Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Analisi della segregazione dei cromosomi, acetilazione istonica e morfologia del mandrino nei cavalli ovociti

doi: 10.3791/55242 Published: May 11, 2017

Summary

Questo manoscritto descrive un approccio sperimentale per caratterizzare morfologicamente e biochimicamente i ovociti dei cavalli. In particolare, il presente lavoro illustra come raccogliere oociti di cavalli immaturi e maturi mediante raccolta di ovuli guidati da ultrasuoni (OPU) e come indagare la segregazione del cromosoma, la morfologia del mandrino, l'acetilazione degli istoni globali e l'espressione di mRNA.

Abstract

Il campo della riproduzione assistita è stato sviluppato per trattare l'infertilità in donne, animali da compagnia e specie in pericolo. Nel cavallo, la riproduzione assistita consente anche la produzione di embrioni da parte di artisti di alto livello senza interrompere la loro carriera sportiva e contribuisce ad aumentare il numero di puledri provenienti da greggi di alto valore genetico. Il presente manoscritto descrive le procedure utilizzate per la raccolta di ovociti immature e mature da ovari a cavallo mediante prelevamento di ovuli (OPU). Questi oociti sono stati poi usati per indagare l'incidenza di aneuploidy adattando un protocollo precedentemente sviluppato nei topi. In particolare, i cromosomi ei centrometi di oociti metafase II (MII) sono stati etichettati in fluorescenza e contati su piani focali sequenziali dopo la scansione a microscopio laser confocale. Questa analisi ha rivelato una maggiore incidenza nel tasso di aneuploidy quando ovociti immature sono stati raccolti dai follicoli e maturati in vitro rispetto aIn vivo. Immunostaining per tubulin e la forma acetilata di istone 4 a residui di lisina specifici hanno anche rivelato differenze nella morfologia del mandrino meiotico e nel modello globale di acetilazione istone. Infine, l'espressione di mRNA che codificano le deacetilasi dell'istone (HDACs) e acetil-transferasi (HAT) è stata studiata mediante trascrizione inversa e PCR quantitativa (q-PCR). Nessuna differenza nell'espressione relativa dei trascritti è stata osservata tra ovociti maturi in vitro e in vivo . In accordo con un silenziamento generale dell'attività trascrizionale durante la maturazione di oociti, l'analisi della quantità totale di trascritti può rivelare solo la stabilità o la degradazione della mRNA. Pertanto, questi risultati indicano che potrebbero essere interessate altre normative traslazionali e post-traduzionali.

Nel complesso, il presente studio descrive un approccio sperimentale che caratterizza morfologicamente e biochimicamente l'ovocita dei cavalli, una ceLl tipo che è estremamente impegnativo da studiare a causa della scarsa disponibilità di campioni. Tuttavia, può espandere le nostre conoscenze sulla biologia riproduttiva e sulla sterilità in specie monovulatorie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Una vasta gamma di tecniche di riproduzione assistita è stata sviluppata per trattare l'infertilità in donne, animali da compagnia e specie in pericolo. Una delle procedure più comuni nelle impostazioni cliniche è il recupero di oociti di fase metafase II (MII) dai follicoli ovarici mediante aspirazione transvaginale guidata da ultrasuoni, prelevamento ovulo (OPU) 1 . Questi oociti vengono poi fecondati in vitro (IVF), con gli embrioni risultanti impiantati in un utero ricevente. Gli oociti di fase MII (maturi) vengono recuperati a seguito della somministrazione di gonadotropine esogene. Tuttavia, questo trattamento è associato, in alcuni pazienti, allo sviluppo di sindrome da iperstimolazione ovarica (OHSS) 2 .

Sfruttando la capacità intrinseca di ovociti immature (GV-stage) completamente coltivati ​​a riprendere spontaneamente la meiosi una volta isolata dai loro follicoli, è possibile ottenere oociti maturi senza somministrazioneGonadotropina 3 . Questa procedura è chiamata oocyte in vitro maturazione (IVM) e rappresenta un approccio meno drogato, meno costoso e più paziente per la tecnologia riproduttiva assistita. Tuttavia, il successo dello sviluppo degli embrioni con ovociti in vitro è generalmente inferiore a quello con oociti maturi in vivo 4 , 5 . Una possibile spiegazione è che gli ovociti maturi in vitro sono maggiormente colpiti da errori nella segregazione del cromosoma e l'aneuploidy risultante compromette lo sviluppo embrionale normale 6 .

La comprensione della base molecolare della mis-segregazione cromosomica durante l'IVM potrebbe infine fornire il pieno potenziale di questa tecnica. In questo senso, l'approccio sperimentale utilizzato per indagare le caratteristiche morfologiche e biochimiche degli oociti in vitro, confrontati con la maturazione in vivoEd oociti qui descritti sono 7 , 8 . In particolare, le procedure per l'OPU di ovociti immature e mature e l'IVM di ovociti immature sono illustrati utilizzando cavalli adulti e ciclisti naturalmente come modello sperimentale. Allora, l'immunofluorescenza e l'analisi delle immagini vengono utilizzati per studiare la segregazione del cromosoma, la morfologia del mandrino e il modello globale dell'acetilazione dell'istone su questi gameti. Infine, un protocollo di trascrizione inversa e PCR quantitativo è descritto per l'analisi dell'espressione mRNA.

Rispetto ai modelli animali roditori, i cavalli non consentono manipolazione genetica, sono meno facili da manipolare e richiedono una costosa manutenzione. Tuttavia, questo modello sta guadagnando un notevole interesse per lo studio della maturazione delle ovaie 9 , 10 a causa della somiglianza con la fisiologia ovarica umana 11 , 12 </ Sup>. Inoltre, lo sviluppo di protocolli affidabili di IVM-IVF nel cavallo ha un notevole interesse economico, in quanto consentirebbe un aumento del numero di puledri da greggi di alto valore genetico.

Una delle limitazioni di effettuare esperimenti su oociti, in particolare nelle specie monovulatorie, è la disponibilità limitata del campione. Questo limite è stato superato qui regolando un approccio, precedentemente sviluppato nei topi, a oociti di cavalli 13 , 14 per effettuare il conteggio dei cromosomi che minimizza la perdita di campioni (vedere la discussione per un confronto con altre tecniche disponibili). Inoltre, è stato ottimizzato un protocollo di colorazione a triplo fluorescenza per condurre analisi multiple sullo stesso campione e le analisi q-PCR sono state eseguite solo su piscine di 2 oociti.

Nel complesso, il presente studio descrive un approccio sperimentale mirato a morfologicamente e biochimicamente chaRacterize l'oocyte di cavallo, un tipo di cellule che è estremamente impegnativo da studiare a causa della bassa disponibilità del campione. Tuttavia, può espandere la nostra conoscenza della biologia riproduttiva e della sterilità delle specie monovulatorie.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutte le procedure sono state approvate dal comitato per la cura e l'uso degli animali CEEA Val de Loire numero 19 e sono state eseguite in conformità ai principi guida per la cura e l'uso degli animali da laboratorio.

1. Raccolta di Oocyte e maturazione in vitro

  1. Raccolta di ovuli
    1. Daily valutare per ultrasuoni il diametro dei follicoli ovarici in una coorte di marne adulte. Alla comparsa di un follicolo ≥33 mm (follicolo dominante), inietta la cavalla con 1.500 UI di gonadotropina corionica umana (hCG) nella parte superiore della vena jugulare (iv).
      1. Prima di effettuare l'iniezione, tamponare l'area con l'alcool, individuare il solco giallo e posizionare il pollice 2-3 cm sotto il sito di iniezione per indurre la vena a salire. Inserire l'ago quasi parallelo al collo e aspirare per assicurarsi che l'ago sia nella vena (il sangue entrerà nella siringa). A questo punto, iniettare; HCG indurirà la mAtura del oocito nel follicolo dominante.
    2. 35 h dopo l'iniezione hCG, sedano la mare con detomidina (15 μg / kg iv), butorfanolo tartrato (10 μg / kg iv) e bromuro di butilscopolamina (0,2-0,3 mg / kg, 15 ml / mare, iv).
    3. Collegare l'ago alla sonda ad ultrasuoni. Inserire la sonda ad ultrasuoni vaginale e tenere la ovaia trasversalmente per affrontare la sonda ad ultrasuoni. Indica un operatore per manovrare l'ago e l'altro per tenere l'ovario in posizione, con il follicolo di fronte alla sonda ad ultrasuoni . Inizia dall'ovario con il follicolo dominante.
    4. Puntare la parete vaginale e la parete del follicolo dominante con l'ago (le sonde a ultrasuoni per OPU sono dotate di un canale per l'ago collegato ad un sistema di aspirazione); Theneedle sarà visibile nell'immagine ecografica.
    5. Aspirare il fluido follicolare in un tubo conico da 50 mL collegato al sistema di aspirazione. Versare il contenuto del conoTubo in un grande piatto di Petri e cercare il complesso cumulo-oocyte (COC) usando uno stereomicroscopio.
    6. Dal momento che il COC non viene sempre recuperato con il fluido follicolare, scorrere il follicolo con la soluzione di Dulbecco modificata con tampone fosfato (DPBS) contenente 5 IU / mL di eparina a 37 ° C. Esaminare DPBS per la presenza di COC, come precedentemente descritto per il liquido follicolare nel punto 1.1.5. Scorrere più volte fino a quando il COC viene recuperato.
    7. Una volta che il COC dal follicolo dominante viene recuperato, puntare e scuotere i follicoli ≥5 e ≤25 mm, come descritto per il follicolo dominante nei passaggi 1.1.3-1.1.4; I follicoli ≥5 e ≤25 non esprimono l'ormone luteinizzante / recettore di choriogonadotropina (LHCGR) e quindi i loro oociti non maturano in risposta a hCG e verranno raccolti a livello di GV (immaturo). Soltanto mantenere COC con diversi strati completi di cellule cumuli e marrone, finemente granulato ooplasma. Scartare gli altri.
    8. Alla fine dell'OPU, inLa mare con benzil-penicillina 15.000 UI / animale per prevenire l'infezione.
    9. Casa la mare in una tranquilla e pulita stabile per almeno 2 ore. Controllare i segni della consapevolezza determinando la posizione delle orecchie, la reazione agli stimoli ( ad esempio, il rumore) e l'andatura prima di tornare alla mare di compagnia di altri animali.
  2. Maturazione in vitro
    1. TCM199 tamponato HEPES caldo (20 mM Hepes) aggiunto a 1,790 IU / L di eparina, 0,4% di albumina bovina serba (BSA), penicillina e streptomicina a 37 ° C. Preparare questo supporto in anticipo. Filtro-sterilizzare e mantenerlo a 4 ° C per un massimo di 6 mesi.
    2. Preparare il mezzo IVM integrando TCM199 (25 mM NaHCO3) con NaHCO 3 con 50 ng / ml fattore di crescita epidermico (EGF) e 20% siero di vitello 7 . Utilizzare NaHCO 3 -fferrato TCM199 entro 3 settimane dall'apertura di una nuova bottiglia. Preparare il FEG in anticipo come scorte 100x, congelarlo a -20 ° C, E utilizzarlo entro 6 mesi. Dispensare 500 μL nei pozzetti di un piatto da 4 pozzetti e incubare in aria umidificata con 5% di CO 2 a 38,5 ° C per almeno 2 ore.
    3. Dopo il recupero dei COC dai follicoli ≥5 e ≤25 mm, metterli in un piatto di petri (diametro 3,5 cm) riempito con 2 mL di HEPES-TCM199. Spostare i COC in diverse aree del piatto per lavare i detriti cellulari.
    4. Trasferire i COC al mezzo IVM e incubare per 28 h in aria umidificata con 5% CO 2 a 38,5 ° C.

2. Immunofluorescenza e analisi delle immagini

  1. Conteggio del cromosoma
    1. Dopo la raccolta dal follicolo dominante o alla fine di IVM, incubare i COC con monastrillo da 100 μM per 1 h in aria umidificata con 5% di CO 2 a 38,5 ° C. Preparare monastrol in anticipo come scorte 100x e conservarlo a -20 ° C per un anno.
    2. Rimuove le coppie di cumuloTrattandoli con ialuronidasi del 0,5% o pipettando delicatamente; Rimuovere la zona pellucida trattandola in 0,2% di proprietà. Preparare ialuronidasi e pronasi in anticipo come scorte 10x e conservarle a -20 ° C per un periodo di 1 anno.
    3. Fissare gli oociti in 4% di paraformaldeide in DPBS per 15 minuti a 38,5 ° C seguito da altri 45 minuti a 4 ° C.
      ATTENZIONE! Indossare equipaggiamento protettivo personale durante la manipolazione di paraformaldeide e smaltire materiali contaminati in conformità con le linee guida per lo smaltimento dei rifiuti pericolosi.
    4. Lavare gli oociti trasferendo sequenzialmente in 3 pozzetti riempiti di 500 μL di DPBS integrati con 0,1% di alcool polivinilico (PVA). Permeabilizzare in 0,3% Triton X-100 per 10 minuti a temperatura ambiente (RT).
    5. Bloccare l'incubazione non specifica del binding in DPBS completata con 1% di albumina bovina serba (DPBS-1% BSA) e 10% di siero normale asino per almeno 30 minuti a RT. I campioni possono essere conservati in soluzione bloccante a 4 ° C per 3-4 giorni.
    6. Per la colorazione primaria, incubare gli oociti in anti-Aurora B fosfato-Thr232 coniglio con DPBS integrato con 1% BSA (diluizione 1:50) a 4 ° C per una notte.
    7. Lavare gli oociti come descritto nel punto 2.1.4. Incubare gli oociti in una soluzione di IgG anti-coniglio (1: 100 in DPBS-1% BSA) di isotiocianato tetra-metilrhodamina (TRITC) -conjugato per 1 h a RT al buio.
    8. Lavare gli oociti come descritto nel punto 2.1.4 e quindi posizionare 3-4 oociti in una goccia di supporto di montaggio anti-indurimento anti-indurimento integrato con 20 μM YOPRO1 su uno scivolo in vetro. Ripetere la procedura fino a quando tutti gli oociti sono montati (3-4 oociti per diapositiva).
    9. Lasciare che gli oociti si stabiliscano per circa 10 minuti nel supporto di montaggio, quindi copriscano con un coperchio. Per evitare di schiacciare gli ovociti, applicare due strisce di nastro biadesivo prima di posare la copertura sullo scivolo in vetro.
      NOTA: Questa precauzione garantirà anche che tutti i campioni siano ugualmente compressi tra il vetro di vetroDe e la coverlip. Le diapositive in vetro possono essere congelate a -20 ° C e imaged durante i 2-3 giorni successivi.
    10. Immagini i campioni su un microscopio confocale a scansione laser con un obiettivo 60X usando i canali rossi (centromeres) e quelli verdi (cromosomi) 7 , 13 , 14 , 20 , 21 . Esaminare i campioni che attraversano l'intera piastra metafisica sull'asse z, con gradini ogni 0,35 μm. Salva le immagini digitalizzate di ogni singolo piano.
    11. Contare i centromeres in sezioni confocali di serie usando la funzione di conteggio delle celle del software NIH ImageJ (disponibile all'indirizzo: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      NOTA: evitare un ripetuto conteggio di centromeres che appaiono nelle sezioni adiacenti identificando i centrometri che appaiono, rimangono e scompaiono in sezioni sequenziali con un codice numerico.
    12. Ripetere il co cromosomicoDisinserire nel passaggio 2.1.11 con un operatore indipendente.
      NOTA: Classificare gli oociti come euploidi (32 cromosomi), iperploidi (> 32) o ipoploidi (<32).
  2. Morfologia del mandrino e acetilazione dell'istone
    1. Dopo la raccolta dal follicolo dominante o alla fine dell'IVM, rimuovere le cellule cumulo mediante trattamento in 0,5% di ialuronidasi o con pipetta gentile, come descritto nel punto 2.1.2.
    2. Lavare gli oociti in DPBS-PVA come nel punto 2.1.4 e fissarli in paraformaldeide al 2,5% per 20 minuti a 38 ° C. Lavare intensamente, come descritto nel punto 2.1.4, e permeabilizzare in 0,1% di Triton X-100 per 5 minuti a RT.
      NOTA: Indossare dispositivi di protezione individuale durante la manipolazione di paraformaldeide e smaltire i materiali contaminati in conformità con le linee guida per lo smaltimento dei rifiuti pericolosi.
    3. Blocco di incubazione non specifica in DPBS con complemento di albumina bovina serba del 2% (DPBS - 2% BSA), 0,05% saponina e 10% di siero normale di asinaR 2 ore a RT.
      NOTA: I campioni possono essere conservati in soluzione bloccante a 4 ° C per 3 - 4 giorni.
    4. Per la colorazione primaria, incubare l'oocyte in mouse anti-alfa-tubulina (1: 150) e coniglio anti-acH4K16 (1: 250) in DPBS-2% BSA con 0,05% di saponin a 4 ° C durante la notte.
    5. Lavare gli oociti come nel punto 2.1.4. Incubare gli oociti in una soluzione di IgG anti-mouse IgG (1: 500) con gomma coniugata fluorescente fluorescente verde e IgG anti-coniglio (1: 100) conica con TRITC in DPBS-2% BSA con 0,05% saponin per 1 ora RT nel buio.
    6. Lavare gli oociti come indicato al punto 2.1.4 e quindi posizionare 3-4 oociti in una goccia del mezzo di montaggio non anticarico e anti-sbiadito integrato con 1 μg / mL 4 ', 6-diammino-2-fenilindolo (DAPI) Su una lastra di vetro.
    7. Montare gli oociti sulle diapositive di vetro come descritto nel punto 2.1.8.
    8. Immagini i campioni su un microscopio confocale a scansione laser con un obiettivo 60x utilizzando i canali rossi (acH4K16), verde (alfa-tubulina) e blu (DNA).
      NOTA: mantenere costanti le impostazioni del laser per i canali rossi e blu durante l'acquisizione di tutti i campioni. Esaminare i campioni che attraversano l'intero mandrino meiotico e la piastra metafisica sull'asse z, con gradini ogni 0,35 μm. Salvare le immagini digitalizzate (piani singoli e immagini 3D proiettate).
    9. Misurare la lunghezza del mandrino polo a polo e il diametro del mandrino alla larghezza massima dell'immagine proiettata utilizzando la funzione di misura del software NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Ripetere ogni 3 volte e calcolare la media.
    10. Quantificare la relativa fluorescenza di acH4K16 usando la funzione di densità integrata del software NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normalizzalo per la densità integrata della colorazione DAPI.

3. Analisi dell'espressione di mRNA

  1. Dopo che i COC sono stati recuperati dai follicoli da 5 a 25 mm, raccogliere la cellula granulosaChe rimase nel piatto di Petri e lavi due volte in DPBS freddo centrifugando a 10.600 xg per 2 minuti. Congelare in azoto liquido. Conservare i campioni a -80 ° C per un massimo di 6 mesi; Le cellule serviranno per la curva standard.
  2. Rimuovere con cautela tutte le cellule cumulo, come descritto nel punto 2.1.2, da immature (GV), in vitro mature e da oociti maturi in vivo .
  3. Lavare gli oociti, come descritto al punto 2.1.4, in DPBS-PVA, raccogliendoli singolarmente in volumi di 1 μL e superare 2 μL RNALater. Snap-freeze in azoto liquido. Conservare i campioni a -80 ° C per un massimo di 6 mesi.
  4. Aggiungere 2 pg di RNA di Luciferasi a ciascun campione come uno spike-in. Raccogliere gli oociti 2 x 2 e estrarre l'RNA totale usando un kit a base di filtri a membrana di silice, idoneo a recuperare RNA da piccoli campioni.
  5. Reverse-trascriva l'RNA in 10 μL con esame casuale di 0,25 μg e la trascrizione trasversa inversa del virus di leucemia Moloney di topo per 1 h a 37 & 176; C. Conservare i campioni a -20 ° C per un massimo di 6 mesi.
  6. Diluire il cDNA dalle cellule granulose in acqua libera da RNAse a 50 ng / μL. Diluire serialmente questa soluzione 1:10 per ottenere 5 ng / μL, 0,5 ng / μL, 0,05 ng / μL e 0,005 ng / μL soluzioni.
  7. Riunire le reazioni in triplice quantità in un volume totale di 20 μL per reazione utilizzando cDNA equivalente a 0,05 oociti come substrato o 5 μL delle diluizioni seriali del cDNA di cellule granulose, 10 μL di supermix verde verde SYBR e 0,3 μM di ciascun primer specifico ( Tabella 1 ).
  8. Eseguire la reazione in un ciclotermico utilizzando un protocollo a tre fasi: 95 ° C per 30 s, 60 ° C per 30 s e 72 ° C per 20 s, ripetuti 40 volte. Infine, acquisite la curva di fusione, a partire da 60 ° C, e aumentate la temperatura di 0,5 ° C ogni 20 s fino a 95 ° C.
  9. Valutare la quantità di partenza (SQ) dell'MRNA specifico nei campioni di oociti utilizzando la curva standardF "> 15 calcolato sulla base del campione di cellule granulosa Esprimere i dati come rapporto tra il SQ del gene di interesse e gli SQ dei geni di mantenimento.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I risultati originali di questi esperimenti sono stati descritti in profondità in precedenza 7 e sono riportati qui come un esempio di risultati che possono essere ottenuti utilizzando i protocolli descritti.

Tasso di maturazione

Dei 32 COC recuperati da OPU da follicoli dominanti, 28 (88%) erano allo stadio MII. Quattordici dei 58 COC raccolti da follicoli di dimensioni da 5 a 25 mm sono stati immediatamente congelati come ovociti immaturi per lo studio di espressione di mRNA. I rimanenti 44 sono stati maturati in vitro e 37 hanno raggiunto la fase MII (85%). L'efficacia della maturazione non era significativamente diversa nei due gruppi (esame esatto di Fisher P> 0,05).

Tasso di Aneuploidy

Al fine di studiare se IVM caN perturbare la divisione cromosomica fedele tra l'oocito secondario e il primo corpo polare, è stato conteggiato il numero di cromosomi allo stadio MII, in quanto rappresenta il risultato della segregazione cromosomica durante la meiosi I. Come mostrato nella Figura 1A , l'anti-Aurora B L'anticorpo fosfo-Thr232 ha specificamente macchiato la regione centromerica in ovociti di cavalli, permettendo di contare il numero di cromosomi. Gli ovociti maturi in vitro sono stati significativamente più colpiti da aneuploidy (5/11) rispetto agli ovociti maturi in vivo (0/12; esame esatto di Fisher, P <0.05; Figura 1B ). La maggior parte degli ovociti aneuploidi (4/5) erano iperploidi; Pertanto, il tasso di aneuploidy non deriva da manufatti nella preparazione del campione che determina la perdita cromosomica, come avviene con gli spread cromosomici. L'immunostaining della regione centromerica è stata anche tentata con gli anticorpi anti-CENPA e anti-AURKB, ma nessun segnale è stato visUalizzato in entrambi i casi (dati non mostrati).

Morfologia del mandrino e acetilazione di H4K16

La lunghezza del mandrino polo a palo e il diametro del mandrino alla larghezza massima sono stati misurati, come illustrato nella figura 2 . Secondo queste misurazioni, le ovociti in vitro erano significativamente più lunghe (19,89 ± 1,15 μm) e più ampie (17,28 ± 0,81 μm) rispetto agli ovociti maturi in vivo (14,57 ± 1,7 μm di lunghezza e 13,56 ± 0,91 μm di diametro; -test, P <0,05). Negli stessi campioni è stato anche misurato il livello globale di acetilazione di H4K16, confermando che l'acetilazione a H4K16 era significativamente più bassa nei oociti IVM rispetto alle loro controparti in vivo ( figura 2 , rosso).

Espressione di tranScript che codificano le acetiltransferasi e le deacetilasi dell'istone

Se l'espressione di geni coinvolti nel processo di acetilazione-deacetilazione dell'istone fosse alterata in ovociti in vitro maturati è stata studiata da q-PCR. Sono stati individuati bersaglio preposto come istante acetil-transferasi 1 ( HAT1 ), K-acetiltransferasi 8 (KAT8 ), istone deacetilasi 1 ( HDAC1 ) e proteina de-acetilasi SAD1 dipendente da NAD ( SIRT1 ). Non sono state osservate significative differenze nell'espressione di questi trascrizioni in ovociti maturi in vitro e immature in vivo , indipendentemente dalla normalizzazione utilizzata. In particolare, i risultati dell'analisi di espressione di trascrizione riportati in Figura 3 sono stati calcolati contro una curva standard utilizzando il metodo SQ e normalizzato per la pulizia della gliceraldehide-3-fosfato deidrogenasi ( GAPDH ). Allo stesso modo, no diffeRenze sono state osservate quando i risultati sono normalizzati per il picco in luciferasi o quando è stato utilizzato il metodo ΔΔct (non mostrato).

Bersaglio Primer Fw Primer Rv Amplicon dimensioni
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
hat1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
luciferasi TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tabella 1: Setail primer. La sequenza 5 '> 3' dei primer in avanti (Fw) e (Rv) e la dimensione dell'amplicone prevista sono fornite per ciascuna transcrizione analizzata: gliceraldehide-3-fosfato deidrogenasi ( GAPDH ) , istone acetil-transferasi 1 ( HAT1 ) Deacetilasi 1 ( HDAC1 ) , K-acetiltransferasi 8 ( KAT8 ) , luciferasi e proteina de-acetilasi sirtuina 1 ( SIRT1 ) dipendente dal NAD. Ristampato con permesso di riferimento 7 .

/55242fig1.jpg "/>
Figura 1: Aneuploidy Rate in ovociti a cavallo in vitro e in vitro . ( A ) Rappresentative che mostrano la colorazione di aurora B fosfo-Thr232 (rosso) e DNA (verde) di un oocyte di cavallo MII, trattato con monastrol. Viene mostrato un oocito euploideo (32 cromosomi). Barra di scala = 5 μm. ( B ) Il grafico a barre rappresenta la distribuzione di oociti di euploidi e aneuploidi MII in in vivo (n = 12) e in vitro (n = 11) oociti maturi. * Indica una differenza significativa nel tasso di aneuploidy (esame esatto di Fisher, P <0,05). Ristampato con l'autorizzazione di riferimento 7. Clicca qui per visualizzare una versione più grande di questa figura.

figura 2 Figura 2: Misura del mandrino e acetilazione H4K16 in ovociti a cavallo in vitro e in vitro . Le immagini rappresentative mostrano tubulina (verde), acetato H4K16 (rosso) e DNA (blu) nei oociti MII dopo maturazione in vivo (n = 4) o in vitro (n = 14). Le immagini tubulin mostrano gli assi utilizzati per le lunghezze del mandrino e le misure di diametro. Barra di scala = 5 μm. Modificato dal riferimento 7 . Clicca qui per visualizzare una versione più grande di questa figura.

Figura 3
Figura 3: Espressione di KAT8 , SIRT1 , HAT1 , E HDAC1 in ImmatuRe, In Vivo , E Oociti maturi in vitro . I grafici a barre rappresentano la media ± SEM dell'espressione mRNA relativa di KAT8 , SIRT1 , HAT1 , E HDAC1 , Espresso come quantità di partenza (SQ) della trascrizione di interesse rispetto al SQ di GAPDH , utilizzato come pulizia. Non sono state osservate differenze statistiche tra oociti maturi (VV, n = 14), in vivo (n = 14) e in vitro (n = 12) maturati (ANOVA unidirezionale, P > 0,05). Ristampato con permesso di riferimento 7 . Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Anche se l'IVM è stato eseguito in cavalli per più di 20 anni 16 , non sappiamo ancora se l'oocyte possa essere l'origine dell'aneuploidy embrionale, come è stato proposto per l'uomo17. La ragione è probabilmente che la preparazione di spread di oociti per il conteggio dei cromosomi comporta una notevole perdita di campioni. Tenuto conto di questo, è stata condotta un'indagine sui metodi utilizzati per indagare gli errori nella segregazione dei cromosomi per cercare la tecnica più appropriata da applicare agli ovociti di cavalli. Nella letteratura scientifica sono state riscontrate quattro tecniche principali: 1) diffusioni cromosomiche 5 , 18 , 19 , 2) centromere conteggio su centrifughe monastrol-collapsed (FISH) 4 , 6 , 17 , 20 , , 14 , 21 , 22 e 4) colorazione cromosoma fluorescenza senza conteggio cromosomico 23 , 24 , 25 .

Come già accennato, la preparazione di diffusioni cromosomiche seguita dalla colorazione di Giemsa è complicata da un elevato tasso di perdita di campioni. Questo metodo è stato sostituito in molti casi da FISH, che utilizza sonde specifiche per mappare i diversi cromosomi. Un inconveniente delle tecniche FISH è che quando si utilizza un piccolo numero di sonde, l'incidenza di un falso negativo può aumentare ( cioè individuando come una normale cellula aneuploida perché il cromosoma mancante o supernumerario non è stato sondato). L'uso affidabile del FISH è perciò fondato in gran parte sulla conoscenza a priori dei cromosomi che sono più frequentemente colpiti da aneuploidy ( es.., Cromosoma 21 nell'uomo). FISH è stato precedentemente utilizzato per studiare le anomalie cromosomiche in embrioni di cavallo usando 2 sonde, contro il cromosoma 2 e il cromosoma 4 20 . Secondo questi esperimenti, i nuclei degli embrioni prodotti in vitro hanno maggiori probabilità di essere influenzati da anomalie cromosomiche rispetto agli embrioni prodotti in vivo . Questa scoperta è d'accordo con l'osservazione sopra riportata usando il metodo di collasso monastrino in ovociti IVM. Tuttavia, l'incidenza di aneuploidy negli oociti IVM è stata anche superiore a quella riportata utilizzando FISH in embrioni 20 prodotte in vitro . Questa discrepanza parziale può essere spiegata dal fatto che solo due sonde cromosomiche specifiche sono state utilizzate per gli esperimenti di FISH. Questo approccio potrebbe aver sottovalutato l'incidenza di aneuploidy che coinvolgono altri cromosomi, specialmente quando si considera che i cavalli hanno 32 cromosomi. Tuttavia, non si può escludere che grave aneuLe ploidie rilevabili negli oociti non vengono mantenute negli embrioni perché i gameti colpiti da anomalie genetiche critiche potrebbero non svilupparsi ulteriormente.

La combinazione di trattamento monastrino, cromosoma e colorazione di centromere e microscopia confocale consentiva un conteggio coerente del numero di cromosomi negli oociti di cavallo in fase MII con una minima perdita di campioni. La limitazione tecnica incontrata nello sviluppo di questa tecnica per ovociti di cavalli è stata la disponibilità di anticorpi specifici del cavallo. Prima di usare Aurora B fosforo (Thr232), due altri anticorpi (anti-Aurora B e anti-CENPA) non hanno prodotto una macchia centromerica. In particolare, l'anti-Aurora B e l'anti-CENPA sono già stati utilizzati con successo nelle cellule bovine e umane 26 , 27 , 28 ; Pertanto, si è concluso che non erano specifici per il cavallo. Questa tecnica può anche essere limitata dalla disponibilità di un laser confocale scAnnegando il software per l'analisi di immagini e microscopi. Inoltre, il conteggio cieco da parte di due operatori indipendenti è essenziale per escludere gli artefatti indotti dagli operatori. Anche se il conteggio cromosomico di un mandrino crollato da monastrol è un approccio che meglio preserva la morfologia della cellula e impedisce la perdita del campione, questa tecnica consente solo di osservare le differenze nel numero di base dei cromosomi; Non è informativo su altre anomalie cromosomiche ( ad esempio, traslocazioni, scorrimenti segmentali, ecc. ) Che possono invece essere rivelati mediante karyotyping e, in alcuni casi, da FISH.

Gli errori nella segregazione del cromosoma sono stati inoltre studiati mediante l'immunofluorescenza del mandrino e del cromosoma, senza eseguire un numero cromosomico 23 , 24 , 25 . In questo caso, i mandrini con anomalie gravi e cromosomi tardivi o sparsi sono considerati segni di cromoso erraticoMi segregazione. Di conseguenza, i cromosomi che sono stati sparsi dal mandrino sono stati osservati in oociti maturi in vitro 7 (la classe che è più probabile colpita da aneuploidy). Tuttavia il conteggio cromosomico ha il vantaggio di trasmettere informazioni quantificabili.

Per riassumere, rispetto alle altre tecniche descritte, l'uso di colorazione monastrino e centromere ha il vantaggio di impedire la perdita del campione, riducendo al minimo l'incidenza di falsi negativi e di essere quantificabili.

L'alterazione delle modificazioni epigenetiche è stata proposta come un possibile meccanismo nell'insorgenza di aneuploidy ovociti 18 , 24 , 25 . Utilizzando una macchia fluorescente tripla, è stato possibile visualizzare e misurare il mandrino meiotico e osservare i cromosomi residui / dispersi. Allo stesso tempo, grazie allo sviluppo di anticorpi cheRiconoscere le specifiche modifiche del residuo, il livello di acetilazione di H4K16 è stato effettuato sullo stesso campione. Questo approccio ha servito il doppio scopo di ridurre la quantità di ovociti necessari per l'analisi e correlare acetilazione H4 con la morfologia del mandrino.

La quantificazione delle modificazioni proteiche covalenti può essere effettuata mediante Western blot. Tuttavia, questa tecnica richiede una dimensione maggiore dei campioni e non preserva l'integrità del campione per studi morfologici. L'approccio a colorazione a triplo fluorescenza può essere applicato ad altre modificazioni dell'istone e, potenzialmente, a qualsiasi proteina che possa essere riconosciuta da diversi anticorpi secondari 8 ; L'unico fattore limitante è la disponibilità di anticorpi specifici per il cavallo. In questo contesto, gli autori sperano che aumentare l'attenzione sul modello di cavallo accrescerà l'interesse per l'indagine dei meccanismi biologici di base in questa specie e quindi, nello sviluppoDi strumenti dedicati.

Infine, viene descritto anche lo studio di espressione di mRNAs che codificano le deacetilasi dell'istone (HDACs) e le acetil-transferasi (HAT) condotte mediante trascrizione inversa e PCR quantitativo (q-PCR). Q-PCR è una tecnica diffusa; Tuttavia, il suo utilizzo per ovociti di cavallo non è diffuso. È indispensabile specificare che, a causa del silenziamento generale dell'attività trascrizionale durante la maturazione del oocito 29 , l'analisi della quantità totale di trascritti può rivelare solo la stabilità o il degrado di mRNA in questo sfondo 30 , 31 . Le differenze nell'espressione relativa di trascrizioni tra la maturazione in vitro e in vivo non sono state osservate. Questi risultati indicano che la normativa translativa e post-traslatoria potrebbe essere influenzata dall'IVM, sottolineando la necessità di sviluppare altri approcci sperimentali finalizzati ad indagare la traslazione e laSt-tradizionali meccanismi a livello di singola cellula.

Nel complesso, questo studio descrive un approccio sperimentale per caratterizzare morfologicamente e biochimicamente i ovociti dei cavalli. Questo approccio può essere applicato a oociti di altre specie che sono influenzati da un basso tasso di recupero, inclusi gli esseri umani o le specie in pericolo. Questi studi ampliano la nostra conoscenza della biologia riproduttiva dei mammiferi e contribuiranno alla nostra comprensione dell'infertilità.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgments

Gli autori vorrebbero ringraziare Fabrice Vincent per il supporto con la microscopia confocale a scansione laser (LSCM) e Philippe Barrière e Thierry Blard per eseguire la scansione giornaliera di ovaie e hCG. Questo lavoro è stato sostenuto in parte dal progetto "Regione di Sardegna e Regione Lombardia" "Ex Ovo Omnia" (n. 26096200 a AML); La borsa di studio "L'Oreal Italia per la Donne e la Scienza 2012" (contratto 2012 a FF), FP7-PEOPLE-2011- CIG, Agenzia esecutiva di ricerca (REA) "Pro-Ovum" (Grant n ° 303640 a VL); E dalla Scuola post-dottorata di agricoltura e veterinaria, cofinanziata dal Fondo sociale europeo, Programma operativo settoriale per lo sviluppo delle risorse umane 2007-2013 (n. POSDRU / 89 / 1.5 / S / 62371 a IM). La raccolta inoculare in vivo è stata finanziata dall'Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analisi della segregazione dei cromosomi, acetilazione istonica e morfologia del mandrino nei cavalli ovociti
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter