Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

At Oositlerinde Kromozom Ayrımı, Histon Asetilasyonu ve İşmili Morfolojisi Analizi

doi: 10.3791/55242 Published: May 11, 2017

Summary

Bu el yazması, at oositlerini morfolojik ve biyokimyasal olarak karakterize eden deneysel bir yaklaşımı anlatmaktadır. Özellikle mevcut çalışma, ultrason kılavuzluğundaki ovum toplama (OPU) ile olgunlaşmamış ve olgun ata oositlerinin nasıl toplanacağını ve kromozom ayrımını, iğ morfolojisini, küresel histone asetilasyonunu ve mRNA ekspresyonunu nasıl araştıracağını göstermektedir.

Abstract

Yardımlı üreme alanı kadınlar, eşlik eden hayvanlar ve nesli tükenmekte olan türlerde infertiliteyi tedavi etmek için geliştirilmiştir. Atta, yardımlı üreme, yüksek meslek sahiplerinden, spor kariyerine ara vermeden embriyoların üretilmesine olanak tanır ve yüksek genetik değerdeki kısraktan tüy sayısındaki artışa katkıda bulunur. Mevcut yazıda, yumurtalık toplama (OPU) kullanılarak at yumurtalıklarında olgunlaşmamış ve olgunlaşmış oositlerin toplanması için kullanılan prosedürler açıklanmaktadır. Bu oositler daha önce farelerde geliştirilen bir protokolü uyarlayarak anöploidite insidansını araştırmak için kullanıldı. Spesifik olarak, kromozomlar ve metafaz II (MII) oositlerinin santromerleri floresan olarak etiketlendi ve konfokal lazer mikroskop taramasından sonra ardışık odak planlarında sayıldı. Bu analiz, olgunlaşmamış oositler folliküllerden toplandığında ve in vitro olarak olgunlaştığında anöploidi oranının daha yüksek bir insidans olduğunu ortaya koymuşturIn vivo olarak. Tübülin için immün boyama ve spesifik lizin kalıntılarında dört aseton formatlı histon da mayotik iğnün morfolojisinde ve histon asetilasyonunun global modelinde farklılıklar ortaya çıkarmıştır. Son olarak, histon deasetilaz (HDAC) ve asetil transferazları (HAT) kodlayan mRNA'ların ifadesi, ters transkripsiyon ve kantitatif PCR (q-PCR) ile araştırıldı. Transkriptlerin nispi ekspresyonunda in vitro ve in vivo olgunlaşmış oositler arasında herhangi bir fark gözlemlenmedi. Oosit olgunlaşması sırasında transkripsiyonel aktivitenin genel bir susturulması ile uyumlu olarak, toplam transkript miktarının analizi sadece mRNA stabilitesini veya bozunumunu ortaya çıkarabilir. Bu nedenle, bu bulgular, diğer çeviri ve çevirim sonrası düzenlemelerin etkilenebileceğini göstermektedir.

Genel olarak, bu çalışmada morfolojik ve biyokimyasal olarak at oositinin karakterize edilmesine yönelik deneysel bir yaklaşım açıklanmaktadır.Düşük örnek kullanılabilirliği nedeniyle çalışmak son derece zorlu bir yazın. Bununla birlikte, monovulatör türlerde üreme biyolojisi ve infertilite hakkındaki bilgilerimizi genişletebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kadınlar, eşlik eden hayvanlar ve nesli tükenmekte olan türlerde infertiliteyi tedavi etmek için çok sayıda yardımcı üreme tekniği geliştirilmiştir. Klinik ortamdaki en yaygın prosedürlerden biri, ultrason kılavuzluğunda transvaginal aspirasyon, ovum pick-up (OPU) 1 ile yumurtalık folliküllerinden metafaz II (MII) evre oositlerinin alınmasıdır. Bu oositler daha sonra in vitro döllenir (IVF) ve elde edilen embriyo bir alıcı rahime implante edilir. MII evresi (olgun) oositler, eksojen gonadotropinlerin uygulanmasından sonra alınır. Bununla birlikte, bu tedavi, bazı hastalarda, yumurtalık hiperstimülasyon sendromu (OHSS) 2 gelişimi ile ilişkilidir.

Tam olarak yetişmiş olgunlaşmamış oositlerin (GV evresi) folliküllerinden bir kez izole edilmiş mayonezleri kendiliğinden sürdürebilme yeteneğinden faydalanmak suretiyle, idare olmadan olgun oositlerin elde edilmesi mümkündürTering gonadotropin 3 . Bu prosedüre, oosit in vitro olgunlaşma (IVM) denir ve yardımcı üreme teknolojisi için daha az ilaç odaklı, daha ucuz ve daha hasta dostu bir yaklaşım temsil eder. Bununla birlikte, embriyo gelişiminin in vitro olarak değiştirilmiş oositlerle başarısı, genellikle in vivo olgunlaşmış oositlerde 4 , 5 olanlarla karşılaştırıldığında daha düşüktür. Olası bir açıklama , in vitro olgunlaşmış oositlerin kromozom ayrışımındaki hatalar tarafından daha fazla etkilenmesi ve oluşan anöploidinin normal embriyonik gelişimi bozmasıdır.

IVM sırasında kromozomal mis-segregasyonun moleküler temelini anlamak, sonuçta bu tekniğin tam potansiyelini açığa vuracaktır. Bu bağlamda , in vivo matur ile karşılaştırıldığında , in vitro olarak değişime uğramış oositlerin morfolojik ve biyokimyasal özelliklerini araştırmak için kullanılan deneysel yaklaşımEd oositler burada 7,8 tarif edilmiştir. Özellikle, olgunlaşmamış ve olgunlaşmış oositlerin OPU'su ve olgunlaşmamış oositlerin IVM'si için prosedürler, deneysel bir model olarak erişkin ve doğal döngü atları kullanılarak gösterilmektedir. Ardından, kromozom ayrımı, iğ morfolojisi ve bu gametlerde histon asetilasyonunun genel paternini incelemek için immünofloresans ve görüntü analizi kullanılır. Son olarak, ters transkripsiyon ve kantitatif PCR protokolü, mRNA ekspresyonunun analizi için tarif edilmiştir.

Kemirgen hayvan modelleriyle karşılaştırıldığında, atlar genetik manipülasyona izin vermez, manipüle edilmesi daha kolaydır ve pahalı bakım gerektirirler. Bununla birlikte, bu model insan yumurtalık fizyolojisine benzerliği nedeniyle oosit olgunlaştırma 9,10 çalışması için büyük ilgi kazanmaktadır 11,12 </ Sup>. Üstelik, yüksek genetik değere sahip kanatlılardan tüylü hayvan sayısının artmasına olanak tanıyacak şekilde, atın IVM-IVF güvenilir protokollerinin geliştirilmesi önemli bir ekonomik ilgiye sahiptir.

Oositlerde, özellikle de monovulatory türlerde deney yapmanın kısıtlamalardan biri, kısıtlı örneklerin bulunmasıdır. Bu limit, burada, daha önce farelerde geliştirilmiş bir yaklaşımı, örnek kaybını en aza indirgeyen kromozom sayımı yapmak için 13 , 14 atı oositlerine ayarlamakla (diğer mevcut tekniklerle karşılaştırma için tartışmaya bakarak) üstesinden gelinmiştir. Ayrıca, aynı numunede birden fazla analiz yapmak için üçlü flüoresans boyama protokolü optimize edilmiş ve sadece 2 oosit hücrelerinde q-PCR analizleri gerçekleştirilmiştir.

Genel olarak, bu çalışmada morfolojik ve biyokimyasal olarak amaçlanan deneysel bir yaklaşım açıklanmaktadır.Düşük örnek varlığı nedeniyle son derece zorlu bir hücre türü olan at oositini ractere edin. Bununla birlikte, monovulatör türlerin üreme biyolojisi ve infertilitesi hakkındaki bilgilerimizi genişletebilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bütün prosedürler Hayvan Bakımı ve Kullanım Komitesi CEEA Val de Loire Numarası 19 tarafından onaylandı ve Laboratuar Hayvanlarının Bakımı ve Kullanımı için Yol Gösterici İlkelere uygun olarak gerçekleştirildi.

1. Oosit Toplama ve İn Vitro Olgunlaşma

  1. Yumurta alımı
    1. Günlük olarak, erişkin kısrak kohortunda yumurtalık foliküllerinin çapını ultrason ile değerlendirin. ≥33 mm follikülün (dominant folikül) ortaya çıkması üzerine, kısrak jeneri damarının üst kısmına 1,500 IU insan koryonik gonadotropin (hCG) enjekte edin (iv).
      1. Enjeksiyonu yapmadan önce alanı al alkolle sürünüz, boyun sırtı yerini tespit edin ve damarı kaldırmaya teşvik etmek için enjeksiyon yerinin altına başparmak 2-3 cm yerleştirin. İğneyi neredeyse boyuna paralel olarak yerleştirin ve iğnenin damardaki (kanın şırıngaya girdiği) olduğundan emin olmak için aspiratlayın. Bu noktada, enjeksiyon; HCG, mDominant foliküldeki oositin tutuşması.
    2. HCG enjeksiyonundan 35 saat sonra mangal detomidin (15 ug / kg, iv), butorfanol tartrat (10 ug / kg, iv) ve butil-skopolamin bromür (0.2-0.3 mg / kg, 15 mL / mare, iv) ile sedasyona alın.
    3. İğneyi ultrason probuna bağlayın. Ultrason probunu vajinal olarak yerleştirin ve ultrason probuna bakacak şekilde ovaryumu transrektal olarak tutun. Bir operatöre iğneyi manevra etmelerini ve diğerini yumurtalıkları yerinde tutmaya, folikül ultrason probuna bakacak şekilde talimat verin . Baskın follikülü olan yumurtalıktan başlayın.
    4. Vajinal duvarı ve baskın follikülün duvarını iğne ile delin (OPU için ultrason probları bir emme sistemine bağlı iğne için bir kanal ile donatılmıştır); Bu görüntü, eko-grafik görüntüde görünür olacaktır.
    5. Foliküler sıvıyı, emme sistemine bağlı 50-mL konik tüp içinde aspire edin. Konik içeriğini boşaltınTüpünü büyük bir petri kabına koyun ve bir stereomikroskop kullanarak cumulus-oosit kompleksini (COC) arayın.
    6. COC her zaman foliküler sıvı ile alınmadığından, folikülü, 5 IU / mL heparinat 37 ° C içeren Dulbecco'nun değiştirilmiş fosfat tamponlu salin (DPBS) ile yıkayın. Adım 1.1.5'te foliküler sıvı için daha önce tarif edildiği gibi DPBS'yi COC varlığı açısından inceleyin. COC alıncaya kadar birkaç kez yıkayın.
    7. Baskın foliküldeki KOK geri alındığında, adımlar 1.1.3-1.1.4'teki baskın folikül için tarif edildiği gibi, ufak ve ≤25 mm folikülleri delip yıkayın; Folliküller ≥5 ve ≤25, luteinize edici hormon / chiorogonadotropin reseptörü (LHCGR) ifade etmez ve bu nedenle, oositleri hCG'ye yanıt olarak olgunlaşmaz ve GV aşamasında (olgunlaşmamış) toplanacaktır. Sadece kümülüs hücrelerinin ve kahverengi, ince tanelenmiş ooplazmın birkaç komple katmanı ile KOK'leri saklayın. Diğerlerini atın.
    8. OPU'nun sonunda,Enfeksiyonu önlemek için kısrak benzil-penisilin 15.000 IU / hayvan ile alın.
    9. Arı en az 2 saat sakin, temiz bir karanlıkta muhafaza edin. Bilincini, kulakların yerini belirleyerek, uyaranlara tepki ( örneğin gürültü) belirleyerek ve kısrak diğer hayvanların şirketlerine geri göndermeden önce kontrol edin.
  2. İn vitro olgunlaşma
    1. 1,790 IU / L heparin,% 0.4 sığır serumu albumin (BSA), penisilin ve streptomis ile 37 ° C'ye tamamlanan sıcak HEPES tamponlu TCM199 (20 mM Hepes). Bu aracı önceden hazırlayın. Filtre ile sterilize edin ve 4 ° C'de 6 aya kadar tutun.
    2. 50 ng / mL epidermal büyüme faktörü (EGF) ve% 20 buzağı serumu 7 ile NaHC03-tamponlu TCM199 (25 mM NaHC03) takviye ederek IVM ortamı hazırlayın. Yeni bir şişe açıldıktan sonraki 3 hafta içinde NaHCO 3 ile tıkanmış TCM199'u kullanın. EGF'yi önceden 100x stok olarak hazırlayın, -20 ° C'de dondurunVe 6 ay içinde kullanın. 4 yuvalı çanağın oyuklarına 500 mcL dağıtır ve nemlendirilmiş havada% 5 CO 2 ile en az 2 saat boyunca 38.5 ° C'de inkübe edin.
    3. COC'lerin ≥5 ve ≤25 mm folliküllerden alınmasından sonra, bunları 2 mL HEPES-TCM199 ile doldurulmuş bir petri kabına (3,5 cm çapında) yerleştirin. Hücrenin enkazını temizlemek için KOK'ları çanağın farklı alanlarına taşıyın.
    4. COC'leri IVM ortamına aktarın ve 38.5 ° C'de% 5 CO 2 ile nemli havada 28 saat inkübe edin.

2. İmmünofloresans ve Görüntü Analizi

  1. Kromozom sayısı
    1. Baskın follikülden toplama veya IVM'nin sonunda, COC'leri 100 uM monastrol ile 1 saat süreyle% 5 CO 2 ile nemlendirilmiş havada 38.5 ° C'de inkübe edin. Monastrolü 100x stok olarak önceden hazırlayın ve 1 yıla kadar -20 ° C'de saklayın.
    2. Kümülüs hücrelerini kaldır% 0.5 hiyalüronidaz ile tedavi ederek veya hafifçe pipetle vererek; Zona pellucida'yı% 0.2 pronaz içinde muamele ederek çıkarın. Hyaluronidaz ve pronase önceden 10x stok olarak hazırlayın ve bunları -20 ° C'de 1 yıla kadar depolayın.
    3. 38.5 ° C'de 15 dakika süreyle DPBS'de% 4 paraformaldehit içinde oositleri sabitleyin, ardından 4 ° C'de 45 dakika bekletin.
      DİKKAT! Paraformaldehidi tutarken kişisel koruyucu ekipman giyin ve kirlenmiş malzemeleri tehlikeli atık imha etme esaslarına uygun olarak atın.
    4. Oositleri,% 0.1 polivinil alkol (PVA) ile takviye edilmiş 500 μL DPBS ile dolu 3 kuyucuk içinde sırayla aktararak yıkayın. Oda sıcaklığında (RT) 10 dakika% 0.3 Triton X-100 içinde geçirgen hale getirin.
    5. RT'de en az 30 dakika boyunca% 1 sığır serum albümini (DPBS-1% BSA) ve% 10 normal eşek serumu ile takviye edilmiş DPBS'de inkübasyon ile spesifik olmayan bağlanmayı bloke edin. Numuneler engelleme çözeltisinde 4 ° C'de 3-4 gün tutulabilir.
    6. Primer boyama için, tavşan anti-Aurora B fosfo-Thr232'deki oositleri% 1 BSA (seyreltme 1:50) ile takviye edilmiş DPBS'de gece boyunca 4 ° C'de inkübe edin.
    7. Oositleri adım 2.1.4'te açıklandığı şekilde yıkayın. Oositleri karanlıkta oda sıcaklığında 1 saat boyunca tetra-metil-noramin izotiosiyanat (TRITC) -conjuge eşek anti-tavşan IgG (DPBS-1% BSA içinde 1: 100) solüsyonunda inkübe edin.
    8. Oositleri adım 2.1.4'te tarif edildiği gibi yıkayın ve 3-4 oosit, bir cam slayt üzerinde 20 uM YOPRO1 ile takviye edilmiş, sertleşmeyen, anti-solmaya karşı sabitleme maddesinin bir damlasına yerleştirin. Tüm oositler monte edilinceye kadar işlemi tekrarlayın (slayt başına 3-4 oosit).
    9. Oositlerin montaj ortamında yaklaşık 10 dakika kalmasına izin verin ve daha sonra bir lamel ile örtün. Oositleri ezmeden önlemek için cam slayt üzerinde lamel döşenmeden önce iki taraflı bant iki şerit uygulayın.
      NOT: Bu önlem aynı zamanda tüm numunelerin cam sliDe ve lamelleri. Cam slaytlar -20 ° C'de dondurulabilir ve takip eden 2-3 gün boyunca görüntülenebilir.
    10. Kırmızı (centromeres) ve yeşil (kromozomlar) kanalları 7 , 13 , 14 , 20 , 21 kullanarak bir 60X hedefi olan bir konfokal lazer tarama mikroskopu üzerindeki örnekleri görüntüleyin. Tüm metafazik plakayı kapsayan z-ekseni üzerindeki örnekleri 0.35 μm'lik basamaklarla tarayın. Her planın dijitalleştirilmiş görüntülerini kaydedin.
    11. NIH ImageJ yazılımının hücre sayımı işlevini kullanarak seri konform kesitlerdeki sentromerleri sayın (https://imagej.nih.gov/ij/plugins/cell-counter.html adresinden edinilebilir).
      NOT: Numerik kodlu sıralı bölümlerde görünen, kalacak ve kaybolacak olan sentromerleri tanımlayarak bitişik kesitlerde görünen tekrarlanan sentromer sayımı yapmaktan kaçının.
    12. Kromozomal co yinelemeAdım 2.1.11'de bağımsız bir operatörle açma.
      NOT: Oositleri euploid (32 kromozom), hiperploid (> 32) veya hipoploid (<32) olarak sınıflandırın.
  2. İş mili morfolojisi ve histon asetillenmesi
    1. Baskın follikülden toplama veya IVM'nin sonunda,% 0.2 hiyalüronidaz ile işleme tabi tutarak veya adım 2.1.2'de anlatıldığı gibi nazik pipet ile kümülüs hücrelerini çıkarın.
    2. Adım 2.1.4'te olduğu gibi DPBS-PVA içindeki oositleri yıkayın ve 38 ° C'de 20 dakika süreyle% 2.5 paraformaldehitle sabitleyin. Adım 2.1.4'te tarif edildiği gibi yoğun yıkama yapın ve oda sıcaklığında 5 dakika boyunca% 0.1 Triton X-100 içinde permeabilize edin.
      NOT: Paraformaldehid ile uğraşırken kişisel koruyucu ekipman kullanın ve kirlenmiş malzemeleri tehlikeli atıkların yok edilmesi yönergelerine uygun olarak atın.
    3. % 2 sığır serumu albumin (DPBS -% 2 BSA),% 0.05 saponin ve% 10 normal eşek serumuyla takviye edilmiş DPBS'de inkübasyon ile spesifik olmayan bağlanmayı bloke edinOda sıcaklığında 2 saat.
      NOT: Numuneler engelleme çözeltisinde 4 ° C'de 3-4 gün tutulabilir.
    4. Primer boyama için, gece boyunca 4 ° C'de% 0.05 saponin ile DPBS-2% BSA içinde fare anti-alfa-tubulin (1: 150) ve tavşan anti-acH4K16 (1: 250) oositleri inkübe edin.
    5. Oositleri aşama 2.1.4'te olduğu gibi yıkayın. Oositleri% 0.05 saponin içeren DPBS-2% BSA içinde yeşil floresan boya konjuge eşek anti-fare IgG (1: 500) ve TRITC-konjuge eşek anti-tavşan IgG (1: 100) solüsyonunda 1 saat inkübe edin. Karanlıkta RT.
    6. Oositleri basamak 2.1.4'te olduğu gibi yıkayın ve sonra 3-4 oosit, 1 μg / mL 4 ', 6-diamidino-2-fenilindol (DAPI) ile takviye edilen sertleşmeyen, anti-solmaya karşı sabitleme maddesinin bir damla içine yerleştirin. Bir cam slayt üzerinde.
    7. Adım 2.1.8'de açıklandığı gibi oositleri cam slaytlara monte edin.
    8. Kırmızı (acH4K16), yeşil (alfa-tubulin) ve mavi (DNA) kanalları kullanarak bir 60x objektifli bir konfokal lazer tarayıcı mikroskopta numuneleri görüntüleyin.
      NOT: Kırmızı ve mavi kanalların lazer ayarlarını tüm numunelerin edinimi boyunca sabit tutun. Tüm mayoz iğ ve metafazik plakayı kapsayan z-ekseni üzerindeki örnekleri her 0,35 μm'lik adımlarla tarayın. Sayısallaştırılmış görüntüleri kaydedin (tek planlar ve yansıtılan 3D görüntü).
    9. NIH ImageJ yazılımının ölçüm fonksiyonunu kullanarak, direk kutup başı uzunluğunu ve işmili çapını yansıtılan görüntüdeki maksimum genişlikte ölçün (https://imagej.nih.gov/ij/docs/guide/146-30 html). Her birini 3 kez tekrarlayın ve ortalamayı hesaplayın.
    10. NIH ImageJ yazılımının entegre yoğunluk fonksiyonunu kullanarak acH4K16'nın göreli floresansını hesaplayın (https://imagej.nih.gov/ij/docs/guide/146-30.html). DAPI boyanın entegre yoğunluğu için normalize edin.

3. mRNA Anlatımının Analizi

  1. COC'ler 5 ila 25 mm'lik foliküllerden alındığında, granulosa hücre sPetri kabı içinde kalan ve iki ay süreyle 10,600 xg'de santrifüj edilerek soğuk DPBS'de iki kez yıkayın. Sıvı nitrojende dondurma yapın. Örnekleri -80 ° C'de 6 aya kadar saklayın; Hücreler standart eğri için hizmet edecektir.
  2. Adım 2.1.2'de tarif edildiği gibi olgunlaşmamış (GV), in vitro olgunlaşmış ve in vivo olgunlaşmış oositlerden tüm kümülüs hücrelerini dikkatli bir şekilde çıkarın.
  3. Oositleri, 2.1.4'te açıklandığı gibi, DPBS-PVA'da yıkayın, tekli olarak 1 μL hacimlerde toplayın ve üstte 2 uL RNALater koyun. Sıvı nitrojende sıkıştırın. Örnekleri -80 ° C'de 6 aya kadar saklayın.
  4. Her numuneye 2 pg liziferaz RNA ekleyiniz . Oositleri 2 x 2'ye boşaltın ve küçük numunelerden RNA'yı kurtarmak için uygun bir silika membran filtre bazlı kiti kullanarak toplam RNA özütünü bulunuz.
  5. RNA'yı 10 μL'de 0.25 μg'lik rasgele hekzamerler ve fare ile tersine transkribe edin. Moloney lösemi virüsü ters transkriptaz 37 ° C'de 1 saat süreyle, 176 ° C. Örnekleri -20 ° C'de 6 aya kadar saklayın.
  6. RNAse içermeyen sudaki granulosa hücrelerinden cDNA'yı 50 ng / μL'ye kadar sulandırın. 5 ng / μL, 0,5 ng / μL, 0,05 ng / μL ve 0,005 ng / μL çözeltiler elde etmek için bu çözeltiyi 1: 10 oranında ciddi derecede seyreltin.
  7. Alt tabaka olarak 0.05 oosite eşdeğer cDNA veya granulosa hücre cDNA'sının seri seyreltmelerinden 5 μL, SYBR yeşil supermix'in 10 uL'si ve her bir spesifik primerin 0.3 uM'si kullanılarak tepkime başına tepkime başına toplam 20 μL'lik bir hacim halinde üçlü reaksiyonlar oluşturun Tablo 1 ).
  8. Reaksiyonu 3 aşamalı bir protokolü kullanarak bir termal döngüleyici içinde çalıştırın: 30 saniye için 95 ° C, 30 saniye için 60 ° C ve 40 kez tekrarlanan 20 saniye boyunca 72 ° C. Son olarak, 60 ° C'den başlayarak ergime eğrisini elde edin ve sıcaklığı her 20 saniyede 95 ° C'ye kadar 0,5 ° C artırın.
  9. Oosit numunelerindeki spesifik mRNA'nın başlangıç ​​miktarını (SQ) standart eğriyi kullanarak değerlendirinF "> 15 granulosa hücre örneği temel alınarak hesaplanmıştır. Verileri, ilgi geninin SQ'si ile oda temizleme genlerinin SQ'sı arasındaki oran olarak ifade edin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu deneylerin orijinal bulguları, daha önce 7'de derinlemesine açıklanmıştır ve burada, tarif edilen protokoller kullanılarak elde edilebilen sonuçların bir örneği olarak rapor edilmiştir.

Olgunlaşma oranı

OPU tarafından baskın folliküllerden alınan 32 KOK'un, 28'i (% 88) MII evresindeydi. 5-25 mm boyutlarındaki folliküllerden toplanan 58 COC'ın ondörtü, mRNA ekspresyonu çalışması için olgunlaşmamış oositler olarak derhal donduruldu. Geri kalan 44'ü in vitro olgunlaştı ve 37'si MII evresine (% 85) ulaştı. Olgunlaşma etkinliği iki grup arasında anlamlı farklılık göstermedi (Fisher's exact test P> 0.05).

Anöploidi oranı

IVM'ninNegatif oosit ve ilk kutup vücudu arasındaki sadık kromozomal bölünmeyi bozun, mezoz I sırasında kromozom ayrışmasının sonucunu temsil ettiği için, MII evresindeki kromozom sayısı hesaplanır. Şekil 1A'da gösterildiği gibi, anti-Aurora B Fosfo-Thr232 antikoru at oositlerinde sentromer bölgeyi spesifik olarak boyadı ve birinin kromozom sayısını saymasına izin verdi. In vivo olgunlaşmış oositler (0/12, Fisher's exact test, P <0.05; Şekil 1B ) ile karşılaştırıldığında, in vitro olarak değişen oositler anöploidite (5/11) göre anlamlı derecede daha fazla etkilendi. Anöploid oositlerin çoğunda (4/5) hiperploid vardı; Bu nedenle, anöploidi oranı, kromozomal yayılımda olduğu gibi kromozomal kaybı belirleyen numunenin hazırlanmasında eserlerden kaynaklanmaz. Centromeric bölgenin immüno-boyanması da anti-CENPA ve anti-AURKB antikorları ile denendi ancak sinyal yoktuHer iki durumda da standartlaştırılmıştır (veriler gösterilmemiştir).

İş mili morfolojisi ve H4K16'nın asetillenmesi

Kutup-kutup mili uzunluğu ve mili maksimum genişlikte çapı Şekil 2'de gösterildiği gibi ölçülmüştür. Bu ölçümlere göre, in vitro olarak emprenye edilen oositler, in vivo olgunlaşmış oositlere kıyasla (14.57 ± 1.7 μm uzunluk ve 13.56 ± 0.91 μm çap), eşlenik olmayan oositlere kıyasla belirgin olarak daha uzun (19.89 ± 1.15 μm) ve geniş (17.28 ± 0.81 μm) genişliktedir -test, P <0.05). Aynı numunelerde, H4K16'nın asetillenmesinin in vivo muadillerine kıyasla IVM oositlerde anlamlı olarak daha düşük olduğunu onaylayan, H4K16'nın küresel asetilasyon seviyesi de ölçülmüştür ( Şekil 2 , kırmızı).

Tran ifadesiHiston asetiltransferazları ve deasetilazları kodlayan senaryolar

Histon asetilasyon-deasetilasyon prosesine dahil olan genlerin ekspresyonu , in vitro olarak empoze oositlerde değiştirilip değiştirilmediği q-PCR ile araştırıldı. Histon asetil transferaz 1 ( HAT1 ), K-asetiltransferaz 8 (KAT8 ), histon deasetilaz 1 ( HDAC1 ) ve NAD'ye bağımlı protein deasetilaz yamacı 1 ( SIRT1 ) varsayımsal hedef olarak tanımlandı. Olmayan, in vitro olgunlaşmış ve in vivo olgunlaşmış oositlerde bu transkriptlerin ekspresyonundaki önemli farklılıklar, kullanılan normalizasyondan bağımsız olarak gözlenmedi. Spesifik olarak, Şekil 3'te bildirilen transkript ekspresyon analizinin sonuçları SQ yöntemini kullanarak standart bir eğriye göre hesaplandı ve oda temizliği gliseraldehid-3-fosfat dehidrojenaz ( GAPDH ) için normalize edildi. Benzer şekilde, fark yokSonuçlar, lusiferazdaki yükselme için normalleştirilmiş sonuçlar veya ΔΔct yöntemi kullanıldığında (gösterilmemiştir) gözlendi.

Hedef Fw astar Rv astar Amplicon boyutu
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
Lusiferaz TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1'in GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tablo 1: Astar kümeleri. Gliferaldehit-3-fosfat dehidrojenaz ( GAPDH ) , histon asetil-transferaz 1 ( HAT1 ) , histone ( GAPDH ) , ileriye doğru (Fw) ve (Rv) primerlerinin 5 '> 3' dizisi ve beklenen amplikon boyutu analiz edilen her transkript için verilmiştir. Deasetilaz 1 ( HDAC1 ) , K-asetiltransferaz 8 ( KAT8 ) , lusiferaz ve NAD'ye bağımlı protein deasetilaz yam bandı 1 ( SIRT1 ). Referans izniyle basılır 7 .

/55242fig1.jpg "/>
Şekil 1: Vivo- ve In vitro özellikli At Oositlerinde Anöploidi Oranı. ( A ) Monastrol ile tedavi edilen bir MII evresi atı oositinin aurora B fosfo-Thr232 (kırmızı) ve DNA (yeşil) boyanmasını gösteren temsili resimler. Bir euploid oosit (32 kromozom) gösterilir. Ölçek çubuğu = 5 μm. ( B ) Çubuk grafik , in vivo (n = 12) ve in vitro (n = 11) olgunlaşmış oositte euploid ve anöploid MII evresi oositlerinin dağılımını göstermektedir. * Anöploidi hızında belirgin bir farklılık olduğunu gösterir (Fisher's exact test, P <0.05). Referanstan izin alınarak yayımlanmaktadır. 7. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız .

şekil 2 Şekil 2: Vivo- ve In Vitro Değiştirilmiş At Oositlerinde İğ Ölçümü ve H4K16 Asetilasyonu. MII oositlerinde in vivo (n = 4) veya in vitro (n = 14) olgunlamadan sonra tubulin (yeşil), asetilatlanmış H4K16 (kırmızı) ve DNA (mavi) gösteren temsili resimler. Tübülin görüntüleri, işmili uzunluğu ve çap ölçümleri için kullanılan eksenleri göstermektedir. Ölçek çubuğu = 5 μm. Referans 7'den değiştirildi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 3
Şekil 3: KAT8, SIRT1 , HAT1 , Ve Immatu'da HDAC1Yeniden, In vivo , Ve In Vitro Olgunlaşmış Oositler. Çubuk grafikler, KAT8 , SIRT1 , HAT1 , Ve HDAC1 , GAPDH'nin SQ'sine kıyasla, ilgi alanı transkriptinin başlangıç ​​miktarı (SQ) olarak ifade edildi ve bunlar oda temizliği olarak kullanıldı. Olgunlaşmamış (GV, n = 14), in vivo (n = 14) ve in vitro (n = 12) olgunlaşmış oosit arasında istatistiksel olarak bir fark gözlenmedi (tek yönlü ANOVA, P > 0.05). Referans izniyle basılır 7 . Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

IVM, atlarda 20 yıldan fazla bir süredir gerçekleştirilmiş olsa da 16 , oositin embriyonik anöploidinin kökeni olup olamayacağını henüz bilemiyoruz, çünkü insanlar için önerilmişti 17 . Bunun nedeni muhtemelen kromozom sayımı için oosit yayılımının hazırlanmasının önemli numune kaybına yol açmasıdır. Bu düşünceyle, at oositlerine en uygun tekniği bulmak için kromozom ayrımındaki hataları araştırmak için kullanılan yöntemlerin araştırılması gerçekleştirildi. Bilimsel literatürde dört temel teknik bulundu: 1) kromozomal yayılımlar 5 , 18 , 19 , 2) floresan yerinde hibridizasyon (FISH) 4 , 6 , 17 , 20 , 3) monastrol çökertilmiş iğler üzerinde sentromere sayısı , 14 , 21 , 22 ve 4) kromozom sayısı 23 , 24 , 25 olmayan kromozom floresan boyama.

Daha önce belirtildiği gibi, Giemsa boyaması ile takip edilen kromozomal yayılımların hazırlanması, yüksek bir numune kaybı oranında karmaşıktır. Bu yöntem birçok durumda, farklı kromozomları haritalamak için özel problar kullanan FISH ile değiştirildi. BALIK tekniklerinin bir dezavantajı, az sayıda prob kullanıldığında yanlış negatif insidansının artması olabilir ( yani, eksik veya süpernümerik kromozom araştırılmadığı için anöploid olan normal bir hücre belirlenmesi). BALIK'IN güvenilir kullanımı, çoğunlukla, anöploididen daha sık etkilenen kromozomların a priori bilgisine dayanmaktadır ( örn.., Insanlarda kromozom 21). BALIK, at embriyolarındaki kromozomal anomalileri 2 sondalı kromozom 2 ve kromozom 4 20'ye karşı araştırmak için daha önce kullanılmıştır. Bu deneylere göre , in vitro üretilen embriyoların çekirdeklerinin, in vivo üretilen embriyolara kıyasla , kromozomal anomalilerden etkilenme olasılığı daha yüksektir. Bu bulgu, IVM oositlerinde monastrol-çöküş yöntemi kullanılarak yukarıda bildirilen gözlem ile uyumludur. Ancak IVM oositlerinde anöploidi görülme sıklığı , in vitro üretilen 20 embriyoda FISH kullanarak bildirilenlerden daha yüksekti. Bu kısmi uyumsuzluk, FISH deneyleri için sadece iki kromozom spesifik sondanın kullanılması gerçeği ile açıklanabilir. Bu yaklaşım, diğer kromozomları içeren anöploidinin görülme sıklığını, özellikle atların 32 kromozom bulunduğunu düşündüğünde olduğundan daha az tahmin etmiş olabilir. Bununla birlikte, ağır anevrininOositlerde saptanabilen ploidler embriyoda tutulmaz çünkü kritik genetik anormalliklerden etkilenen gametler daha da gelişmeyebilir.

Monastrol tedavisi, kromozom ve sentromere boyama ve konfokal mikroskopi kombinasyonu, minimal numune kaybıyla MII-aşaması at oositlerinde kromozom sayısının tutarlı sayımına izin verdi. At oositleri için bu tekniğin geliştirilmesinde karşılaşılan teknik sınırlama ata spesifik antikorların bulunmasıydı. Aurora B fosfo- (Thr232) kullanmadan önce iki diğer antikor (anti-Aurora B ve anti-CENPA) sentromerik bir leke üretmedi. Özellikle, anti-Aurora B ve anti-CENPA sığır ve insan hücrelerinde başarıyla kullanılmıştır 26,27,28; Bu nedenle, atın kendine özgü olmadığı sonucuna varılmıştır. Bu teknik aynı zamanda bir konfokal lazer scAnning mikroskop ve görüntü analiz yazılımı. Ayrıca, iki bağımsız operatör tarafından kör sayma, operatörün neden olduğu eserleri hariç tutmak için şarttır. Bir monastrol çökmüş iğin kromozom sayısı, hücrenin morfolojisini daha iyi koruyan ve numunenin kaybını önleyen bir yaklaşım olsa da, bu teknik sadece temel kromozom sayısındaki farklılıkların gözlemlenmesine izin verir; Karyotipleme ve bazı durumlarda FISH ile ortaya çıkabilen diğer kromozomal anormallikler ( örneğin translokasyonlar, segmental kavşaklar, vb. ) Hakkında bilgilendirici değildir.

Kromozom ayrımındaki hatalar, kromozom sayısı 23 , 24 , 25 olmadan iğ ve kromozom immünfloresan ile araştırılmıştır. Bu durumda, ciddi anormallikler ve geride kalan veya dağılmış kromozomlardaki iğler, düzensiz kromozomun işareti olarak kabul edilirBen ayrımcılık. Buna göre, in vitro olgunlaşmış oositlerde ( 7 , anöploididen daha fazla etkilenen sınıf), iğden dağılmış olan kromozomlar gözlemlendi. Bununla birlikte, kromozom sayımı, nicelenebilir bilginin iletilmesi avantajına sahiptir.

Özetle, açıklanan diğer tekniklerle karşılaştırıldığında, monastrol ve sentromere boyamanın kullanılması numune kaybını önleme, yanlış negatiflerin görülme sıklığını minimuma indirme ve ölçülebilir olma avantajına sahiptir.

Epigenetik modifikasyonların değişimi, oosit anöploidinin başlangıcında olası bir mekanizma olarak önerilmiştir ( 18 , 24 , 25) . Üçlü flüoresan bir leke kullanarak mayotik iğnizi görselleştirmek ve ölçmek ve gecikmeli / dağınık kromozomlar izlemek mümkün olmuştur. Aynı zamanda antikorların geliştirilmesi sayesindeBelirli kalıntı değişikliklerini tanıyarak, H4K16'nın asetilasyon seviyesi aynı numunede gerçekleştirildi. Bu yaklaşım, H4 asetilasyonunu iş mili morfolojisi ile ilişkilendirmek ve analiz etmek için gerekli olan oosit miktarını azaltmak için iki amaca hizmet etti.

Kovalent protein modifikasyonlarının nicelendirilmesi Western leke ile gerçekleştirilebilir. Bununla birlikte, bu teknik, daha büyük numune boyutları gerektirir ve morfolojik çalışmalar için numunenin bütünlüğünü muhafaza etmez. Üçlü flüoresan boyama yaklaşımı, diğer histone modifikasyonlarına ve potansiyel olarak farklı ikincil antikorlar 8 tarafından tanınabilen herhangi bir proteine ​​uygulanabilir; Tek sınırlayıcı faktör ata özgü antikorların bulunmasıdır. Bu bağlamda, yazarlar, at modeline dikkat çekmenin, bu türdeki temel biyolojik mekanizmaların araştırılmasına olan ilgiyi artıracağını ve bu nedenle gelişmede umutlanmasını umuyoruzÖzel araçlar ile.

Son olarak, ters transkripsiyon ve kantitatif-PCR (q-PCR) ile gerçekleştirilen histon deasetilazları (HDAC'lar) ve asetil-transferazları (HAT) kodlayan mRNA'ların ekspresyon çalışması da tarif edilmektedir. Q-PCR yaygın olarak kullanılan bir tekniktir; Bununla birlikte, at oositleri için kullanımı yaygın değildir. Oosit olgunlaştırması sırasında transkripsiyonel aktivitenin genel olarak silinmesi nedeniyle, 29 , toplam transkript miktarının analizi, bu arka planda 30 , 31 mRNA stabilitesini veya bozunmasını ortaya çıkarabilir. In vitro ve in vivo olgunlaşma arasındaki transkriptlerin göreceli ekspresyonundaki farklılıklar gözlemlenmemiştir. Bu bulgular, translasyonel ve post-translasyonel düzenlemelerin IVM'den etkilenebileceğini göstermektedir ve translasyonel ve po'nun araştırılmasına yönelik diğer deneysel yaklaşımların geliştirilmesine duyulan ihtiyacı vurgulamaktadırTek hücreli düzeyde st-translasyonel mekanizmalar.

Genel olarak, bu çalışma, at oositlerini morfolojik ve biyokimyasal olarak karakterize eden deneysel bir yaklaşımı tanımlamaktadır. Bu yaklaşım, insanlar veya nesli tükenmekte olan türler dahil olmak üzere, düşük bir iyileşme oranından benzer şekilde etkilenen diğer türlerin oositlerine uygulanabilir. Bu çalışmalar, memeli üreme biyolojisi konusundaki bilgilerimizi genişletecek ve infertilitenin anlaşılmasına katkıda bulunacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Yazarlar Fabrice Vincent'a lazer tarama konfokal mikroskobu (LSCM) desteği ve Philippe Barrière ve Thierry Blard'a günlük ultrasonlu ovarian tarama ve hCG enjeksiyonu yapmaları için teşekkür etmek istiyorlar. Bu çalışma kısmen "Regione Sardegna ve Regione Lombardia" projesi "Ex Ovo Omnia" (Grub no 26096200, AML'ye) tarafından desteklendi; "2012 Olimpiyatları İçin L'Oreal Italia" bursu (Sözleşme 2012'den FF'ye), FP7-PEOPLE-2011-CIG, Araştırma İcra Ajansı (REA) "Pro-Ovum" (Hibe No: 303640'dan VL'ye); Ve Avrupa Sosyal Fonu, 2007-2013 İnsan Kaynaklarının Geliştirilmesi için Sektörel Operasyonel Programı (Sözleşme No. POSDRU / 89 / 1.5 / S / 62371'den IM'ye) tarafından birlikte finanse edilen Doktora Sonrası Tarım ve Veterinerlik Okulu tarafından hazırlanmıştır. In vivo oosit koleksiyonu Institut Français du Cheval et de l'Equitation tarafından finanse edildi.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
At Oositlerinde Kromozom Ayrımı, Histon Asetilasyonu ve İşmili Morfolojisi Analizi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter