9. मानक वक्र का उपयोग करते हुए oocyte नमूनों में विशिष्ट mRNA के प्रारंभिक मात्रा (एसक्यू) का आकलन करेंच "15 ग्रेन्युलोसा सेल नमूना के आधार पर गणना की गई। हित के जीन के एसक्यू और हाउसकीपिंग जीन की एसक्यू के बीच के अनुपात के रूप में डेटा को व्यक्त करें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इन प्रयोगों के मूल निष्कर्षों को पहले 7 में गहराई में वर्णित किया गया था और इन परिणामों के एक उदाहरण के रूप में बताया गया है जो वर्णित प्रोटोकॉल का उपयोग करके प्राप्त किया जा सकता है।

परिपक्वता दर

ओपीयू द्वारा प्रभावी रोमियों द्वारा प्राप्त 32 सीओसी में से 28 (88%) एमआईआई चरण में थे एमआरएनए अभिव्यक्ति अध्ययन के लिए अपरिपक्व oocytes के रूप में आकार में 5-25 मिलीमीटर आकार के follicles से एकत्र किए गए 58 सीओसी में से चौदहों को तुरन्त-फ्रोजन किया गया था। शेष 44 इन विट्रो में परिपक्व थे, और 37 एमआईआई चरण (85%) तक पहुंच गए थे। परिपक्वता की दक्षता दो समूहों में काफी भिन्न नहीं थी (फिशर की सटीक परीक्षा पी> 0.05)।

एयूप्लोइडी दर

अध्ययन करने के लिए कि क्या IVM caद्वितीयक औोकाइट और पहला ध्रुवीय निकाय के बीच वफादार गुणसूत्र विभाजन को उलझाना, एमआईआई चरण में गुणसूत्रों की संख्या गिना गया, क्योंकि यह आयोइसिस ​​आई के दौरान गुणसूत्र अलगाव के परिणाम को दर्शाती है। जैसा कि चित्र 1 ए में दिखाया गया है, अरोड़ा अरोड़ा बी फास्फो-थ्री 232 एंटीबॉडी ने विशेष रूप से घोड़े के oocytes में सेंट्रोमेरिक क्षेत्र को दाग दिया, जिससे कि एक को गुणसूत्रों की संख्या की गणना कर सकें। विवो में परिपक्व ऑओसाइट्स में विवो परिपक्व ऑओसाइट्स (0/12; फिशर की सटीक परीक्षा, पी <0.05; चित्रा 1 बी ) की तुलना में एनेप्लोइडी (5/11) द्वारा काफी अधिक प्रभावित हुए थे। अधिकांश एनाप्लोइड ओक्साइट्स (4/5) हाइपरप्लाइड थे; इसलिए, एनोप्लोइडी दर क्रोमोसोमल नुकसान का निर्धारण करने के नमूने की तैयारी में कलाकृतियों से नहीं होती है, जैसा कि क्रोमोसोमल स्प्रेड के साथ होता है। सेंट्रोमेरिक क्षेत्र के प्रतिरक्षण को भी विरोधी-सीएनएपीए और एंटी-एयूआरबीबी एंटीबॉडी के साथ करने का प्रयास किया गया था, लेकिन कोई संकेत नहीं थादोनों मामलों में योग्य (डेटा नहीं दिखाया गया)।

स्पिंडल मोर्फोलॉजी और एच 4 के 16 एसिटिलेशन

ध्रुव से ध्रुव तकला लंबाई और अधिकतम चौड़ाई पर धुरी का व्यास मापा गया था, जैसा कि चित्रा 2 में दिखाया गया है । इन मापों के अनुसार, विवो में परिपक्व ऑक्साइट्स काफी अधिक (19.8 9 ± 1.15 माइक्रोग्राम) और व्यापक (17.28 ± 0.81 सुक्ष्ममापी) विवो परिपक्व ऑओसाइट्स (लंबाई में 14.57 ± 1.7 माइक्रोन और व्यास में 13.56 ± 0.91 माइक्रोन में तुलना में); unpaired टी -टीस्ट, पी <0.05)। उसी नमूनों पर, एच 4 के 16 के वैश्विक एसिटिलेशन स्तर को भी मापा गया, यह पुष्टि करते हुए कि एच 4 के 16 में एसिटिलेशन आईवीएम ऑक्साइट्स में विवो समकक्षों ( चित्रा 2 , लाल) की तुलना में काफी कम था।

ट्रॅन का अभिव्यक्तिहिस्टोन एसिटाइल ट्रान्सफेरेसेस और डेक्टालिज़िस के लिए कोडिंग लिपियां

क्या हिस्टोन एसिटिलेशन-डेसेटाइलेशन प्रक्रिया में शामिल जीनों की अभिव्यक्ति को इन-विट्रो- मैक्टेरड ऑओसाइट्स में क्यू-पीसीआर द्वारा जांच की गई थी। हिस्टोन एसिटील-ट्रान्सफर 1 (एचएटी 1), के-एसिटाइल ट्रांससार्सेज 8 ( कैट 8), हिस्टोन डेसेटेलीज़ 1 (एचडीएसी 1), और एनएडी-निर्भर प्रोटीन डेसेटाइलस सिर्टुइन 1 ( एसआईआरटी 1 ) को धब्बेदार लक्ष्य के रूप में पहचाना गया है। अपरिपक्व, इन विट्रो परिपक्व और विवो परिपक्व ओक्साइट्स में इन प्रतिलेखों की अभिव्यक्ति में महत्वपूर्ण अंतर नहीं देखा गया, उपयोग किए जाने वाले सामान्यीकरण से स्वतंत्र। विशेष रूप से, चित्रा 3 में दी गई प्रतिलेख अभिव्यक्ति विश्लेषण के परिणाम की गणना एसक्यू विधि का उपयोग करते हुए एक मानक वक्र के खिलाफ की जाती थी और हाउसकीपिंग ग्लिसराइडहाइड -3 फॉस्फेट डिहाइड्रोजनेज (जीएपीडीएच) के लिए सामान्यीकृत था। इसी तरह, कोई मतभेद नहींबालों को तब देखा गया जब परिणाम जहां लुईफेरेज़ में स्पाइक के लिए सामान्य हो या जब ΔΔct विधि का इस्तेमाल किया गया (दिखाया नहीं गया)।

लक्ष्य एफडब्ल्यू प्रिमर आर.वी. प्राइमर एम्प्लिकॉन का आकार
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 बीपी
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 21 9 बीपी
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 बीपी
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 बीपी
luciferase TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 बीपी
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 16 9 बीपी

तालिका 1: प्राइमर विवरण विश्लेषण के प्रत्येक प्रतिलेख के लिए आगे ( एफडब्ल्यू ) और ( आरवी ) प्राइमरों और अपेक्षित एम्प्लिकॉन आकार के 5 'अनुक्रम' दिए गए हैं: ग्लिसराइडहाइड -3 फॉस्फेट डिहाइड्रोजनेज (जीएपीडीएच) , हिस्टोन एसिटील-ट्रान्सफर 1 ( एचएटी 1) , हिस्टोन डेकाटाइलेज़ 1 (एचडीएसी 1) , के -एसिटाइल ट्रांसंसफेस 8 (कैट 8) , ल्यूइफेरेज़ और एनएडी-निर्भर प्रोटीन डेसेटाइलस सिर्टुइन 1 ( एसआईआरटी 1 )। संदर्भ 7 से अनुमति के साथ पुनर्प्रकाशित

/55242fig1.jpg "/>
चित्रा 1: जीवाश्म में- और विट्रो- मेचर्ड हॉर्स ओक्साइट्स में एनेप्लोइडी दर। ( ) अॉरोरा बी फॉस्फो-थ्र 322 (लाल) और डीएनए (हरा) स्टेनिंग को एमआईआई-स्टेज घोड़ा ओओसीइट दिखाए जाने वाले प्रतिनिधि छविएं मॉन्सट्रॉल के साथ इलाज की गईं। एक यूक्लोइड ओसाइट (32 गुणसूत्र) दिखाए जाते हैं। स्केल बार = 5 सुक्ष्ममापी ( बी ) बार ग्राफ विवो (एन = 12) में इन विट्रो (एन = 11) परिपक्व ओओकाइट्स में एयूप्लोइड और एयूमलोलाइड एमआईआई-स्टेज ओक्साइट्स के वितरण को दर्शाता है। * एनीप्लोओडीई दर (फिशर की सटीक परीक्षा, पी <0.05) में एक महत्वपूर्ण अंतर को दर्शाता है। संदर्भ से अनुमति के साथ पुनर्प्रकाशित 7. कृपया इस आंकड़े के एक बड़े संस्करण को देखने के लिए यहां क्लिक करें।

चित्र 2 चित्रा 2: स्पाइंडल मापन और एच 4 के 16 एसिटिलेशन, इन विवो में- और विट्रो- मेचर्ड हॉर्स ओक्साइट्स में। विवो (एन = 4) में या विट्रो (एन = 14) परिपक्वता के बाद एमआईआई ऑक्साइट्स में ट्यूबिलिन (हरा), एसिटिलेटेड एच 4 के 16 (लाल), और डीएनए (नीला) प्रदर्शित प्रतिनिधि चित्र। ट्यूबिलिन छवियां धुरी की लंबाई और व्यास माप के लिए उपयोग किए गए कुल्हाड़ियों को दिखाती हैं। स्केल बार = 5 सुक्ष्ममापी संदर्भ 7 से संशोधित इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र तीन
चित्रा 3: केएटी 8 , एसआईआरटी 1 , एचएटी 1 , और इमामतु में एचडीएसी 1फिर, वीवो में , और विट्रो परिपक्व ओओसाइट्स में बार ग्राफ़ KAT8 , SIRT1 , एचएटी 1 के रिश्तेदार एमआरएनए अभिव्यक्ति के मतलब एसयूएम का प्रतिनिधित्व करते हैं , और एचडीएसी 1 , जीएपीडीएच के एसक्यू की तुलना में ब्याज की प्रतिलिपि की शुरुआती मात्रा (एसक्यू) के रूप में व्यक्त की गई, जिसे हाउसकीपिंग के रूप में इस्तेमाल किया गया था। विवो (एन = 14) में, और इन विट्रो (एन = 12) परिपक्व ओक्साइट्स (एक तरफा एनोवा, पी > 0.05) में अपरिपक्व (जीवी, एन = 14) के बीच कोई सांख्यिकीय अंतर नहीं देखा गया था। संदर्भ 7 से अनुमति के साथ पुनर्प्रकाशित इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

भले ही आईवीएम 20 से अधिक वर्षों तक घोड़ों में किया गया हो, हम अभी तक यह नहीं जानते हैं कि ओओसीइट भ्रूणीय एनेप्लोइडे का मूल हो सकता है, जैसा कि मनुष्य 17 के लिए प्रस्तावित किया गया है। शायद कारण यह है कि ओसोइट की तैयारी गुणसूत्र की गिनती के परिणाम के लिए काफी नमूना नुकसान में फैलती है। इस बात को ध्यान में रखते हुए, क्रोमोसोम अलगाव में त्रुटियों की जांच के लिए इस्तेमाल किए जाने वाले तरीकों का एक सर्वेक्षण घोड़ों के oocytes पर लागू करने के लिए सबसे उपयुक्त तकनीक की खोज के लिए किया गया था। वैज्ञानिक सिद्धांतों में चार मुख्य तकनीकें मिलीं: 1) क्रोमोसोमल 5 , 18 , 1 9 , 2 में फैलता है) स्वस्थानी संकरण (एफआईएसएच) 4 , 6 , 17 , 20 , 3) में फ्लोरोसेंट मॉन्सट्रॉल-गिरते हुए स्पिंडल , 14 , 21 , 22 , और 4) गुणसूत्र संख्या 23 , 24 , 25 के बिना क्रोमोसोम प्रतिदीप्ति धुंधला हो जाना।

जैसा कि पहले ही उल्लेख किया गया है, जीमेसा धुंधला होने के बाद गुणसूत्र फैलाने की तैयारी नमूना नुकसान की उच्च दर से जटिल है। इस पद्धति को FISH द्वारा कई मामलों में बदल दिया गया है, जो विभिन्न गुणसूत्रों को मैप करने के लिए विशिष्ट जांच का उपयोग करता है। फिश तकनीकों का एक दोष यह है कि जब छोटी संख्या में जांच की जाती है, तो झूठी नकारात्मक की घटनाएं बढ़ सकती हैं ( यानी, सामान्य रूप में एक सेल की पहचान करना जो कि एयूपलोइड है क्योंकि गुम या अतिसूक्ष्म गुणसूत्र की जांच नहीं की गई है)। एफआईएसएच का विश्वसनीय उपयोग इसलिए काफी हद तक ज्ञान पर आधारित है कि गुणसूत्रों की एक प्राथमिकता जो कि एनेप्लोइडी से अधिक बार प्रभावित होती है ( उदा।।, मनुष्यों में गुणसूत्र 21)। एफआईएसएच का उपयोग पहले घोड़े के भ्रूण में क्रोमोसोम 2 और क्रोमोसोम 4 20 के खिलाफ 2 जांचों का उपयोग करते हुए गुणसूत्र संबंधी असामान्यताओं की जांच के लिए किया गया है। इन प्रयोगों के अनुसार, इन विट्रो में किए गए भ्रूण के नाभिक, विवो उत्पादनित भ्रूण की तुलना में क्रोमोसोमल असामान्यताओं से अधिक होने की संभावना है। यह खोज IVM oocytes में मॉन्सट्रॉल-पतन पद्धति के उपयोग से ऊपर की गई अवलोकन के साथ समझौते में है। हालांकि, IVM oocytes में एयप्प्लायसी की घटनाएं उस विट्रो- प्रोड्यूसड भ्रूण 20 में एफआईएसएच का उपयोग करते हुए रिपोर्ट की तुलना में कहीं अधिक थी। इस आंशिक विसंगति को इस तथ्य से समझाया जा सकता है कि एफआईएसएच प्रयोगों के लिए केवल दो गुणसूत्र-विशिष्ट जांच का उपयोग किया गया था। इस दृष्टिकोण में अन्य गुणसूत्रों को शामिल करने वाले एयप्लोइडी की घटनाओं को कम करके आंका जा सकता है, खासकर जब घोड़ों के 32 गुणसूत्र होते हैं। हालांकि, यह गंभीर एएनयू को शामिल नहीं किया जा सकताOocytes में detectable ploidies भ्रूण में बनाए रखा नहीं है क्योंकि महत्वपूर्ण आनुवंशिक असामान्यताओं से प्रभावित gametes आगे विकसित नहीं हो सकता है।

मॉन्सट्रॉल उपचार, गुणसूत्र और सेंट्रोमरी धुंधला हो जाना, और confocal माइक्रोस्कोपी का संयोजन न्यूनतम नमूना हानि के साथ एमआईआई-चरण घोड़े oocytes में क्रोमोसोम संख्या के लगातार मायने रखता है। घोड़े के oocytes के लिए इस तकनीक का विकास करने में तकनीकी सीमा का सामना करना पड़ा घोड़े विशिष्ट एंटीबॉडी की उपलब्धता थी। अरोड़ा बी फॉस्फो- (थ्रेस -232) का उपयोग करने से पहले, दो अन्य एंटीबॉडी (अरोड़ा-बी और एंटी-सीएनएपीए) ने एक सेंट्रोमोरिक दाग का उत्पादन नहीं किया। विशेष रूप से, अरोड़ा-बी और एंटी-सेन्पा को पहले से ही गोजातीय और मानव कोशिकाओं 26 , 27 , 28 ; इसलिए, यह निष्कर्ष निकाला गया कि वे घोड़े के लिए विशिष्ट नहीं थे। इस तकनीक को एक confocal लेजर sc की उपलब्धता के द्वारा सीमित किया जा सकता हैएनिंग माइक्रोस्कोप और इमेज विश्लेषण सॉफ्टवेयर इसके अलावा, ऑपरेटर प्रेरित कलाकृतियों को बाहर करने के लिए दो स्वतंत्र ऑपरेटरों द्वारा अंधा गिनती आवश्यक है। भले ही एक मोनसॉस्ट्रॉल गिरने वाले धुरी के गुणसूत्र की गणना एक ऐसा दृष्टिकोण है जो सेल के आकारिकी को बेहतर ढंग से सुरक्षित रखता है और नमूना हानि को रोकता है, इस तकनीक में केवल गुणसूत्रों की मूल संख्या में अंतर के अवलोकन की अनुमति मिलती है; यह अन्य गुणसूत्र संबंधी असामान्यताओं ( जैसे, ट्रांसलोक्शन, सेगमेंटल इंटरचेंज आदि ) पर जानकारीपूर्ण नहीं है, जो कि किरणोटीपिंग द्वारा और इसके बजाय कुछ मामलों में, FISH द्वारा प्रकट किया जा सकता है।

क्रोमोसोम अलगाव में त्रुटियों को भी स्पिंडल और क्रोमोसोम इम्यूनोफ्लोरेसेंस द्वारा जांच की गई है, बिना गुणसूत्र गिनती 23 , 24 , 25 । इस मामले में, गंभीर विसंगतियों और ठंड या बिखरे हुए गुणसूत्रों के साथ spindles अनियमित क्रोमोसो के लक्षण माना जाता हैमुझे अलगाव तदनुसार, धुरी के बाहर बिखरे हुए गुणसूत्रों को इन विट्रो परिपक्व ओओसाइट्स 7 में देखा गया (कक्षा जो कि एनेप्लोइडी से अधिक होने की संभावना है)। हालांकि गुणसूत्र गिनती में मात्रात्मक जानकारी देने का लाभ होता है।

वर्णित अन्य तकनीकों की तुलना में संक्षेप करने के लिए, मॉनिस्ट्रॉल और सेंट्रोमरी धुंधला के उपयोग में नमूना नुकसान को रोकने, झूठी नकारात्मकताओं की घटनाओं को कम करने, और मात्रात्मक होने का लाभ होता है।

एपिजेनेटिक संशोधनों के परिवर्तन को ओओसीइट एनीप्लोइडी 18 , 24 , 25 की शुरुआत में संभव तंत्र के रूप में प्रस्तावित किया गया है। ट्रिपल फ्लोरोसेंट का दाग का उपयोग करना, मेयियोटिक स्पिंडल को कल्पना और मापना और ठंड-छिपे हुए गुणसूत्रों का निरीक्षण करना संभव था। उसी समय, एंटीबॉडी के विकास के लिए धन्यवादविशिष्ट अवशेषों को संशोधित करने के लिए, एच 4 के 16 के एसिटिलेशन स्तर को उसी नमूने पर लिया गया था। इस दृष्टिकोण ने विश्लेषण के लिए आवश्यक oocytes की मात्रा को कम करने और धुरी के आकृति विज्ञान के साथ एच 4 एसिटिलेशन को सम्मिलित करने के दोहरे उद्देश्य को पेश किया था।

पश्चिमी ब्लोट द्वारा सहसंयोजक प्रोटीन संशोधनों की मात्रा का ठहराव किया जा सकता है। हालांकि, इस तकनीक के लिए बड़े नमूने आकार की आवश्यकता होती है और रूपात्मक अध्ययनों के लिए नमूना की अखंडता को संरक्षित नहीं करता है। ट्रिपल फ्लोरोसेंट स्टैनिंग दृष्टिकोण को अन्य हिस्टोइन संशोधनों के लिए और संभावित रूप से, किसी भी प्रोटीन को लागू किया जा सकता है जिसे कि विभिन्न माध्यमिक एंटीबॉडी द्वारा पहचाना जा सकता है 8 ; केवल सीमित कारक घोड़े की विशिष्ट एंटीबॉडी की उपलब्धता है इस संदर्भ में, लेखक आशा करते हैं कि घोड़े के मॉडल पर ध्यान केंद्रित करने से इस प्रजाति में बुनियादी जैविक तंत्र की जांच में रुचि बढ़ेगी, और इसलिए, डेवलम मेंसमर्पित उपकरण का एएनटी

अंत में, रिवर्स ट्रांसक्रिप्शन और मात्रात्मक-पीसीआर (क्यू-पीसीआर) द्वारा आयोजित हास्टोन डेकेटेलीज़ (एचडीएसी) और एसिटील-ट्रांस्फ़ेक्शन (एचएटी) के लिए कोडिंग के एमआरएनए का अभिव्यक्ति अध्ययन भी वर्णित है। क्यू-पीसीआर एक मोटे तौर पर प्रसार तकनीक है; हालांकि, घोड़े के oocytes के लिए इसका उपयोग फैलाना नहीं है। यह निर्दिष्ट करना आवश्यक है कि, ओकोटाई परिपक्वता के दौरान ट्रांसक्रिप्शनल गतिविधि की सामान्य चुप्पी के कारण 29 , कुल प्रतिलेख राशि का विश्लेषण केवल इस पृष्ठभूमि 30 , 31 में एमआरएनए स्थिरता या गिरावट को प्रकट कर सकता है। इन विट्रो और विवो परिपक्वता के बीच के प्रतिलेखों की सापेक्ष अभिव्यक्ति में अंतर नहीं देखा गया। इन निष्कर्षों से संकेत मिलता है कि अनुवादक और बाद के अनुवादक नियमों को आईवीएम द्वारा प्रभावित किया जा सकता है, जो कि अन्य प्रयोगात्मक दृष्टिकोणों के विकास की आवश्यकता को इंगित करता है जिसका उद्देश्य अनुवादकीय और पुलिस की जांच करना है।एकल-सेल स्तर पर सेंट-ट्रांसजेशनल मेकेनिज्म।

कुल मिलाकर, वर्तमान अध्ययन में morphologically और biochemically घोड़े oocytes विशेषताएँ के लिए एक प्रयोगात्मक दृष्टिकोण का वर्णन करता है। इस दृष्टिकोण को अन्य प्रजातियों के oocytes पर लागू किया जा सकता है जो मनुष्यों या लुप्तप्राय प्रजातियों सहित कम वसूली दर से इसी तरह प्रभावित होते हैं। ये अध्ययन स्तनधारी प्रजनन जीव विज्ञान के हमारे ज्ञान का विस्तार करेगा और बांझपन की हमारी समझ में योगदान करेगा।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

लेखकों को लेजर स्कैनिंग confocal माइक्रोस्कोपी (एलएससीएम) , और फिलिप बैरियर और थियरी ब्लार्ड के साथ दैनिक अल्ट्रासाउंड डिम्बग्रंथि स्कैनिंग और एचसीजी इंजेक्शन के प्रदर्शन के लिए Fabrice Vincent का समर्थन करना चाहूंगा। यह काम "क्षेत्रीय सर्जेन्गा और क्षेत्रीय लोम्बार्डिया" परियोजना "पूर्व ओवो ओम्नीया" (अनुदान संख्या 260 9 6200 से एएमएल तक) में भाग में समर्थित था; "ल 'ओरियल इटालिया प्रति ली डोंने ई ला सिसिना 2012" फेलोशिप (अनुबंध 2012 से एफएफ), एफपी 7-पीपुले-2011-सीआईजी, रिसर्च एक्जिक्यूटिव एजेंसी (आरईए) "प्रो-ओवम" (अनुदान सं। 303640 से वीएल); और यूरोपीय सामाजिक निधि, मानव संसाधन विकास 2007-2013 के लिए क्षेत्रीय संचालन कार्यक्रम (संविदा संख्या POSDRU / 89 / 1.5 / एस / 62371 आईएम के लिए) द्वारा सह-वित्तपोषित कृषि और पशु चिकित्सा चिकित्सा के पोस्टडोक्लोरल स्कूल द्वारा। इन्स्टिट्यूट फ़्रान्सीसी डु चावल एट डे ल्यू इक्विटेशन द्वारा विवो ऑओसाइट संग्रह में वित्तपोषित किया गया था।

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
क्रोमोजोम अलगाव का विश्लेषण, हिस्टोन एसिटिलेशन, और स्पिंडल मोर्फ़ोलॉजी इन हॉर्स ओक्साइट्स
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter