Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Analyse av kromosomsegregasjon, histonacetylering og spindelmorfologi i hesteokocytter

doi: 10.3791/55242 Published: May 11, 2017

Summary

Dette manuskriptet beskriver en eksperimentell tilnærming til morfologisk og biokjemisk karakterisering av hesteocytter. Spesifikt illustrerer foreliggende arbeid hvordan å samle umodne og modne hesteocytter ved ultralydstyrt ovumopptak (OPU) og hvordan undersøke kromosomsegmentering, spindelmorfologi, global histonacetylering og mRNA-ekspresjon.

Abstract

Feltet assistert reproduksjon er utviklet for å behandle infertilitet hos kvinner, følgesvenner og truede arter. I hesten muliggjør assistert reproduksjon også produksjon av embryoer fra høyt utøvere uten å forstyrre sin idrettskarriere og bidrar til en økning i antall føll fra marer av høy genetisk verdi. Det nåværende manuskriptet beskriver prosedyrene som brukes for å samle umodne og modne oocytter fra hestestokkene ved å bruke ovum pickup (OPU). Disse oocytene ble deretter brukt til å undersøke forekomsten av aneuploidi ved å tilpasse en protokoll som tidligere ble utviklet hos mus. Spesielt ble kromosomer og sentromerer av metafase II (MII) oocytter merket fluorescens og talt på sekventielle fokalplaner etter konfokal lasermikroskop-skanning. Denne analysen viste en høyere forekomst i aneuploiditetsfrekvensen når umodne oocytter ble samlet fra folliklene og modnet in vitro sammenlignet medIn vivo. Immunostaining for tubulin og den acetylerte formen av histon 4 ved spesifikke lysinrester viste også forskjeller i den meotiske spindelens morfologi og i det globale mønsteret av histonacetylering. Endelig ble ekspresjonen av mRNA som koder for histon-deacetylaser (HDACs) og acetyltransferaser (HATs) undersøkt ved revers transkripsjon og kvantitativ PCR (q-PCR). Ingen forskjeller i det relative uttrykket av transkripsjoner ble observert mellom in vitro og in vivo modnet oocytter. I samsvar med en generell stumning av transkripsjonsaktiviteten under oocytmodning, kan analysen av total transkripsjonsmengde bare avsløre mRNA-stabilitet eller nedbrytning. Derfor viser disse funnene at andre oversettelses- og posttranslatoriske forskrifter kan bli påvirket.

Samlet beskriver den foreliggende studien en eksperimentell tilnærming til morfologisk og biokjemisk karakterisering av hesten oocyt, en ceLl skrive som er ekstremt utfordrende å studere på grunn av lav tilgjengelighet tilgjengelighet. Det kan imidlertid utvide vår kunnskap om reproduktiv biologi og infertilitet i monovulatoriske arter.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Et stort utvalg av assisterte reproduksjonsteknikker har blitt utviklet for å behandle infertilitet hos kvinner, følgesvenner og truede arter. En av de vanligste prosedyrene i kliniske innstillinger er gjenvinning av metafase II (MII) -stadieocytter fra eggstokkfollikler ved ultralydstyrt transvaginal aspirasjon, oppsamling av egg (OPU) 1 . Disse oocytene blir deretter befruktet in vitro (IVF), med det resulterende embryoet (e) implantert i en mottaker uterus. MII-trinnet (modne) oocytter hentes etter administrering av eksogene gonadotropiner. Imidlertid er denne behandlingen forbundet, hos noen pasienter, med utviklingen av ovarial hyperstimuleringssyndrom (OHSS) 2 .

Å dra nytte av den indre evne til fullvokst, umodne oocytter (GV-stadium) for spontant å gjenoppta meiosis en gang isolert fra deres follikler, er det mulig å oppnå modne oocytter uten administrasjonToning gonadotropin 3 . Denne prosedyren kalles oocyte in vitro modning (IVM) og representerer en mindre narkotikarelatert, billigere og mer pasientvennlig tilnærming til assistert reproduktiv teknologi. Suksessen med embryoutvikling med in vitro- matede oocytter er imidlertid generelt lavere enn med in vivo- modne oocytter 4 , 5 . En mulig forklaring er at in vitro- modne oocytter påvirkes mer av feil i kromosomsegregasjon, og den resulterende aneuploidien forringer normal embryonisk utvikling 6 .

Å forstå den molekylære basisen for kromosomal mis-segregering under IVM, vil i siste instans avsløre det fulle potensialet i denne teknikken. I denne vene brukte den eksperimentelle tilnærmingen til å undersøke de morfologiske og biokjemiske egenskapene til in vitro- matede oocytter sammenlignet med in vivo matEd oocytter er her beskrevet 7 , 8 . Spesielt er prosedyrene for OPU av umodne og modne oocytter og IVM av umodne oocytter illustrert ved hjelp av voksne og naturlig sykler som en eksperimentell modell. Deretter brukes immunfluorescens og bildeanalyse for å undersøke kromosomsegmentering, spindelmorfologi og det globale mønsteret av histonacetylering på disse gametene. Endelig er en protokoll for revers-transkripsjon og kvantitativ PCR beskrevet for analysen av mRNA-ekspresjon.

Sammenlignet med gnagerdyrmodeller, tillater ikke hester genetisk manipulering, er det mindre lett å manipulere, og krever dyrt vedlikehold. Imidlertid får denne modellen stor interesse for studiet av oocytmodning 9 , 10 på grunn av likheten til menneskelig ovariefysiologi 11 , 12 </ Sup>. Videre har utviklingen av pålitelige protokoller for IVM-IVF i hesten en betydelig økonomisk interesse, da det ville muliggjøre en økning i antall føll fra marer av høy genetisk verdi.

En av begrensningene for å utføre eksperimenter på oocytter, spesielt i monovulatoriske arter, er begrenset prøve tilgjengelighet. Denne grensen er overvunnet her ved å justere en tilnærming, tidligere utviklet hos mus, til hestocytene 13 , 14 for å utføre kromosometelling som minimerer prøveutfallet (se diskusjonen for en sammenligning med andre tilgjengelige teknikker). Videre er en trippel-fluorescensfargingsprotokoll optimalisert for å utføre flere analyser på samme prøve, og q-PCR-analyser ble utført bare på bassenger med 2 oocytter.

Samlet beskriver den foreliggende studien en eksperimentell tilnærming rettet mot morfologisk og biokjemisk chaRacterize hesten oocyte, en celle type som er ekstremt utfordrende å studere på grunn av lav tilgjengelighet tilgjengelighet. Det kan imidlertid utvide vår kunnskap om reproduktiv biologi og infertilitet av monovulatory arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle prosedyrene ble godkjent av Dyrepleie- og brukskomiteen CEEA Val de Loire nummer 19 og ble utført i samsvar med retningslinjene for pleie og bruk av laboratoriedyr.

1. Oocyt-samling og In vitro- modning

  1. Ovum pickup
    1. Daglig vurdere ved hjelp av ultralyd diameteren av ovariefollikler i en kohorte av voksne hopper. Ved fremveksten av en follikel ≥33 mm (dominerende follikkel) injiserer hanen med 1500 IE av humant choriongonadotropin (hCG) i den øvre delen av jugularvenen (iv).
      1. Før injeksjonen utføres, swab området med alkohol, finn den jugular furrow, og plasser tommelen 2-3 cm under injeksjonsstedet for å indusere venen å stige. Sett nålen nesten parallelt med nakken og aspirer for å forsikre deg om at nålen er i venen (blodet kommer inn i sprøyten). På dette punktet injiserer du; HCG vil indusere mAturasjon av oocyten i den dominerende follikel.
    2. 35 h etter hCG-injeksjonen, sedimenterer maren med detomidin (15 μg / kg, iv), butorfanoltartrat (10 μg / kg, iv) og butylskopolaminbrom (0,2-0,3 mg / kg, 15 ml / mare, iv).
    3. Koble nålen til ultralydssonden. Sett ultralydssonden vaginalt og hold eggstokken transretalt for å møte ultralydssonden. Oppgi en operatør for å manøvrere nålen og den andre for å holde eggstokken på plass, med follikkelen mot ultralydssonden . Start fra eggstokken med dominerende follikel.
    4. Punkter vaginalveggen og veggen til den dominerende follikkelen med nålen (ultralydprober for OPU er utstyrt med en kanal for nålen som er koblet til et sugesystem); Theneedle vil være synlig i det ekkografiske bildet.
    5. Aspirer follikulærvæsken i et 50 ml konisk rør forbundet med sugesystemet. Hell innholdet av koniskenRør inn i en stor petriskål og søk etter cumulus-oocytkomplekset (COC) ved hjelp av et stereomikroskop.
    6. Siden COC ikke alltid hentes med follikulærvæsken, skyll follikkelen med Dulbeccos modifiserte fosfatbufferte saltvann (DPBS) som inneholder 5 IE / ml heparinat 37 ° C. Undersøk DPBS for COC-tilstedeværelse, som tidligere beskrevet for follikkelvæsken i trinn 1.1.5. Skyll flere ganger til COC er hentet.
    7. Når COC fra den dominerende follikel er hentet, punkter og flush folliklene ≥5 og ≤25 mm, som beskrevet for den dominerende follikel i trinn 1.1.3-1.1.4; Follikler ≥5 og ≤25 uttrykker ikke luteiniserende hormon / choriogonadotropinreceptor (LHCGR), og derfor vil deres oocytter ikke modnes som følge av hCG og vil bli samlet inn på GV-stadium (umodne). Bare hold COC med flere komplett lag med cumulus celler og brunt, fingranulert åplasm. Kast de andre.
    8. På slutten av OPU, iSe mer med benzylpenisillin 15.000 IE / dyr for å forhindre infeksjon.
    9. Huser hoppen i et rolig, rent stall i minst 2 timer. Kontroller tegn på bevissthet ved å bestemme ørens stilling, reaksjon på stimuli ( f.eks. Støy) og gang før du returnerer maren til selskap med andre dyr.
  2. In vitro modning
    1. Varm HEPES-buffert TCM199 (20 mM Hepes) tilsatt 1,790 IE / L heparin, 0,4% bovint serumalbumin (BSA), penicillin og streptomycin til 37 ° C. Forbered dette mediet på forhånd. Filtrer-steriliser og hold den ved 4 ° C i opptil 6 måneder.
    2. Klargjør IVM-midlet ved å tilsette NaHCO3-buffert TCM199 (25 mM NaHC03) med 50 ng / ml epidermal vekstfaktor (EGF) og 20% ​​kalveserum 7 . Bruk NaHCO 3- buffert TCM199 innen 3 uker etter å ha åpnet en ny flaske. Forbered EGF på forhånd som 100x bestand, frys den ved -20 ° C, Og bruk den innen 6 måneder. Dispense 500 μL i brønnene i en 4-brønnsfat og inkuber i fuktig luft med 5% CO2 ved 38,5 ° C i minst 2 timer.
    3. Etter henting av COCs fra ≥5 og ≤25 mm follikler, sett dem i en petriskål (3,5 cm diameter) fylt med 2 mL HEPES-TCM199. Flytt COC-ene til forskjellige områder av parabolen for å vaske bort den cellulære rusk.
    4. Overfør COC-ene til IVM-mediet og inkuber i 28 timer i fuktig luft med 5% CO2 ved 38,5 ° C.

2. Immunofluorescens og bildeanalyse

  1. Kromosometall
    1. Etter oppsamling fra den dominante follikel eller ved slutten av IVM inkuberer COCene med 100 μM monastrol i 1 time i fuktig luft med 5% CO2 ved 38,5 ° C. Forbered monastrol på forhånd som 100x lager og lagre den ved -20 ° C i opptil 1 år.
    2. Fjern kumuluscelleneVed å behandle dem med 0,5% hyaluronidase eller ved forsiktig pipetting; Fjern zona pellucida ved å behandle den i 0,2% pronase. Forbered hyaluronidase og pronase på forhånd som 10x bestand og lagre dem ved -20 ° C i opptil 1 år.
    3. Fiks oocytene i 4% paraformaldehyd i DPBS i 15 minutter ved 38,5 ° C etterfulgt av ytterligere 45 minutter ved 4 ° C.
      FORSIKTIGHET! Bruk personlig verneutstyr når du håndterer paraformaldehyd, og kast bort forurenset materiale i samsvar med retningslinjene for avfallshåndtering.
    4. Vask oocytene ved å overføre sekvensielt i 3 brønner fylt med 500 μl DPBS tilsatt 0,1% polyvinylalkohol (PVA). Permeabiliser i 0,3% Triton X-100 i 10 minutter ved romtemperatur (RT).
    5. Blokker ikke-spesifikk binding ved inkubasjon i DPBS tilsatt 1% bovint serumalbumin (DPBS-1% BSA) og 10% normalt eselserum i minst 30 minutter ved RT. Prøver kan holdes i blokkeringsløsning ved 4 ° C i 3-4 dager.
    6. For primærfarging inkuberer oocytene i kanin-anti-Aurora B-fosfor-Thr232 i DPBS tilsatt 1% BSA (fortynning 1:50) ved 4 ° C over natten.
    7. Vask oocytene som beskrevet i trinn 2.1.4. Inkuber oocytene i en oppløsning av tetra-metylrhodaminisothiocyanat (TRITC) -konjugert esel-anti-kanin-IgG (1: 100 i DPBS-1% BSA) i 1 time ved RT i mørket.
    8. Vask oocytene som beskrevet i trinn 2.1.4, og legg deretter 3-4 oocytter i en dråpe ikke-herdende, fargemiddelsmonteringsmedium suppleret med 20 μM YOPRO1 på en glassdiode. Gjenta prosedyren til alle oocytene er montert (3-4 oocytter per lysbilde).
    9. La oocytene løsne seg i ca. 10 minutter i monteringsmediet, og dekk dem deretter med et deksel. For å unngå å knuse oocytene, påfør to striper med dobbeltsidig tape før du legger dekselet på glassruten.
      MERK: Denne forholdsregelen vil også sørge for at alle prøvene er like komprimert mellom glassplatenDe og dekselet. Glassglassene kan fryses ved -20 ° C og avbildes i løpet av de neste 2-3 dagene.
    10. Bilde prøvene på et konfokal laserskanningsmikroskop med et 60X objektiv ved hjelp av de røde (sentromerer) og grønne (kromosomene) kanalene 7 , 13 , 14 , 20 , 21 . Skann prøvene som spenner over hele metafasisk tallerken på z-aksen, med trinn hver 0.35 μm. Lagre digitaliserte bilder av hver enkelt plan.
    11. Telle centromerer i serielle konfokale seksjoner ved hjelp av celle telling funksjon av NIH ImageJ programvaren (tilgjengelig på: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      MERK: Unngå et gjentatt antall centromerer som vises på tilstøtende deler ved å identifisere sentromerer som vises, forblir og forsvinner i sekvensielle seksjoner med en numerisk kode.
    12. Gjenta kromosomale coUnting i trinn 2.1.11 med en uavhengig operatør.
      MERK: Klassifiser oocytene som euploid (32 kromosomer), hyperploid (> 32), eller hypoploid (<32).
  2. Spindel morfologi og histon acetylering
    1. Etter oppsamling fra dominerende follikel eller ved slutten av IVM, fjern kumuluscellene ved behandling i 0,5% hyaluronidase eller ved forsiktig pipetting, som beskrevet i trinn 2.1.2.
    2. Vask oocytene i DPBS-PVA, som i trinn 2.1.4, og lag dem i 2,5% paraformaldehyd i 20 minutter ved 38 ° C. Vask mye, som beskrevet i trinn 2.1.4, og permeabiliser i 0,1% Triton X-100 i 5 minutter ved RT.
      MERK: Bruk personlig verneutstyr ved håndtering av paraformaldehyd og avhend av forurenset materiale i samsvar med retningslinjene for avfallshåndtering.
    3. Blokker ikke-spesifikk binding ved inkubering i DPBS tilsatt 2% bovint serumalbumin (DPBS - 2% BSA), 0,05% saponin og 10% normalt eselserum fo2 timer ved RT.
      MERK: Prøver kan holdes i blokkeringsløsning ved 4 ° C i 3 - 4 dager.
    4. For primærfarging inkuberer oocyttene i mus anti-alfa-tubulin (1: 150) og kanin anti-acH4K16 (1: 250) i DPBS-2% BSA med 0,05% saponin ved 4 ° C over natten.
    5. Vask oocytene som i trinn 2.1.4. Inkuber oocytene i en oppløsning av grønt fluorescerende fargekonjugert esel-anti-mus-IgG (1: 500) og TRITC-konjugert esel-anti-kanin-IgG (1: 100) i DPBS-2% BSA med 0,05% saponin i 1 time ved RT i mørket.
    6. Vask oocytene som i trinn 2.1.4, og legg deretter 3-4 oocytter i en dråpe i det ikke-herdende, fargebeleggsmediet, supplert med 1 μg / ml 4'-, 6-diamidino-2-fenylindol (DAPI) På en glassglass.
    7. Monter oocytene på glassrør som beskrevet i trinn 2.1.8.
    8. Bild prøvene på et konfokal laserskanningsmikroskop med et 60x objektiv ved hjelp av de røde (acH4K16), grønne (alfa-tubulin) og blå (DNA) kanalene.
      MERK: Hold laserinnstillingene for de røde og blå kanalene konstante i løpet av oppkjøpet av alle prøvene. Skann prøvene som spenner over hele meisjespindelen og metafasisk tallerken på z-aksen, med trinn hver 0.35 μm. Lagre digitaliserte bilder (enkeltplaner og projisert 3D-bilde).
    9. Mål pole-til-polet spindellengde og spindeldiameteren ved maksimal bredde på det projiserte bildet ved hjelp av målefunksjonen til NIH ImageJ-programvaren (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Gjenta hver 3 ganger og beregne gjennomsnittet.
    10. Kvantifiser den relative fluorescensen av acH4K16 ved hjelp av den integrerte tetthetsfunksjonen til NIH ImageJ-programvaren (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normaliser den for den integrerte tettheten av DAPI-fargingen.

3. Analyse av mRNA-ekspresjon

  1. Etter at COCene er hentet fra 5 til 25 mm follikler, samle granulosa cellene sUspension som ble igjen i petriskålen og vaske den to ganger i kaldt DPBS ved sentrifugering ved 10 600 xg i 2 min. Frys i flytende nitrogen. Oppbevar prøvene ved -80 ° C i opptil 6 måneder; Cellene vil tjene til standardkurven.
  2. Fjern forsiktig alle cumuluscellene, som beskrevet i trinn 2.1.2, fra umodne (GV), in vitro- modne og in vivo- modne oocytter.
  3. Vask oocytene, som beskrevet i 2.1.4, i DPBS-PVA, samle dem enkelt i 1 μl volum og legg 2 μL RNALater på toppen. Snapfryse i flytende nitrogen. Oppbevar prøvene ved -80 ° C i opptil 6 måneder.
  4. Tilsett 2 pg Luciferase RNA til hver prøve som en spike-in. Basseng oocytene 2 x 2 og ekstraher det totale RNA ved hjelp av et silikamembranfilterbasert sett som er egnet for å gjenvinne RNA fra små prøver.
  5. Omvendt transkriber RNA i 10 μL med 0,25 μg tilfeldig hexamerer og mus-Moloney leukemivirus revers transkriptase i 1 time ved 37 & # 176; C. Oppbevar prøvene ved -20 ° C i opptil 6 måneder.
  6. Fortynn cDNA fra granulosa-celler i RNAse-fri vann til 50 ng / μl. Serielt fortynn denne løsningen 1:10 for å oppnå 5 ng / μl, 0,5 ng / μl, 0,05 ng / μl og 0,005 ng / μl løsninger.
  7. Samle reaksjoner i tre eksemplarer i et totalt volum på 20 μl per reaksjon ved å bruke cDNA ekvivalent med 0,05 oocytter som substratet, eller 5 μl av de serielle fortynninger av granulosa celle-cDNA, 10 μl SYBR-grønn supermiks og 0,3 μM av hver spesifikk primer Tabell 1 ).
  8. Kjør reaksjonen i en termisk syklus ved bruk av en 3-trinns protokoll: 95 ° C i 30 s, 60 ° C i 30 s og 72 ° C i 20 s, gjentatt 40 ganger. Til slutt, kjøp smeltekurven fra 60 ° C og øk temperaturen med 0,5 ° C hver 20 s opp til 95 ° C.
  9. Vurder startkvantiteten (SQ) for det spesifikke mRNA i oocyttprøver ved hjelp av standardkurvenF "> 15 beregnet ut fra granulosa-celleprøven. Express dataene som forholdet mellom SQ av genet av interesse og SQ for housekeeping-gener.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De opprinnelige funnene av disse forsøkene ble beskrevet i dybden tidligere 7 og er rapportert her som et eksempel på resultater som kan oppnås under anvendelse av de beskrevne protokoller.

Modningsgrad

Av de 32 koksykdommer som ble hentet av OPU fra dominante follikler, var 28 (88%) på MII-stadiet. Fjorten av de 58 COCene samlet fra follikler 5-25 mm i størrelse ble umiddelbart frosset som umodne oocytter for mRNA ekspressjonsstudien. De resterende 44 ble modnet in vitro og 37 nådde MII-trinnet (85%). Effektiviteten av modning var ikke signifikant forskjellig i de to gruppene (Fishers eksakte test P> 0,05).

Aneuploidy rate

For å studere om IVM ca.N forstyrrer den trofaste kromosomale partisjonering mellom den sekundære oocytten og den første polare kroppen, ble antall kromosomer i MII-trinnet talt, idet det representerer resultatet av kromosomsegregasjon under meiosen I. Som vist i Figur 1A , ble anti-Aurora B Fosfat-Thr232-antistoffet fargede spesielt den sentromere regionen i hesteocyter, slik at man kunne telle antall kromosomer. In vitro- modne oocytter var signifikant mer påvirket av aneuploidi (5/11) sammenlignet med in vivo modnet oocytter (0/12; Fishers eksakte test, P <0,05; Figur 1B ). De fleste aneuploide oocytene (4/5) var hyperploide; Derfor kommer aneuploiditetsraten ikke fra artefakter i fremstillingen av prøvebestemmende kromosomalt tap, som skjer med kromosomale sprekker. Immunostaining av den sentromere regionen ble også forsøkt med anti-CENPA- og anti-AURKB-antistoffene, men ingen signal var visUalisert i begge tilfeller (data ikke vist).

Spindelmorfologi og acetylering av H4K16

Pol-til-polet spindellengde og diameteren til spindelen ved maksimal bredde ble målt, som illustrert i figur 2 . I henhold til disse målingene var in vitro- matede oocytter betydelig lenger (19,89 ± 1,15 μm) og bredere (17,28 ± 0,81 μm) sammenlignet med in vivo modnet oocytter (14,57 ± 1,7 μm i lengde og 13,56 ± 0,91 μm i diameter, uparert t -test, P <0,05). På samme prøver ble det globale acetyleringsnivået for H4K16 også målt, hvilket bekrefter at acetylering ved H4K16 var signifikant lavere i IVM-oocytter sammenlignet med deres in vivo- kolleger ( figur 2 , rød).

Ekspression av tranSkript kodende for histon acetyltransferaser og deacetylaser

Hvorvidt uttrykket av gener involvert i histon-acetylerings-deacetyleringsprosessen ble endret i in vitro- matede oocytter ble undersøkt av q-PCR. Histonacetyltransferase 1 ( HAT1 ), K-acetyltransferase 8 (KAT8 ), histon-deacetylase 1 ( HDAC1 ) og NAD-avhengig protein-deacetylase sirtuin 1 ( SIRT1 ) ble identifisert som formodede mål. Vesentlige forskjeller i ekspresjonen av disse transkripsjonene i umodne, in vitro- modnede og in vivo- modne oocytter ble ikke observert, uavhengig av den anvendte normalisering. Spesifikt ble resultatene av transkripsjonsuttrykksanalysen som ble rapportert i figur 3, beregnet mot en standardkurve ved bruk av SQ-metoden og normalisert for rengjøring av glyceraldehyd-3-fosfat-dehydrogenase ( GAPDH ). Tilsvarende ingen forskjellRencer ble observert når resultatene var normalisert for spissen i luciferase eller når AΔct-metoden ble brukt (ikke vist).

Mål Fw primer Rv primer Amplikon størrelse
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
luciferase TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tabell 1: Primer Setails. 5'> 3'-sekvensen av de fremadrettede (Fw) og (Rv) primere og den forventede amplikonstørrelsen er gitt for hvert transkript analysert: glyceraldehyd-3-fosfat dehydrogenase ( GAPDH ) , histonacetyltransferase 1 ( HAT1 ) , histon Deacetylase 1 ( HDAC1 ) , K-acetyltransferase 8 ( KAT8 ) , luciferase og NAD-avhengig protein-deacetylase sirtuin 1 ( SIRT1 ). Gjengitt med tillatelse fra referanse 7 .

/55242fig1.jpg "/>
Figur 1: Aneuploidy Rate i Vivo- og In Vitro- matede hestokocytter. ( A ) Representative bilder som viser aurora B fosfon-Thr232 (rød) og DNA (grønn) farging av en MII-trinns hesteococytt behandlet med monastrol. En euploid oocyt (32 kromosomer) er vist. Skalbjelke = 5 μm. ( B ) Stanggrafen representerer fordelingen av euploide og aneuploide MII-trinns oocytter i in vivo (n = 12) og in vitro (n = 11) modnet oocytter. * Indikerer en signifikant forskjell i aneuploiditetsfrekvensen (Fishers eksakte test, P <0,05). Gjengitt med tillatelse fra Referanse 7. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2 Figur 2: Spindelmåling og H4K16-acetylering i Vivo- og In Vitro- matede hestokocytter. Representative bilder som viser tubulin (grønn), acetylert H4K16 (rød) og DNA (blå) i MII-oocytter etter in vivo (n = 4) eller in vitro (n = 14) modning. Tubulinbildene viser aksene som brukes til spindellengde og diametermålinger. Skalbjelke = 5 μm. Endret fra referanse 7 . Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: Ekspresjon av KAT8 , SIRT1 , HAT1 , Og HDAC1 i ImmatuRe, in vivo Og i Vitro Matured Oocytes. Stanggrafene representerer gjennomsnittet ± SEM av det relative mRNA-uttrykket av KAT8 , SIRT1 , HAT1 , Og HDAC1 , Uttrykt som startkvantiteten (SQ) av transkripsjonen av interesse sammenlignet med SQ av GAPDH , brukt som husholdning. Ingen statistiske forskjeller ble observert mellom umodne (GV, n = 14), in vivo (n = 14) og in vitro (n = 12) modnet oocytter (enveis ANOVA, P > 0,05). Gjengitt med tillatelse fra referanse 7 . Vennligst klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Selv om IVM har blitt utført på hester i mer enn 20 år 16 , vet vi ennå ikke om oocyten kan være opprinnelsen til embryonal aneuploidi, som det har blitt foreslått for mennesker 17 . Årsaken er sannsynligvis at utarbeidelsen av oocyt-sprøyter for kromosometelling resulterer i betydelig prøveforsinkelse. Med dette i bakhodet ble en undersøkelse av metodene som ble brukt for å undersøke feil i kromosomsegregasjon, utført for å søke etter den mest hensiktsmessige teknikken for anvendelse på hesteocytter. Fire hovedteknikker ble funnet i den vitenskapelige litteraturen: 1) kromosomale sprekker 5 , 18 , 19 , 2) fluorescerende in situ hybridisering (FISH) 4 , 6 , 17 , 20 , 3) centromere teller på monastrol-kollapsede spindler , 14 , 21 , 22 og 4) kromosom fluorescensfarging uten kromosometall 23 , 24 , 25 .

Som allerede nevnt, blir prepareringen av kromosomale sprøyter etterfulgt av Giemsa-farging komplisert ved en høy grad av prøveforsinkelse. Denne metoden har i mange tilfeller blitt erstattet av FISH, som bruker spesifikke sonder til å kartlegge forskjellige kromosomer. En ulempe med FISH-teknikker er at når et lite antall sonder brukes, kan forekomsten av et falskt negativt øke ( dvs. å identifisere som en normal en celle som er aneuploid fordi det manglende eller supernumerære kromosomet ikke er probet). Den pålitelige bruken av FISH er derfor i stor grad basert på kunnskapen a priori av kromosomene som hyppigere påvirkes av aneuploidi ( f.eks.., Kromosom 21 hos mennesker). FISH har tidligere blitt brukt til å undersøke kromosomale abnormiteter i hestembryoer ved bruk av 2 prober mot kromosom 2 og kromosom 4 20 . Ifølge disse forsøkene er kjernene av in vitro produserte embryoer mer sannsynlig å bli påvirket av kromosomale abnormiteter enn in vivo- produserte embryoer. Dette funnet er i samsvar med observasjonen som er rapportert ovenfor ved bruk av monastrol-kollapsmetoden i IVM-oocytter. Imidlertid var forekomsten av aneuploidi i IVM-oocytter enda høyere enn det som ble rapportert ved bruk av FISH i in vitro- produserte embryoer 20 . Denne partielle avviket kan forklares ved det faktum at kun to kromosomspesifikke prober ble brukt til FISH-eksperimenter. Denne tilnærmingen kan ha undervurdert forekomsten av aneuploidi som involverer andre kromosomer, spesielt når man vurderer at hester har 32 kromosomer. Det kan imidlertid ikke utelukkes som alvorlig aneuPloidier som kan påvises i oocytene, opprettholdes ikke i embryoene fordi gameter som påvirkes av kritiske genetiske abnormiteter, kanskje ikke utvikles videre.

Kombinasjonen av monastrolbehandlings-, kromosom- og sentromerefarging og konfokalmikroskopi tillates for konsistente teller av kromosomnummeret i MII-trinns hesteocyter med minimal prøveforsinkelse. Den tekniske begrensningen som ble oppstått ved å utvikle denne teknikken for hesteocytter var tilgjengeligheten av hestespesifikke antistoffer. Før du brukte Aurora B fosfor (Thr232) produserte ikke to andre antistoffer (anti-Aurora B og anti-CENPA) en sentromerisk flekk. Spesielt var anti-Aurora B og anti-CENPA allerede vellykket brukt i bovin og humane celler 26 , 27 , 28 ; Derfor ble det konkludert med at de ikke var spesifikke for hesten. Denne teknikken kan også begrenses av tilgjengeligheten av en konfokal laserskanningAnningmikroskop og bildeanalyseprogramvare. Blindtelling av to uavhengige operatører er også avgjørende for å utelukke operatørinducerte artefakter. Selv om kromosomaltallet av en monastrol-kollapset spindel er en tilnærming som bedre opprettholder cellens morfologi og forhindrer prøven tap, tillater denne teknikken kun observasjon av forskjeller i det grunnleggende antall kromosomer; Det er ikke informativ om andre kromosomale abnormiteter ( f.eks. Translokasjoner, segmentinterchanges, etc. ) som i stedet kan avsløres ved karyotyping og i noen tilfeller av FISH.

Feil i kromosomsegregasjon har også blitt undersøkt ved spindel- og kromosomimmunfluorescens, uten å utføre en kromosomaltall 23 , 24 , 25 . I dette tilfellet betraktes spindler med alvorlige anomalier og slanke eller spredte kromosomer tegn på uregelmessig kromosoMeg segregering. Følgelig ble kromosomer som ble spredt ut av spindelen observert i in vitro- modne oocytter 7 (klassen som er mer sannsynlig påvirket av aneuploidi). Imidlertid har kromosomaltalling fordelen av å formidle kvantifiserbar informasjon.

For å oppsummere, sammenlignet med de andre teknikkene som er beskrevet, har bruken av monastrol og sentromerefarging fordelen av å forhindre prøvetap, minimere forekomsten av falske negativer, og være kvantifiserbare.

Endringen av de epigenetiske modifikasjonene er blitt foreslått som en mulig mekanisme ved utbruddet av oocyt-aneuploidi 18 , 24 , 25 . Ved å bruke en trippel fluorescerende flekk, var det mulig å visualisere og måle den meotiske spindelen og observere bølgende / spredte kromosomer. På samme tid, takket være utviklingen av antistoffer somGjenkjenne spesifikke restmodifikasjoner, ble acetyleringsnivået av H4K16 utført på samme prøve. Denne tilnærmingen tjente det dobbelte formål å redusere mengden av oocytter som var nødvendige for analysen og korrelering av H4-acetylering med spindelens morfologi.

Kvantifiseringen av kovalente protein modifikasjoner kan utføres med Western blot. Denne teknikken krever imidlertid en større prøvestørrelse og opprettholder ikke prøvenes integritet for morfologiske studier. Den tredobbelte fluorescerende fargingstilnærmingen kan påføres andre histon-modifikasjoner og potensielt til hvilket som helst protein som kan gjenkjennes av forskjellige sekundære antistoffer 8 ; Den eneste begrensende faktoren er tilgjengeligheten av hestespesifikke antistoffer. I denne sammenheng håper forfatterne at oppmerksomheten til hestemodellen vil øke interessen for undersøkelsen av grunnleggende biologiske mekanismer i denne arten, og derfor i utviklingenEnt av dedikerte verktøy.

Endelig beskrives også ekspresjonsstudien av mRNA som koder for histon-deacetylaser (HDACs) og acetyltransferaser (HATs) utført ved revers transkripsjon og kvantitativ PCR (q-PCR). Q-PCR er en bredt spredt teknikk; Imidlertid er bruken av hesteocytter ikke diffus. Det er essensielt å spesifisere at på grunn av generell silencing av transkripsjonsaktivitet under oocytmodning 29 , kan analysen av total transkripsjonsmengde bare avsløre mRNA-stabilitet eller nedbrytning i denne bakgrunn 30 , 31 . Forskjeller i det relative uttrykket av transkripsjoner mellom in vitro og in vivo modning ble ikke observert. Disse funnene tyder på at oversettelses- og posttranslatoriske forskrifter kan bli påvirket av IVM, og påpeke behovet for utvikling av andre eksperimentelle tilnærminger som skal undersøke translasjonelle og poSt-translasjonelle mekanismer på single-celle nivå.

Samlet beskriver den foreliggende studien en eksperimentell tilnærming til morfologisk og biokjemisk karakterisering av hesteocyter. Denne tilnærmingen kan brukes på oocytter av andre arter som er påvirket av en lav utvinningsgrad, inkludert mennesker eller truede arter. Disse studiene vil utvide vår kunnskap om reproduksjonsbiologi fra pattedyr og vil bidra til vår forståelse av infertilitet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne vil gjerne takke Fabrice Vincent for støtte med laserskanningskonokalsmikroskopi (LSCM) , og Philippe Barrière og Thierry Blard for å utføre daglig ultralyd ovariescanning og hCG-injeksjon. Dette arbeidet ble støttet delvis av "Regione Sardegna og Regione Lombardia" -projektet "Ex Ovo Omnia" (Tilskudd nr. 26096200 til AML); "L'Oreal Italia per le Donne e la Scienza 2012" fellesskap (Kontrakt 2012 til FF), FP7-PEOPLE-2011- CIG, Forskningsforvaltningsorganet (REA) "Pro-Ovum" (stipend nr. 303640 til VL); Og av Postdoktorskolen for jordbruk og veterinærmedisin, medfinansiert av Det europeiske sosialfond, Sektorielt operativt program for menneskelig ressursutvikling 2007-2013 (Kontrakt nr. POSDRU / 89 / 1.5 / S / 62371 til IM). In vivo oocyt samlingen ble finansiert av Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analyse av kromosomsegregasjon, histonacetylering og spindelmorfologi i hesteokocytter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter