Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Анализ сегрегации хромосом, ацетилирование гистонов и морфология веретена в ооцитах лошадей

doi: 10.3791/55242 Published: May 11, 2017

Summary

Эта рукопись описывает экспериментальный подход к морфологическим и биохимическим характеристикам ооцитов лошадей. В частности, в настоящей работе показано, как собирать незрелые и зрелые ооциты лошади с помощью ультразвукового наводящего пипетки (OPU) и как исследовать сегрегацию хромосом, морфологию веретена, глобальное ацетилирование гистонов и экспрессию мРНК.

Abstract

Область вспомогательного размножения была разработана для лечения бесплодия у женщин, домашних животных и исчезающих видов. У лошадей вспомогательное воспроизведение также позволяет производить эмбрионы от высоких исполнителей без прерывания их спортивной карьеры и способствует увеличению числа жеребят у кобыл высокой генетической ценности. Настоящая рукопись описывает процедуры, используемые для сбора незрелых и зрелых ооцитов из яичников лошадей с использованием пипетки яйцеклеток (OPU). Эти ооциты затем использовали для исследования частоты анеуплоидии путем адаптации протокола, ранее разработанного на мышах. В частности, хромосомы и центромеры ооцитов метафазы II (MII) флуоресцентно маркировали и подсчитывали на последовательные фокальные планы после сканирования конфокального лазерного микроскопа. Этот анализ выявил более высокую частоту анеуплоидии, когда незрелые ооциты были собраны из фолликулов и созревали in vitro по сравнению сIn vivo. Иммунное окрашивание тубулина и ацетилированная форма гистона-4 в определенных остатках лизина также выявило различия в морфологии мейотического веретена и в глобальной структуре ацетилирования гистонов. Наконец, экспрессия мРНК, кодирующих гистондеацетилазы (HDACs) и ацетилтрансфераз (HATs), исследовалась с помощью обратной транскрипции и количественной ПЦР (q-ПЦР). Отличия в относительной экспрессии транскриптов не наблюдались между созревшими in vitro и ооцитами in vivo . В соответствии с общим молчанием транскрипционной активности во время созревания ооцитов анализ суммарного количества транскриптов может выявить только стабильность или деградацию мРНК. Таким образом, эти выводы показывают, что могут быть затронуты другие правила перевода и посттрансляции.

В целом, настоящее исследование описывает экспериментальный подход к морфологическим и биохимическим характеристикам ооцита лошади,Типа, который чрезвычайно сложно изучить из-за низкой доступности образцов. Тем не менее, он может расширить наши знания о репродуктивной биологии и бесплодии у моновируляционных видов.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Для лечения бесплодия у женщин, животных-компаньонов и исчезающих видов разработано множество методов вспомогательной репродукции. Одной из наиболее распространенных процедур в клинических условиях является извлечение ооцитов из метафазы II (MII) из фолликулов яичников с помощью ультразвуковой трансвагинальной аспирации, пикап яичника (OPU) 1 . Эти ооциты затем оплодотворяются in vitro (IVF), с полученным эмбрионом (ами), имплантированным в матку-реципиенту. MII-стадии (зрелые) ооциты извлекаются после введения экзогенных гонадотропинов. Однако это лечение ассоциируется у некоторых пациентов с развитием синдрома гиперстимуляции яичников (OHSS) 2 .

Пользуясь внутренней способностью полностью выращенных незрелых ооцитов (GV-стадия) спонтанно возобновлять мейоз после выделения из их фолликулов, можно получить зрелые ооциты без введенияГонадотропин 3 . Эта процедура называется созреванием ооцита in vitro (IVM) и представляет собой менее ориентированный на наркотики, менее дорогой и более дружелюбный к пациенту подход к вспомогательным репродуктивным технологиям. Однако успех развития эмбрионов с ооцитами, выращенными in vitro, как правило, ниже, чем у ооцитов созревших in vivo 4 , 5 . Возможное объяснение состоит в том, что созревающие in vitro ооциты в большей степени подвержены ошибкам в сегрегации хромосом, а возникающая анеуплоидия нарушает нормальное эмбриональное развитие 6 .

Понимание молекулярной основы хромосомной неправильной сегрегации во время IVM в конечном счете раскрыло бы полный потенциал этого метода. В этом ключе экспериментальный подход, используемый для исследования морфологических и биохимических особенностей in vitro -зрелых ооцитов, по сравнению с in vivo maturОоциты описаны здесь 7 , 8 . В частности, процедуры OPU незрелых и зрелых ооцитов и IVM незрелых ооцитов иллюстрируются с использованием взрослых лошадей и лошадей с естественной едой в качестве экспериментальной модели. Затем проводят иммунофлюоресценцию и анализ изображения, чтобы исследовать сегрегацию хромосом, морфологию веретена и глобальную картину ацетилирования гистонов на этих гаметах. Наконец, описан протокол обратной транскрипции и количественной ПЦР для анализа экспрессии мРНК.

По сравнению с моделями животных-грызунов лошади не допускают генетических манипуляций, их труднее манипулировать и требуют дорогого ухода. Однако эта модель приобретает значительный интерес для изучения созревания ооцитов 9 , 10 из-за сходства с физиологией яичников у людей 11 , 12 </ SUP>. Более того, разработка надежных протоколов IVM-IVF у лошади имеет существенный экономический интерес, так как это позволило бы увеличить число жеребят у кобыл высокой генетической ценности.

Одним из ограничений проведения экспериментов на ооцитах, особенно в моновируляционных видах, является ограниченная доступность образцов. Этот предел был преодолен путем корректировки подхода, ранее разработанного на мышах, к ооцитам лошадей 13 , 14 , чтобы проводить подсчет хромосом, который минимизирует потерю образца (см. Обсуждение для сравнения с другими доступными методами). Кроме того, протокол трифлуоресцентного окрашивания был оптимизирован для проведения множественных анализов в одном образце, а q-PCR-анализ проводился только для пулов с 2 ооцитами.

В целом, настоящее исследование описывает экспериментальный подход, направленный на морфологически и биохимически чаРактеризировать ооцит лошади, тип клетки, который чрезвычайно сложно изучить из-за низкой доступности образцов. Тем не менее, он может расширить наши знания о репродуктивной биологии и бесплодии моновируляционных видов.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Все процедуры были одобрены Комитетом по уходу и использованию животных CEEA Val de Loire номер 19 и выполнялись в соответствии с Руководящими принципами ухода и использования лабораторных животных.

1. Сбор ооцитов и созревание in vitro

  1. Питание яйцеклетки
    1. Ежедневно оценивают ультразвуком диаметр яичниковых фолликулов в когорте взрослых кобыл. При появлении фолликула ≥33 мм (доминантный фолликул), вставьте кобылу 1500 IU хорионического гонадотропина человека (hCG) в верхнюю часть яремной вены (iv).
      1. Перед выполнением инъекции протрите область спиртом, найдите яремную борозду и поместите большой палец на 2-3 см под место инъекции, чтобы побудить вену встать. Вставьте иглу почти параллельно шейке и аспирируйте, чтобы убедиться, что игла находится в вене (кровь попадет в шприц). На этом этапе введите; ХГЧ будет вызывать мНатурации ооцита в доминантном фолликуле.
    2. Спустя 35 ч после инъекции ХГЧ, успокаивают кобылу детомидином (15 мкг / кг, внутривенно), буторфаноловым тартратом (10 мкг / кг, внутривенно) и бутилскополамином бромом (0,2-0,3 мг / кг, 15 мл / мор., Iv).
    3. Подключите иглу к ультразвуковому зонду. Вставьте ультразвуковой зонд вагинально и удерживайте яичник трансректально, чтобы смотреть на ультразвуковой зонд. Поручите одному оператору маневрировать иглой, а другой, чтобы удерживать яичник на месте, с фолликулом, обращенным к ультразвуковому зонду . Начните с яичника с доминирующим фолликулом.
    4. Проколите стенку влагалища и стенку доминантного фолликула иглой (ультразвуковые зонды для OPU оснащены каналом для иглы, присоединенной к системе всасывания); Theneedle будет виден в эхографическом изображении.
    5. Аспирируйте фолликулярную жидкость в 50-мл конической трубке, соединенной с системой всасывания. Налейте содержимое конической формыПробирки в большую чашку Петри и поиск комплекса кумулюс-ооцит (КОК) с помощью стереомикроскопа.
    6. Так как КОК не всегда извлекается фолликулярной жидкостью, промывайте фолликул с модифицированным Дульбекко фосфатно-солевым буфером (DPBS), содержащим 5 МЕ / мл гепарината 37 ° C. Исследуйте DPBS для присутствия COC, как описано ранее для фолликулярной жидкости на этапе 1.1.5. Сбрасывайте несколько раз, пока не будет извлечен COC.
    7. Как только КОК из доминантного фолликула извлекается, прокалывается и смывается фолликулы ≥5 и ≤25 мм, как описано для доминантного фолликула на этапах 1.1.3-1.1.4; Фолликулы ≥5 и ≤25 не экспрессируют лютеинизирующий гормон / рецептор choriogonadotropin (LHCGR), и поэтому их ооциты не созревают в ответ на hCG и будут собраны на стадии GV (незрелые). Храните КОК только несколькими полными слоями кучевых клеток и коричневой мелкозернистой ооплазмы. Откажитесь от других.
    8. В конце ОПУ, вЧтобы предотвратить заражение, кобылу с бензил-пенициллином 15 000 МЕ / животное.
    9. Дом кобыла в тихом, чистом стабильном состоянии, по крайней мере 2 часа. Проверяйте признаки осознания, определяя положение ушей, реакцию на раздражители ( например, шум) и походку, прежде чем возвращать кобылу в компанию других животных.
  2. Созревание in vitro
    1. Теплый HEPES-буферный TCM199 (20 мМ Hepes), дополненный 1790 МЕ / л гепарином, 0,4% бычьим сывороточным альбумином (BSA), пенициллином и стрептомицином до 37 ° C. Подготовьте этот носитель заранее. Фильтр стерилизовать и держать его при 4 ° C до 6 месяцев.
    2. Подготовьте среду IVM добавлением NaHCO 3 -буферизованного TCM199 (25 мМ NaHCO 3 ) с 50 нг / мл эпидермального фактора роста (EGF) и 20% сыворотки теленка 7 . Используйте NaHCO 3 -буфер TCM199 в течение 3 недель после открытия новой бутылки. Подготовка EGF заранее, как 100x запасов, заморозить его при -20 ° C, И использовать его в течение 6 месяцев. Внесите 500 мкл в лунки 4-луночного планшета и инкубируйте в увлажненном воздухе с 5% CO 2 при 38,5 ° C в течение не менее 2 часов.
    3. После извлечения КОК из фолликулов ≥5 и ≤25 мм, помещали их в чашку Петри (диаметр 3,5 см), заполненную 2 мл HEPES-TCM199. Переместите КОК в разные области блюда, чтобы смыть сотовые развалины.
    4. Перенесите КОК в среду IVM и инкубируйте в течение 28 ч в увлажненном воздухе с 5% СО 2 при 38,5 ° С.

2. Иммунофлюоресценция и анализ изображений

  1. Количество хромосом
    1. После сбора из доминантного фолликула или в конце IVM инкубируйте КОК со 100 мкМ monastrol в течение 1 ч в увлажненном воздухе с 5% CO 2 при 38,5 ° C. Предварительно подготовьте monastrol как 100x запасы и храните его при -20 ° C до 1 года.
    2. Удаление кучевых ячеекПутем обработки их 0,5% гиалуронидазой или осторожным пипетированием; Удалите zona pellucida, обработав его в 0,2% проназе. Предварительно подготовьте гиалуронидазу и проназу в виде 10х запасов и храните их при -20 ° C до 1 года.
    3. Закрепите ооциты в 4% параформальдегиде в DPBS в течение 15 мин при 38,5 ° С, затем еще 45 мин при 4 ° С.
      ВНИМАНИЕ! При обращении с параформальдегидом пользоваться средствами индивидуальной защиты и утилизировать загрязненные материалы в соответствии с указаниями по удалению опасных отходов.
    4. Промывают ооциты путем последовательной передачи в 3 лунки, заполненные 500 мкл DPBS, дополненного 0,1% поливинилового спирта (PVA). Permeabilize в 0,3% Triton X-100 в течение 10 мин при комнатной температуре (RT).
    5. Блокировать неспецифическое связывание путем инкубации в DPBS, дополненном 1% бычьим сывороточным альбумином (DPBS-1% BSA) и 10% нормальной сывороткой осла в течение по меньшей мере 30 мин при комнатной температуре. Образцы можно хранить в блокирующем растворе при 4 ° С в течение 3-4 дней.
    6. Для первичного окрашивания инкубируйте ооциты в кроличьем анти-Aurora B phospho-Thr232 в DPBS, дополненном 1% BSA (разведение 1:50) при 4 ° C в течение ночи.
    7. Промыть ооциты, как описано в шаге 2.1.4. Инкубируйте ооциты в растворе конъюгированного с тетрациклом метилоходами изотиоцианатом (TRITC) осла против кроличьего IgG (1: 100 в DPBS-1% BSA) в течение 1 часа при комнатной температуре в темноте.
    8. Промывают ооциты, как описано в шаге 2.1.4, и затем помещают 3-4 ооцита в каплю не упрочняющей, анти-увядающей среды для установки, дополненной 20 мкМ YOPRO1 на предметном стекле. Повторяйте процедуру до тех пор, пока не будут смонтированы все ооциты (3-4 ооцита на слайд).
    9. Дайте ооцитам оседать в течение примерно 10 минут в монтажной среде, а затем накройте их покровным стеклом. Чтобы избежать дробления ооцитов, нанесите две полоски двухсторонней ленты перед укладкой покровного стекла на предметное стекло.
      ПРИМЕЧАНИЕ. Эта мера предосторожности также гарантирует, что все образцы одинаково сжаты между стеклянным sliДе и покровное стекло. Стеклянные горки могут быть заморожены при -20 ° C и отображены в течение следующих 2-3 дней.
    10. Изобразите образцы на конфокальном лазерном сканирующем микроскопе с объективом 60X с использованием красных (центромеры) и зеленых (хромосом) каналов 7 , 13 , 14 , 20 , 21 . Отсканируйте образцы, охватывающие всю метафазическую пластину по оси Z, с шагом каждые 0,35 мкм. Сохраните цифровые изображения каждого плана.
    11. Посчитайте центромеры в последовательных конфокальных срезах, используя функцию подсчета клеток программного обеспечения NIH ImageJ (доступно по адресу: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      ПРИМЕЧАНИЕ. Избегайте повторного подсчета центромер, которые появляются на смежных секциях, путем определения центромеров, которые появляются, остаются и исчезают в последовательных разделах с помощью числового кода.
    12. Повторите хромосомный соНа шаге 2.1.11, с независимым оператором.
      ПРИМЕЧАНИЕ. Классифицируйте ооциты как эуплоидные (32 хромосомы), гиперплоидные (> 32) или гипоплоидные (<32).
  2. Морфология веретена и ацетилирование гистонов
    1. После сбора из доминантного фолликула или в конце IVM удалите кумулюсные клетки обработкой в ​​0,5% гиалуронидазе или осторожным пипетированием, как описано на этапе 2.1.2.
    2. Промывают ооциты в DPBS-PVA, как на этапе 2.1.4, и фиксируют их в 2,5% параформальдегиде в течение 20 мин при 38 ° C. Аккуратно промыть, как описано в шаге 2.1.4, и пропитать в 0,1% Triton X-100 в течение 5 мин при комнатной температуре.
      ПРИМЕЧАНИЕ. При обращении с параформальдегидом используйте средства индивидуальной защиты и утилизируйте загрязненные материалы в соответствии с указаниями по удалению опасных отходов.
    3. Блокировать неспецифическое связывание путем инкубации в DPBS, дополненном 2% бычьим сывороточным альбумином (DPBS - 2% BSA), 0,05% сапонином и 10% нормальной сывороткой ослаR 2 ч при комнатной температуре.
      ПРИМЕЧАНИЕ: Образцы можно хранить в блокирующем растворе при 4 ° С в течение 3 - 4 дней.
    4. Для первичного окрашивания инкубируйте ооциты в мышином анти-альфа-тубулине (1: 150) и кроличьем анти-acH4K16 (1: 250) в DPBS-2% BSA с 0,05% сапонином при 4 ° C в течение ночи.
    5. Промывают ооциты, как на этапе 2.1.4. Инкубируйте ооциты в растворе зеленого флуоресцентного конъюгированного с ослом антитела против мышиного IgG (1: 500) и TRITC-конъюгированного осла против кролика IgG (1: 100) в DPBS-2% BSA с 0,05% сапонина в течение 1 часа при RT в темноте.
    6. Промывают ооциты, как на шаге 2.1.4, а затем кладут 3-4 ооцита в каплю не затвердевающей, анти-увядающей среды для установки, дополненной 1 мкг / мл 4 ', 6-диамидино-2-фенилиндолом (DAPI) На стеклянном слайде.
    7. Смонтируйте ооциты на предметных стеклах, как описано в шаге 2.1.8.
    8. Изобразите образцы на конфокальном лазерном сканирующем микроскопе с 60-кратным объективом, используя красный (acH4K16), зеленый (альфа-тубулин) и синий (ДНК) каналы.
      ПРИМЕЧАНИЕ. Сохраняйте параметры лазера для красного и синего каналов постоянными во время сбора всех образцов. Отсканируйте образцы, охватывающие весь мейотический шпиндель и метафазную пластину по оси Z, с шагом каждые 0,35 мкм. Сохраните цифровые изображения (одиночные планы и проецируемое трехмерное изображение).
    9. Измерьте длину шпинделя между полюсами и диаметр шпинделя на максимальной ширине на проецируемом изображении с помощью функции измерения программного обеспечения NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Повторить каждые 3 раза и вычислить среднее значение.
    10. Количественное определение относительной флуоресценции acH4K16 с использованием интегрированной функции плотности программного обеспечения NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30.html). Нормализовать его для интегрированной плотности окрашивания DAPI.

3. Анализ экспрессии мРНК.

  1. После того, как КОК были извлечены из фолликулов размером от 5 до 25 мм, соберите гранулезную клеткуКоторый оставался в чашке Петри и дважды промывал его в холодном DPBS путем центрифугирования при 10600 мкг в течение 2 мин. Замораживают замораживание в жидком азоте. Хранить образцы при -80 ° C в течение 6 месяцев; Ячейки будут служить для стандартной кривой.
  2. Тщательно удалите все кумулятивные клетки, как описано на этапе 2.1.2, из незрелых (GV), созревших in vitro и in vivo ооцитов.
  3. Промывают ооциты, как описано в 2.1.4, в DPBS-PVA, собирают их по одному в 1 мкл объемах и откладывают 2 мкл RNALater сверху. Заморозить в жидком азоте. Храните образцы при температуре -80 ° C в течение 6 месяцев.
  4. Добавить 2 пг Luciferase РНК для каждого образца, как всплеск. Объединение ооцитов 2 х 2 и экстракция общей РНК с использованием фильтра на основе кремниевой мембранной фильтрации, подходящего для извлечения РНК из небольших образцов.
  5. Обратную транскрибируют РНК в 10 мкл с 0,25 мкг случайных гексамеров и обратной мышиной обратной транскриптазы вируса лейкемии Moloney в течение 1 ч при 37 & 176; С. Храните образцы при температуре -20 ° C в течение 6 месяцев.
  6. Развести кДНК из гранулезных клеток в воде без РНКазы до 50 нг / мкл. Серийно разбавляйте этот раствор 1:10 до получения 5 нг / мкл, 0,5 нг / мкл, 0,05 нг / мкл и 0,005 нг / мкл раствора.
  7. Собирают реакции в трех повторностях в общем объеме 20 мкл на реакцию с использованием кДНК, эквивалентной 0.05 ооцитов в качестве субстрата, или 5 мкл серийных разведений кДНК гранулезных клеток, 10 мкл зеленого супермикса SYBR и 0,3 мкМ каждого конкретного праймера ( Таблица 1 ).
  8. Проведите реакцию в термоциклере с использованием трехстадийного протокола: 95 ° C в течение 30 секунд, 60 ° C в течение 30 секунд и 72 ° C в течение 20 секунд, повторяя 40 раз. Наконец, приобретите кривую плавления, начиная с 60 ° C, и увеличивайте температуру на 0,5 ° C каждые 20 секунд до 95 ° C.
  9. Оценить начальное количество (SQ) конкретной мРНК в образцах ооцитов с использованием стандартной кривойF "> 15, рассчитанной на основе выборки клеток гранулезы. Выразите данные как отношение между SQ интересующего гена и SQ генов хозяйствования.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Исходные данные этих экспериментов были подробно описаны ранее 7 и приведены здесь в качестве примера результатов, которые могут быть получены с использованием описанных протоколов.

Скорость созревания

Из 32 КОК, извлеченных OPU из доминантных фолликулов, 28 (88%) находились на стадии MII. Четырнадцать из 58 КОК, собранных из фолликулов размером 5-25 мм, немедленно замораживались как незрелые ооциты для исследования экспрессии мРНК. Остальные 44 были in vitro созревшими, а 37 достигли стадии MII (85%). Эффективность созревания существенно не различалась в двух группах (точный критерий Фишера P> 0,05).

Коэффициент анеуплоидии

Чтобы изучить, может ли IVM caN нарушают точное хромосомное разделение между вторичным ооцитом и первым полярным телом, подсчитывалось число хромосом на стадии MII, так как оно представляет результат сегрегации хромосом во время мейоза I. Как показано на фиг. 1A , анти-Aurora B Фосфо-Thr232 антитела специфически окрашивали центромерную область в ооцитах лошади, позволяя подсчитать количество хромосом. In vitro -озрелые ооциты были значительно более подвержены анеуплоидии (5/11) по сравнению со зрелыми ооцитами in vivo (0/12, точный критерий Фишера, P <0,05, фиг.1B ). Большинство анеуплоидных ооцитов (4/5) были гиперплоидными; Следовательно, скорость анеуплоидии не является результатом артефактов при приготовлении образца, определяющего хромосомную потерю, как это происходит при хромосомных спредах. Иммуноокрашивание центромерной области также было предпринято с антителами против CENPA и анти-AURKB, но сигнал не был визенВ обоих случаях (данные не показаны).

Морфология веретена и ацетилирование H4K16

Измерялись длина шпинделя от полюса к полюсу и диаметр шпинделя при максимальной ширине, как показано на рисунке 2 . Согласно этим измерениям, ооциты in vitro были значительно длиннее (19,89 ± 1,15 мкм) и более широкие (17,28 ± 0,81 мкм) по сравнению со зрелыми ооцитами in vivo (14,57 ± 1,7 мкм в длину и 13,56 ± 0,91 мкм в диаметре, -тест, Р <0,05). На тех же образцах был также измерен уровень глобального ацетилирования H4K16, подтвердивший, что ацетилирование при H4K16 было значительно ниже в ооцитах IVM по сравнению с их аналогами in vivo ( рисунок 2 , красный).

Выражение tranСкрипты, кодирующие гистон-ацетилтрансферазы и деацетилазы

Определяли ли q-ПЦР экспрессию генов, участвующих в процессе ацетилирования гистонов-деацетилирования, в in vitro -озрелых ооцитах. Гистонацетилтрансфераза 1 ( HAT1 ), K-ацетилтрансфераза 8 (KAT8 ), гистондезацетилаза 1 ( HDAC1 ) и NAD-зависимая деацетилаза белка sirtuin 1 ( SIRT1 ) были определены как предполагаемые мишени. Значительные различия в экспрессии этих транскриптов в незрелых, созревших in vitro и in vivo зрелых ооцитах не наблюдались, независимо от используемой нормализации. В частности, результаты анализа экспрессии транскриптов, представленные на фиг. 3 , вычисляли по стандартной кривой с использованием метода SQ и нормировали на хозяйственную глицеральдегид-3-фосфатдегидрогеназу ( GAPDH ). Аналогичным образом,Наблюдались, когда результаты, где нормировались на всплеск люциферазы или когда использовался метод ΔΔct (не показан).

цель Fw-праймер Rv-праймер Размер ампикона
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 п.о.
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 п.о.
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 б.п.
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
люциферазы TCATTCTTCGCCAAAAGCACTCTG д> AGCCCATATCCTTGTCGTATCCC 148 б.п.
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Таблица 1: Стержень праймера. Для каждого анализируемого транскрипта дана последовательность 5 '> 3' праймеров (Fw) и (Rv) и ожидаемый размер ампликона: глицеральдегид-3-фосфатдегидрогеназа ( GAPDH ) , гистонацетилтрансфераза 1 ( HAT1 ) , гистон Дезацетилазы 1 ( HDAC1 ) , K-ацетилтрансферазы 8 ( KAT8 ) , люциферазы и NAD-зависимой белковой деацетилазы sirtuin 1 ( SIRT1 ). Перепечатано с разрешения от ссылки 7 .

/55242fig1.jpg "/>
Рисунок 1: Aneuploidy Rate в In Vivo- и In Vitro - здоровые ооциты лошади. ( A ) Типичные изображения, показывающие окраску aurora B phospho-Thr232 (красный) и ДНК (зеленое) ооцита лошади MII, обработанного монастролом. Показан эуплоидный ооцит (32 хромосомы). Шкала шкалы = 5 мкм. ( B ) Гистограмма представляет распределение эуплоидных и анеуплоидных ооцитов с MII стадией in vivo (n = 12) и in vitro (n = 11) зрелых ооцитов. * Указывает на значительную разницу в скорости анеуплоидии (точный критерий Фишера, Р <0,05). Перепечатано с разрешения ссылки 7. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2 Рисунок 2: Измерение шпинделя и ацетилирование H4K16 в ооцитах, выращенных in vivo и in vitro . Типичные изображения, показывающие тубулин (зеленый), ацетилированный H4K16 (красный) и ДНК (синий) в ооцитах MII после созревания in vivo (n = 4) или in vitro (n = 14). На изображениях тубулина показаны оси, используемые для измерения длины и диаметра шпинделя. Шкала шкалы = 5 мкм. Изменено из ссылки 7 . Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 3
Рисунок 3: Выражение KAT8 , SIRT1 , HAT1 , И HDAC1 в ИмматуRe, In Vivo , И in vitro созревших ооцитов. Гистограммы представляют среднее ± SEM относительной экспрессии мРНК KAT8 , SIRT1 , HAT1 , И HDAC1 , Выраженное как начальное количество (SQ) представляющего интерес транскрипта по сравнению с SQ GAPDH , используемого в качестве домашнего хозяйства. Статистических различий между незрелыми (GV, n = 14), in vivo (n = 14) и in vitro (n = 12) зрелыми ооцитами (одностороннее ANOVA, P > 0,05) не наблюдалось. Перепечатано с разрешения от ссылки 7 . Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Несмотря на то, что IVM был проведен на лошадях более 20 лет 16 , мы еще не знаем, может ли ооцит быть источником эмбриональной анеуплоидии, как это было предложено для людей 17 . Причина, вероятно, в том, что приготовление спредов ооцитов для подсчета хромосом приводит к значительной потере образца. Имея это в виду, был проведен обзор методов, используемых для исследования ошибок в сегрегации хромосом, для поиска наиболее подходящей методики, применяемой к ооцитам лошадей. В научной литературе были найдены четыре основных метода: 1) хромосомные спрэды 5 , 18 , 19 , 2) флуоресцентная гибридизация in situ (FISH) 4 , 6 , 17 , 20 , 3) центромерное число на веретенообразных коллапсированных веретенах , 14 , 21 , 22 и 4) хромосомное флуоресцентное окрашивание без учета числа хромосом 23 , 24 , 25 .

Как уже упоминалось, получение хромосомных спредов с последующим окрашиванием по Гимзе осложняется высокой скоростью потери пробы. Этот метод во многих случаях был заменен FISH, который использует специальные зонды для картирования разных хромосом. Недостатком методик FISH является то, что при использовании небольшого количества зондов вероятность ложного отрицательного результата может увеличиться ( т.е. идентифицировать как нормальную клетку, которая является анеуплоидной, потому что отсутствующая или нештатная хромосома не исследована). Поэтому надежное использование FISH основывается в основном на знаниях априорно о хромосомах, которые чаще подвержены анеуплоидии ( например,., Хромосома 21 у людей). FISH ранее использовался для исследования хромосомных аномалий у эмбрионов лошадей с использованием 2 зондов, против хромосомы 2 и хромосомы 4 20 . Согласно этим экспериментам, в ядрах in vitro , продуцирующих эмбрионы, более вероятно, будут влиять хромосомные аномалии, чем in vivo продуцируемые эмбрионы. Это открытие согласуется с данными, приведенными выше, с использованием метода monastrol-collapse в ооцитах IVM. Однако частота анеуплоидии в ооцитах IVM была даже выше, чем при использовании FISH у эмбрионов in vitro 20 . Это частичное несоответствие может быть объяснено тем фактом, что для экспериментов FISH использовались только два хромосомных зонда. Этот подход, возможно, недооценил частоту анеуплоидии с участием других хромосом, особенно если учесть, что лошади имеют 32 хромосомы. Однако нельзя исключать, что суровоеПлоидии, обнаруживаемые в ооцитах, не поддерживаются у эмбрионов, потому что гаметы, пораженные критическими генетическими аномалиями, могут не развиваться дальше.

Комбинация monastrol лечения, хромосомы и центромеры окрашивания и конфокальной микроскопии позволило последовательное подсчет числа хромосом в MII-стадии ооцитов лошади с минимальной потери образца. Техническое ограничение, возникшее при разработке этой техники для ооцитов лошадей, заключалось в наличии специфичных к лошади антител. Перед использованием Aurora B phospho- (Thr232) два других антитела (анти-Aurora B и anti-CENPA) не вызывали центромерного окрашивания. Примечательно, что анти-Aurora B и anti-CENPA уже успешно использовались в бычьих и человеческих клетках 26 , 27 , 28 ; Поэтому был сделан вывод, что они не специфичны для лошади. Этот метод также может быть ограничен доступностью конфокального лазерного сканераМикроскоп и программное обеспечение для анализа изображений. Кроме того, слепое подсчет двумя независимыми операторами имеет важное значение для исключения вызванных оператором артефактов. Несмотря на то, что хромосомный счет монастрола-сплюснутого веретена представляет собой подход, который лучше сохраняет морфологию клетки и предотвращает потерю образца, этот метод позволяет только наблюдать различия в основном числе хромосом; Он не является информативным в отношении других хромосомных аномалий ( например, транслокаций, сегментных обменов и т. Д.), Которые могут быть выявлены при кариотипировании, а в некоторых случаях и при FISH.

Ошибки в сегрегации хромосом также изучались с помощью веретенообразной и хромосомной иммунофлуоресценции без учета хромосомного числа 23 , 24 , 25 . В этом случае веретена с серьезными аномалиями и отстающими или рассеянными хромосомами считаются признаками неустойчивой хромосомыМеня сегрегации. Соответственно, хромосомы, которые были рассеяны из веретена, наблюдались в созревших in vitro ооцитах 7 (класс, который более подвержен воздействию анеуплоидии). Однако хромосомный счет имеет то преимущество, что позволяет передавать количественную информацию.

Таким образом, по сравнению с другими описанными методиками использование monastrol и центромерного окрашивания имеет преимущество в том, что предотвращает потерю образца, сводит к минимуму количество ошибочных негативов и поддается количественному определению.

Изменение эпигенетических модификаций было предложено в качестве возможного механизма начала анеуплоиии ооцитов 18 , 24 , 25 . Используя тройное флуоресцентное пятно, можно было визуализировать и измерить мейотическое веретено и наблюдать отстающие / рассеянные хромосомы. В то же время, благодаря разработке антител, которыеРаспознать специфические модификации остатков, уровень ацетилирования H4K16 был проведен на том же образце. Этот подход служил двойной цели - уменьшить количество ооцитов, необходимых для анализа, и соотнести ацетилирование Н4 с морфологией веретена.

Количественное определение модификаций ковалентного белка может быть выполнено вестерн-блоттингом. Однако этот метод требует большего размера выборки и не сохраняет целостность образца для морфологических исследований. Метод тройного флуоресцентного окрашивания можно применять к другим модификациям гистонов и, потенциально, к любому белку, который может быть распознан различными вторичными антителами 8 ; Единственным ограничивающим фактором является наличие специфичных для лошади антител. В этом контексте авторы надеются, что привлечение внимания к модели лошади повысит интерес к исследованию основных биологических механизмов у этого вида и, следовательно, в развитииСпециальных инструментов.

Наконец, также описано исследование экспрессии мРНК, кодирующих гистондеацетилазы (HDACs) и ацетилтрансфераз (HATs), проводимых с помощью обратной транскрипции и количественной PCR (q-PCR). Q-ПЦР - широко распространенный метод; Однако его использование для ооцитов лошадей не является диффузным. Важно указать, что из-за общего молчания транскрипционной активности во время созревания ооцитов 29 анализ суммарного количества транскриптов может выявить только стабильность или деградацию мРНК на этом фоне 30 , 31 . Различий в относительной экспрессии транскриптов между созреванием in vitro и in vivo не наблюдалось. Эти результаты указывают на то, что IVM может влиять на правила трансляции и посттрансляции, указывая на необходимость разработки других экспериментальных подходов, направленных на исследование трансляционных и poSt-поступательные механизмы на уровне отдельных клеток.

В целом, настоящее исследование описывает экспериментальный подход к морфологическим и биохимическим характеристикам ооцитов лошадей. Этот подход может быть применен к ооцитам других видов, которые также подвержены влиянию низкой скорости извлечения, включая людей или находящихся под угрозой исчезновения видов. Эти исследования расширят наши знания о репродуктивной биологии млекопитающих и будут способствовать пониманию бесплодия.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Авторы хотели бы поблагодарить Фабриса Винсента за поддержку лазерной сканирующей конфокальной микроскопии (LSCM) , а также Филиппа Барьера и Тьерри Бларда за ежедневное ультразвуковое сканирование яичников и инъекцию ХГЧ. Эта работа была частично поддержана проектом "Regione Sardegna and Regione Lombardia" "Ex Ovo Omnia" (Грант № 26096200 по борьбе с отмыванием денег); «Стипендия L'Oreal Italia per le Donne e la Scienza 2012» (контракт от 2012 года до FF), FP7-PEOPLE-2011-CIG, Исполнительное агентство по исследованиям (REA) «Pro-Ovum» (грант № 303640 по VL); И Постдокторской школой земледелия и ветеринарной медицины, финансируемой совместно с Европейским социальным фондом, Секторальная оперативная программа развития людских ресурсов на 2007-2013 годы (контракт № POSDRU / 89 / 1.5 / S / 62371 для IM). Сбор яйцеклеток in vivo финансировался Институтом французского языка им. Шеваля и Эквивалента.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Анализ сегрегации хромосом, ацетилирование гистонов и морфология веретена в ооцитах лошадей
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter