Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

المستهدفة doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

أربعة البروتينات هيستون الأساسية H2A، H2B، H3، H4 وتلعب دورا أساسيا في الضغط، والتنظيم، ووظيفة الصبغيات حقيقية النواة. مجموعتين من كل من هذه الهستونات تشكل octamer هيستون، بكرة الجزيئية التي توجه التفاف ~ 147 أزواج قاعدة الحمض النووي حول نفسها، مما أدى في نهاية المطاف إلى تشكيل جسيم نووي 1. جسيم نووي هي مشاركين نشطين في مجموعة متنوعة من العمليات القائمة على كروموسوم، مثل تنظيم النسخ الجيني وتشكيل كروماتين حقيقي والمغاير في الكروموسومات، وعلى هذا النحو تم التركيز من البحوث المكثفة على مدى العقود العديدة الماضية. وقد وصف عدد من الآليات التي يمكن التلاعب بها جسيم نووي في الطرق التي يمكن أن تسهل تنفيذ عمليات محددة - وتشمل هذه الآليات تعديل posttranslational من بقايا هيستون، ATP التي تعتمد على إعادة عرض جسيم نووي، وإعادة تنظيم جسيم نووي ATP مستقلةوالتجمع / التفكيك 2 و 3.

الخميرة في مهدها خميرة الخباز هي قوية ولا سيما نموذج حي لفهم وظيفة هيستون في حقيقيات النوى. ويمكن أن يعزى ذلك إلى حد كبير إلى درجة عالية من الحفظ التطوري من البروتينات هيستون في جميع أنحاء حقيقيات النوى المجال وقابليته للخميرة لمجموعة متنوعة من التجريبية الجينية والبيوكيميائية النهج 4. وقد استخدمت على نطاق واسع نهج عكس الوراثية في الخميرة لدراسة آثار الطفرات هيستون محددة بشأن مختلف جوانب علم الأحياء لونين. لهذه الأنواع من التجارب غالبا ما يكون من الأفضل استخدام الخلايا التي يتم التعبير عنها في الهستونات متحولة من مواضع الجيني الأصلي لها، والتعبير عن البلازميدات مستقلة يمكن أن يؤدي إلى مستويات غير طبيعية داخل الخلايا من البروتينات هيستون (بسبب وجود عدد من البلازميدات متفاوتة في الخلايا) و تغيير يصاحب ذلك من لونين أونvironments، والتي يمكن أن نخلط في نهاية المطاف تفسير النتائج.

هنا، نحن تصف تقنية PCR القائم الذي يسمح لالطفرات الموجهة للجينات هيستون في مواقع الجينومية الأصلية الخاصة بهم والتي لا تتطلب خطوة الاستنساخ والنتائج في جيل الطفرة المطلوبة (ق) من دون بقايا تسلسل الحمض النووي الخارجية في الجينوم. هذا الأسلوب يستفيد من نظام إعادة التركيب مثلي كفاءة في الخميرة، ولها عدة سمات مشتركة مع غيرها من التقنيات المشابهة التي وضعتها المجموعات الأخرى - وأبرزها Delitto بيرفيتو، الجينوم (SSG) الطفرات في مواقع محددة، وخالية استنساخ أليل القائم على PCR طرق استبدال 7. ومع ذلك، فإن تقنية وصفنا لها الجانب الذي يجعل من وبخاصة مناسبة تماما لالطفرات الجينات هيستون. في خلايا الخميرة فرداني، يتم ترميز كل من histones الأساسية الأربعة من قبل اثنين من غير على بعدالجينات llelic والمتجانسة للغاية: على سبيل المثال، يتم ترميز H3 هيستون بواسطة الجينات HHT1 وHHT2، وإطارات القراءة المفتوحة (ORFS) من الجينات هما أكثر من 90٪ مماثلة في التسلسل. هذه درجة عالية من التماثل يمكن تعقيد التجارب المصممة خصيصا لاستهداف واحد من اثنين من جينات ترميز هيستون عن الطفرات. في حين أن الطرق المذكورة أعلاه وغالبا ما تتطلب استخدام بعض ما لا يقل عن تسلسل داخل ORF من الجين المستهدف لحملة إعادة التركيب مثلي، والتقنية وصفنا هنا يجعل من استخدام تسلسل المرافقة ORFS من الجينات هيستون (التي تشترك أقل بكثير تسلسل تناظر) ل الخطوة إعادة التركيب، مما يزيد من احتمال استهداف ناجح من الطفرات إلى مكان المطلوب. وعلاوة على ذلك، يمكن للمناطق متماثلة التي تدفع إعادة التركيب تكون واسعة جدا، مما يسهم في كفاءة إعادة التركيب مثلي المستهدفة.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ملاحظة: استراتيجية تجريبية لالمستهدفة في الموقع الطفرات هيستون الجين تتضمن عدة خطوات (ملخصة في الشكل 1). وتشمل الخطوات التالية: (1) استبدال الجين هيستون الهدف مع الجينات URA3، (2) جيل وتنقية المنتجات PCR المقابلة لاثنين من شظايا متداخلة جزئيا من الجين هيستون الهدف باستخدام بادئات إيواء الطفرة المطلوبة (ق) و (3 ) فيوجن PCR اثنين من شظايا متداخلة جزئيا للحصول على كامل حجم المنتجات PCR للتكامل، (4) المشاركة في التحول من المنتجات PCR بالحجم الكامل والبلازميد العمود الفقري، واختيار علامة على البلازميد، (5) شاشة لمقاومة-5-FOA transformants، (6) تنقية المستعمرات المقاومة لل5 FOA وفقدان البلازميد العمود الفقري، و (7) الجزيئية تحليلات لفحص للاندماج الصحيح للأليل متحولة.

شكل 1
في الموقع الطفرات من الجينات هيستون في مهدها الخميرة. في هذا المثال الجين المستهدف هو HHT2، ولكن يمكن أيضا أي الجينات هيستون الأساسية الأخرى أن mutagenized باستخدام هذه الاستراتيجية. (A) خلايا الخميرة فرداني تؤوي اثنين هيستون جينات ترميز H3 (HHT1 وHHT2) واثنين من الجينات ترميز H4 هيستون (HHF1 وHHF2) مرتبة كما هو مبين في الشكل (توجد جينات HHT1 وHHF1 على الكروموسوم الثاني وHHT2 وتقع الجينات HHF2 في الرابع عشر كروموسوم - في كل حالة على حدة، وتشير الأسهم في الاتجاه من النسخ). في الخطوة الأولى من هذا الإجراء، يتم استبدال ORF من الجين HHT2 مع الجين URA3، مما أدى إلى سلالة hht2Δ :: URA3. (ب) في الجزء 1، يتم استخدام نسخة من النوع البري من الجين HHT2 من عينة الحمض النووي الجيني كقالب لمدة تفاعلات PCR إلى أجناسالشركة المصرية للاتصالات اثنين شظايا متداخلة جزئيا من الجين. التمهيدي العكسي لأول رد فعل يتضمن واحد أو أكثر غير متطابقة النيوكليوتيدات (المشار إليها مع دائرة حمراء) التي تتوافق مع الطفرة المطلوبة (ق) ليتم إدخالها في الجينوم. التمهيدي إلى الأمام للتفاعل الثاني له فمنها ما يعادلها في تكوين تكميلي العكسي (المشار إليها أيضا مع دائرة حمراء). المنتجات PCR اثنين ولدت في الجزء 1 (منتجات أ و ب) يتم استخدامها بعد ذلك نماذج لانصهار PCR باستخدام بادئات أن يصلب لمنتجات أ و ب في الشكل المبين في الجزء 2. وهذا يؤدي إلى توليد كاملة الحجم PCR المنتجات (المنتج ج في جزء 3) بإيواء الطفرة المطلوبة (ق). (ج) hht2Δ :: سلالة URA3 ومن ثم شارك في تحويلها مع المنتجات PCR كاملة الحجم والبلازميد العمود الفقري (ملحوظ على HIS3- البلازميد في هذا المثال)، ويتم اختيار خلايا لوجود البلازميد (على وسائل الإعلام التي تفتقر إلى حistidine في هذا المثال). ثم يتم فحص Transformants لمدة 5-FOA المقاومة - الخلايا المقاومة هي المرشحين لأنه خضع لحدث إعادة التركيب مثلي مما يؤدي إلى تكامل المنتج PCR واستئصال الجين URA3، كما هو مبين. الخسارة اللاحقة من البلازميد العمود الفقري من قبل انقسام الخلية الإنقسامية يؤدي إلى هيستون المطلوب سلالة متحولة النهائي. لقد وجدنا أن اختيار البلازميد العمود الفقري تليها الكشف عن النتائج المقاومة 5 FOA في تردد أعلى بكثير من تحديد أحداث التكامل الصحيحة مقارنة الاختيار المباشر على لوحات 5 FOA، والذي يعرف في الغالب الخلايا التي اكتسبت طفرات URA3 عفوية. (تم تعديل هذا الرقم من مرجع 14). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

1. استبدال هدف هيستون جين مع URA3جينة

  1. أداء قياسي بوساطة PCR-خطوة واحدة تعطيل الجينات استبدال ORF الهدف الجينات هيستون مع الجين URA3 8 و 9.
    ملاحظة: من المستحسن استخدام خلايا الخميرة تحمل ura3Δ0 لأن هذا التحور يزيل URA3 الذاتية كامل ORF، وبالتالي تجنب تكامل المنتج PCR في موضع URA3 8. بدلا من ذلك، K. اللبنية URA3 الجينات يمكن استخدامها بفعالية في توليد استبدال هيستون في أي خلفية ura3 كما هو وظيفي في البيرة س ولكن ليس لديها سوى جزئيا تسلسل تناظر مع الجين البيرة س URA3. وينبغي أيضا أن يكون من سلالة العوز الغذائي للمجمع واحد على الأقل من شأنها أن تسمح للاختيار من البلازميد العمود الفقري في تجربة التحول (راجع الخطوة 4 من هذا البروتوكول). هذه الخطوة غير ضرورية إذا كان geneΔ هيستون الهدف :: URA3سلالة متاح بالفعل.

2. الجيل وتنقية PCR المنتجات الموافق اثنان أجزاء متداخلة جزئيا من الهدف هيستون جين باستخدام الاشعال إيواء الطفرة المرجوة (ق)

  1. توليد منتجات PCR المقابلة لاثنين من شظايا متداخلة جزئيا من الجين هيستون الهدف.
    1. إعداد اثنين من ردود الفعل PCR على النحو التالي:
      1. لتوليد المنتجات PCR الموافق النصف الأول من هذا الجين (منتج في الشكل 1B)، إعداد التفاعل التالي: 1 ميكرولتر قالب الحمض النووي، 5 μl10 ميكرومتر التمهيدي إلى الأمام، 5 μl10 ميكرومتر التمهيدي العكسي 0.5 ميكرولتر (1.25 U) بالحرارة البلمرة DNA، 10 ميكرولتر 5X DNA العازلة البلمرة، 5 ميكرولتر dNTP خليط (2 مم لكل منهما)، و 23.5 ميكرولتر درهم 2 O.
        ملاحظة: قالب الحمض النووي يمكن أن يكون الحمض النووي الجيني المستمدة من سلالة من النوع البري لجين هيستون الهدف معزولة باستخدام الموالية القياسيةcedures 10. لحساب التغيرات في تركيز الحمض النووي ومستوى الشوائب في الأعمال التحضيرية الجينومية مختلفة، فمن المستحسن لتحسين ردود الفعل باستخدام إما الحمض النووي مخفف أو التخفيفات مختلفة من الاستعدادات الجينوم (على سبيل المثال، 1:10 و 1: 100). التمهيدي إلى الأمام يجب أن يصلب إلى منطقة المنبع من الجين المستهدف. التمهيدي العكسي يجب أن يصلب داخل ORF، يكون ~ 40 النيوكليوتيدات في الطول، وتحتوي على الطفرة المرجوة (ق) في مكان ما في المنتصف منه (انظر الشكل 1B-1 وممثل النتائج القسم للحصول على أمثلة). من المستحسن استخدام عالية الدقة البلمرة DNA من أجل الحد من معدلات الطفرات غير مرغوب فيها أثناء تركيب المنتجات PCR.
      2. لتوليد المنتجات PCR الموافق النصف الثاني من هذا الجين (المنتج ب في الشكل 1B)، إعداد رد الفعل كما هو مبين في 2.1.1.1 لكن مع الاشعال مختلفة.
        ملاحظة: الحزب الثوري المؤسسي إلى الأماميجب مير يصلب داخل ORF، يكون ~ 40 النيوكليوتيدات في الطول، واحتواء الطفرة المطلوبة (ق) في مكان ما في منتصفها. لاحظ أن الطفرة (ق) في هذا الكتيب هو تكملة العكسي للطفرة (ق) في التمهيدي العكسي في الخطوة 2.1.1.1. التمهيدي العكس يجب أن يصلب إلى منطقة المصب من الجينات المستهدفة (انظر الشكل 1B-1 وممثل النتائج القسم للحصول على أمثلة).
    2. وضع ردود الفعل في thermocycler مع الإعدادات التالية: 94 ج 30 ثانية؛ 30 دورات من الإعدادات التالية: 98 ج 10 ثانية و 60 ج 5 ثانية، 72 ج 1.5 دقيقة. و72 ج 10 دقيقة.
      ملاحظة: قد تكون هناك حاجة الأمثل المعلمات PCR لمجموعات التمهيدي محددة واستهداف الجين هيستون.
  2. تشغيل 20 - 50 ميكرولتر من المواد من ردود الفعل PCR على 0.9٪ انصهار منخفضة هلام نقطة الاغاروز في 89 ملي تريس قاعدة، 89 ملم حمض البوريك، 2.5 ملي EDTA (TBE) العازلة.
  3. قطع أقسام هلام الاغاروز التي تحتوي على العلاقات العامة PCRoducts العلاقات من هلام باستخدام نظيفة مشرط أو شفرة حلاقة ونقل كل لأنبوب microcentrifuge 1.5 مل. تخزين المقاطع الأغاروس المنتجات المحتوية على PCR عند درجة حرارة -20 مئوية لتصبح جاهزة للاستخدام.

3. فيوجن PCR من شظايا متداخلة جزئيا اثنين من الحصول على كامل الحجم PCR المنتجات للتكامل

  1. إعداد نموذج لردود الفعل PCR
    1. تذوب أقسام هلام الاغاروز من الخطوة 2.3 عن طريق وضع أنابيب microcentrifuge في مجموعة كتلة الحرارة عند 65 مئوية لمدة 5 دقائق (أو حتى ذاب تماما). أنابيب دوامة كل 1-2 دقيقة لتسهيل عملية الصهر.
    2. نقل مبلغ محدد من agarose ذاب من كل عينة (على سبيل المثال، 50 ميكرولتر لكل منهما، ليصبح المجموع 100 ميكرولتر) في أنبوب microcentrifuge واحد ومزيج من قبل vortexing. استخدام هذا القالب في الانصهار ردود الفعل PCR. وضع أنبوب في -20 مئوية لتصبح جاهزة للاستخدام.
  2. تضخيم كمية كبيرة من حجم كامل المنتج PCR (المنتج جفي الشكل 1B)
    1. إعداد ستة تفاعلات PCR، مع كل من العناصر التالية: 2 ميكرولتر الحمض النووي القالب، و 10 ميكرولتر 10 ميكرومتر التمهيدي إلى الأمام، 10 ميكرولتر 10 ميكرومتر التمهيدي العكسي، 1 ميكرولتر (2.5 U) بالحرارة البلمرة DNA، 20 5X ميكرولتر عازلة الحمض النووي بوليميريز، 10 ميكرولتر خليط dNTP (2 مم لكل منهما)، و 47 ميكرولتر درهم 2 O.
      ملاحظة: يمكن تغيير عدد من ردود الفعل تبعا لكفاءة PCR. وينبغي تسخين الحمض النووي قالب (انظر 3.1.2) إلى 65 مئوية حتى ذاب، مختلطة من قبل vortexing، وأضاف آخر من مزيج تفاعل PCR. مرة واحدة وأضاف، مزيج بلطف ولكن بدقة من قبل pipetting الحل صعودا وهبوطا عدة مرات. لحساب التغيرات في تركيز الحمض النووي في العينات المختلفة، فمن المستحسن لأول مرة تحسين ردود الفعل باستخدام أي قالب غير مخفف أو التخفيفات مختلفة من القالب (على سبيل المثال، 1:10 و 1: 100). وهما الاشعال المستخدمة يجب أن يصلب لاثنين من شظايا متداخلة جزئيا من الجينات المستهدفة وسوءustrated في الشكل 1B-2 وتكون مصممة بحيث منتجات PCR النهائية سوف يكون لا يقل عن 40 أزواج قاعدة على أي مثلي الجانب للمناطق المحيطة وURA3 ORF من شأنها أن تدفع خطوة إعادة التركيب مثلي (انظر القسم ممثل النتائج على سبيل المثال). من المستحسن استخدام عالية الدقة البلمرة DNA من أجل الحد من معدلات الطفرات غير مرغوب فيها أثناء تركيب المنتجات PCR.
    2. وضع أنابيب في thermocycler مع الإعدادات التالية: 94 ج 30 ثانية؛ 30 دورات من الإعدادات التالية: 98 ج 10 ثانية و 50 ج 15 ثانية، 72 ج 1.5 دقيقة. و72 ج 10 دقيقة.
      ملاحظة: قد تكون هناك حاجة الأمثل المعلمات PCR لمجموعات التمهيدي محددة والجينات هيستون الهدف.

4. المشارك تحول كامل الحجم PCR المنتجات والعمود الفقري البلازميد، واختيار لعلامة على البلازميد

  1. تركيز المنتجات PCR
    1. تجميع الصورةردود الفعل التاسع PCR (600 مجموع ميكرولتر) من الخطوة 3.2.2 إلى أنبوب microcentrifuge واحد ومزيج من قبل vortexing.
    2. تقسيم العينة إلى ثلاث 200 مكل في أنابيب microcentrifuge. ترسيب الحمض النووي في كل أنبوب عن طريق إضافة 20 ميكرولتر من 3M خلات الصوديوم (الرقم الهيدروجيني 5.2) و 550 ميكرولتر من الإيثانول بنسبة 100٪. مزيج من حل شامل ووضع على الجليد لمدة 15 دقيقة على الأقل. جمع الحمض النووي عن طريق الطرد المركزي في ~ 14000 x ج لمدة 10 دقيقة، شطف بيليه مع 200 ميكرولتر من الايثانول 70٪، والهواء الجاف.
    3. resuspend كل بيليه الحمض النووي في 25 ميكرولتر من O 2 درهم، وتجمع في أنبوب واحد (أي ما مجموعه 75 ميكرولتر).
  2. الخميرة شارك في التحول
    1. إعداد 10 مل من الثقافة بين عشية وضحاها من سلالة ولدت في القسم 1 في استخراج الخميرة ببتون سكر العنب (YPD) السائل المتوسطة 11.
    2. في صباح اليوم التالي، تطعيم 400 مل من YPD المتوسطة السائل مع 8 مل من الثقافة بين عشية وضحاها المشبعة واحتضان التي تهزفي 30 درجة مئوية لمدة 4-5 ساعات للسماح للخلايا لدخول مرحلة لوغاريتمي من النمو.
    3. جمع الخلايا بواسطة الطرد المركزي في ~ 3220 x ج لمدة 10 دقيقة، تجاهل المتوسطة السائل، وresuspend الخلايا في 1 حجم 10 ملي تريس، حمض الهيدروكلوريك (الرقم الهيدروجيني 8.0)، 1 ملم EDTA، 0.1 م ليثيوم خلات الحل (TE / LiAc) .
    4. جمع الخلايا بواسطة الطرد المركزي في ~ 3220 x ج لمدة 10 دقيقة، وتجاهل TE / LiAc.
    5. Resuspend الخلايا في 1 مل TE / LiAc.
    6. إعداد كوكتيل التفاعل التالي في أنبوب microcentrifuge: 800 ميكرولتر من الخلايا من الخطوة 4.2.5، 40 ميكرولتر من مغلي 10 ملغ / مل السلمون الحمض النووي الحيوانات المنوية، أي ما مجموعه 12.5 ميكروغرام من العمود الفقري DNA البلازميد، و 75 ميكرولتر من الناتج PCR المركزة من الخطوة 4.1.3.
      يجب أن تكون مسلوقة سمك السلمون الحمض النووي الحيوانات المنوية لمدة 5 دقائق ويوضع على الجليد لمدة 5 دقائق على الأقل قبل استخدامها في رد الفعل: ملاحظة. يجب أن تبقى إجمالي حجم الحمض النووي العمود الفقري البلازميد وأضاف إلى أدنى حد ممكن (~ 80 ميكرولتر أو أقل). انظر القسم ممثل النتائج للحصول على مثال من بلازما العمود الفقريهوية شخصية.
    7. مزيج من أنبوب كوكتيل بدقة وقسامة بالتساوي إلى ثمانية أنابيب microcentrifuge (أنابيب 1-8).
    8. إعداد التحكم اثنين أنابيب رد فعل التحول التالية:
      1. أنبوب 9 (أي سيطرة المنتج PCR): 100 ميكرولتر من الخلايا من الخطوة 4.2.5، 5 ميكرولتر من مغلي 10 ملغ / مل السلمون الحمض النووي الحيوانات المنوية (المغلي لمدة 5 دقائق، وانظر الخطوة 4.2.6 ملاحظة)، أي ما مجموعه 1.56 ميكروغرام من وأضاف العمود الفقري DNA البلازميد وأي منتج PCR.
      2. أنبوب 10 (أي سيطرة DNA): 100 ميكرولتر من الخلايا من الخطوة 4.2.5، 5 ميكرولتر من مغلي 10 ملغ / مل السلمون الحمض النووي الحيوانات المنوية (راجع الخطوة 4.2.6 ملاحظة)، إضافة أي البلازميد العمود الفقري وأضاف الحمض النووي، وأي منتج PCR.
      3. خلط كل من أنابيب بلطف ولكن بشكل دقيق من قبل pipetting صعودا وهبوطا عدة مرات.
    9. احتضان الأنابيب عشرة في 30 مئوية لمدة 30 دقيقة.
    10. لكل أنبوب، إضافة 1.2 مل من 40٪ البولي ايثيلين جلايكول (PEG 3350) في TE / LiAc. تخلط جيدا باستخدام الماصة-P 1000 حتى الحل هو متجانس.
    11. احتضان الأنابيب عشرة في 30° مئوية لمدة 30 دقيقة. المزيج بلطف حل عن طريق pipetting صعودا وهبوطا ثم احتضان الأنابيب عند 42 درجة مئوية لمدة 15 دقيقة.
    12. جمع الخلايا من خلال الدوران الأنابيب في microcentrifuge في ~ 14000 x ج لمدة 30 ثانية. تجاهل السائل وresuspend الخلايا في 1 مل من درهم معقم 2 O.
    13. جمع الخلايا من خلال الدوران الأنابيب في microcentrifuge في ~ 14000 x ج لمدة 30 ثانية. تجاهل السائل وresuspend الخلايا في 500 ميكرولتر من درهم معقم 2 O.
    14. أنابيب بركة 1-8 معا (الحجم الكلي من 4 مل)، ومزيج دقيق من قبل pipetting صعودا وهبوطا.
    15. لوحة 200 ميكرولتر من الخليط المذكور أعلاه على كل عشرين لوحات كاملة المتوسطة الحد الأدنى من التسرب 11 (لوحات 1-20) لاختيار البلازميد العمود الفقري.
    16. لوحة 200 ميكرولتر من خليط من أنبوب 9 و 200 ميكرولتر من خليط من أنبوب 10 كل على لوحة اختيار الخاصة بها (لوحات 21 و 22، على التوالي).
    17. احتضان لوحات 22 حتى 30 درجة مئوية لمدة 3-5 أيام لحدد لtransformants البلازميد.
    18. تفقد لوحات التحول بعد 3-5 أيام من الحضانة. ما يقرب من يجب أن يكون 5000 المستعمرات مرئية على لوحات 1-21 (انظر ممثل النتائج للحصول على مثال) ويجب أن تكون هناك مستعمرات موجودة على لوحة 22.

5. الشاشة لTransformants مقاومة لل5 FOA

  1. نقل الخلايا من لوحات 1 - 20 (ولوحة تحول 21 كعنصر تحكم) إلى 5 fluoroorotic حمض (5 FOA) لوحات 11 من 12 من أجل كشف عن فقدان الجين URA3 نتيجة اندماج تصفيح نسخة منتجات PCR في الموقع المطلوب.
    1. إزالة غطاء لوحة واضغط على لوحة تحتوي على المستعمرات على المخملية العقيمة. نقل الخلايا من المخمل إلى لوحة 5-FOA عن طريق الضغط على لوحة على المخملية. احتضان لوحات عند 30 مئوية لمدة 2 أيام.
  2. بعد حضانة 2 يوما، وفحص بعناية لوحات 5 FOA للغرامowth.
    ملاحظة: وسوف يمثل حدثا التكامل مرشح صغيرة غير المتماثلة مستعمرة "سحق" على طبق من 5 FOA - على العكس، حليمات صغيرة تنمو على لوحات 5 FOA وممثل المرجح الطفرات URA3 العفوية التي نشأت أثناء نمو المستعمرات على لوحات التحول، وبالتالي فهي غير المرجح أن يمثل هذا الحدث التكامل المنشود (انظر الشكل 3 في قسم ممثل النتائج لمزيد من التفصيل حول هذه النقطة وبالنسبة لبعض الأمثلة).

6. تنقية المستعمرات المقاومة لل5 FOA وفقدان البلازميد العمود الفقري

  1. استخدام المسواك العقيمة، واختيار المستعمرات مرشح من لوحات 5 FOA هو موضح في الخطوة 5.2 و خط لالمستعمرات واحد على لوحات YPD. احتضان لمدة 2-3 أيام عند 30 درجة مئوية.
  2. بعد الحضانة، نسخة طبق الاصل - لوحة كل YPD تنقية لوحة إلى لوحة YPD جديدة، لوحة التسرب تفتقر اليوراسيل للتحقق من الخسارةمن الجين URA3، وصفيحة التسرب الثانية لمراقبة وجود أو عدم وجود البلازميد العمود الفقري. احتضان لمدة 1-2 أيام عند 30 درجة مئوية.
  3. بعد الحضانة، وتحديد مستعمرة من كل عينة المرشح الذي ينمو على لوحة YPD ولكن لا ينمو على أي لوحة التسرب (من المتوقع مثل مستعمرة قد فقدت الجينات URA3 من خلال هذا الحدث إعادة التركيب وخسر البلازميد العمود الفقري خلال الإنقسامية انقسام الخلية). Restreak هذه المستعمرات على لوحات YPD جديدة. هذه المستعمرات هي المرشحين التكامل ووسيجري تحليل في الخطوة 7.

7. التحليلات الجزيئية لفحص للتكامل السليم للالمسخ أليل

  1. عزل الحمض النووي الجيني من العينات مرشح باستخدام إجراءات القياسية 10.
  2. تضخيم المنطقة الجينومية يشمل الموقع المستهدف.
    1. إعداد تفاعل PCR التالية لكل عينة: 0.5 ميكرولتر الحمض النووي القالب، 5 ميكرولتر10 ميكرومتر التمهيدي إلى الأمام، 5 ميكرولتر 10 ميكرومتر التمهيدي العكسي 0.5 ميكرولتر (2.5 وحدة) طق الحمض النووي بوليميريز، 5 ميكرولتر 10X طق DNA العازلة البلمرة، 5 ميكرولتر خليط dNTP (2 مم لكل منهما)، و 29 ميكرولتر درهم 2 O.
      ملاحظة: قالب الحمض النووي هو الحمض النووي الجيني المستمدة من العينات مرشح. فمن المستحسن أن تشمل أيضا اثنين من ردود الفعل التحكم: واحد باستخدام الحمض النووي الجيني المستمدة من geneΔ هيستون الأصلي :: URA3 سلالة كقالب واستخدام الحمض النووي الجيني آخر من نوع السلالة البرية هيستون كقالب. لحساب التغيرات في تركيز الحمض النووي ومستوى الشوائب في الأعمال التحضيرية الجينومية مختلفة، فمن المستحسن لتحسين ردود الفعل باستخدام إما الحمض النووي مخفف أو التخفيفات مختلفة من الاستعدادات الجينوم (على سبيل المثال، 1:10 و 1: 100). من المهم للتأكد من أن هذه الاشعال يصلب لتسلسل الحمض النووي خارج المنطقة التي تشملها المنتج PCR متكاملة مزعومة - وبهذه الطريقة، وحجم المنتجات PCR في هذه صeactions يمكن أن تستخدم كأداة تشخيصية لتكامل المنتجات في الموقع الجيني الصحيح (انظر ممثل النتائج للحصول على مثال).
    2. وضع ردود الفعل في thermocycler مع الإعدادات التالية: 94 ° C 3 دقائق. 30 دورات من الإعدادات التالية: 94 درجة مئوية و 45 ثانية و 50 درجة مئوية و 45 ثانية و 72 درجة مئوية 2 دقيقة. و 72 درجة مئوية مدة 10 دقيقة.
      ملاحظة: قد تكون هناك حاجة الأمثل المعلمات PCR لمجموعات التمهيدي محددة والجينات هيستون الهدف.
  3. تجهيز المنتجات PCR
    1. تشغيل 20 ميكرولتر من كل رد فعل على 0.8٪ TBE هلام الاغاروز.
    2. تقييم حجم المنتجات PCR باستخدام معايير الحمض النووي كمرجع لتحديد ما إذا تم استبدال الجينات URA3 بنجاح بواسطة الجينات هيستون تحور مزعومة (انظر ممثل النتائج للحصول على مثال).
      ملاحظة: في بعض الحالات، الطفرة المطلوبة (الصورة) التي أدخلت الجينات هيستون إما إنشاء أو تدمير تقييد الجلوسه. إذا كان هذا هو الحال، فإن وجود الطفرة المرجوة في منتجات PCR من حجم يدل على التكامل الصحيح يمكن تقييمها من خلال إخضاع المنتجات للهضم مع انزيم التقييد المقابل تليها التحليل الكهربائي للهلام (انظر ممثل النتائج للحصول على مثال) .
    3. منتجات PCR تخضع لحجم يدل على التكامل الصحيح لتسلسل الحمض النووي لتأكيد وجود طفرة المطلوب (ق) وضمان أن أدخلت أي طفرات إضافية في الجينوم.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

نحن تصف الجيل من أليل hht2 تعبر عن هيستون H3 البروتين متحولة إيواء إجراء تبديل في موقف 53 من أرجينين إلى حمض الجلوتاميك (H3-R53E متحولة) كمثال التمثيلي للالمستهدفة في استراتيجية الموقع الطفرات.

ولدت لنا سلالة التي يتم استبدال ORF كامل HHT2 بواسطة الجينات URA3 (راجع الخطوة 1 من البروتوكول). هذه السلالة، yAAD156، أيضا يؤوي أليل his3Δ200، والذي يسبب الخلايا لتكون العوز الغذائي لالحامض الاميني. باتباع الإجراء المشار إليه في الخطوة 2 من البروتوكول، ونحن بعد ذلك ولدت اثنين شظايا متداخلة جزئيا من HHT2. استخدمت الاشعال التالي للجزء الأول: إلى الأمام التمهيدي (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3 "والتمهيدي عكسي (R53Erev): 5' GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3". العلاقات العامة التاليةواستخدمت imers للجزء الثاني: إلى الأمام التمهيدي (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3 "والتمهيدي عكسي (OAD21): 5' GCGCTTGATCAGCAGTTCATCG 3". لاحظ أن التمهيدي عكسي في أول رد فعل والتمهيدي إلى الأمام في رد الفعل الثاني تحتوي على المطلوب تحور النيوكليوتيدات (في حالة السفلي) - وتقع هذه النيوكليوتيدات تحور في بين اثنين من فترات طويلة من النوع البري تسلسل، وهذا يسمح لالصلب كفاءة من التمهيدي إلى قالب الحمض النووي على الرغم من عدم تطابق في المواقف تحور. نلاحظ أيضا أن النيوكليوتيدات متحولة في هذه الاشعال هما عكس مكملة لبعضها البعض، وتتسبب في AG لGA طفرة في حبلا المعنى، مما يؤدي الى AGA لأكاديمية الخليج للطيران التغيير كودون، التي تنتج في نهاية المطاف طفرة R53E في البروتين المشفرة. وتظهر نتائج من هذه التفاعلات PCR في الشكل 2A.

باستخدام الإجراء في الخطوة 3، ونحن بعد ذلك GENER ATED المنتجات PCR كاملة الحجم. كانت الاشعال المستخدمة الأمام التمهيدي (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 "وعكس التمهيدي (OAD480): 5 'CATGGTTTCTTGCCGGTTAT 3". عند تصميم هذه الاشعال، من المهم للتأكد من أن الانصهار المنتجات PCR الناتجة تشمل على الأقل 40 أزواج قاعدة على أي من الطرفين لدفع رد فعل إعادة التركيب مثلي (ويعد من المناطق التماثل، ستقوم أحداث إعادة التركيب مثلي أكثر كفاءة ومحددة يكون). في تجربتنا، احتوت على منتجات PCR كاملة الحجم في المنطقة 195 قاعدة الزوج و 220 قاعدة المنطقة زوج مثلي إلى مناطق المنبع والمصب من HHT2 ORF، على التوالي. تم تحليل عينة من هذه المنتجات PCR بواسطة الاغاروز الكهربائي للهلام (الشكل 2B).

المنتجات PCR كاملة الحجم وبعد ذلك شارك في تحويل جنبا إلى جنب مع pRS413 بلازميد القسيم المركزي، تميز HIS3- البلازميدوقد تم اختيار و "> 13) وtransformants على لوحات تفتقر الحامض الاميني (SC-له لوحات) كما هو موضح في الخطوة 4 من البروتوكول. وصاحب المستعمرات + ثم فرزها لمقاومة 5 FOA التالية الإجراءات الموضحة في الخطوة 5 من البروتوكول. ويبين الشكل 3 مثالا لوحة التحول (SC-له) و 5 FOA لوحات التالية من SC-له لوحات طلاء متماثلة. أمثلة على عينات مرشح وكذلك عينات من غير المحتمل أن تمثل أحداث التكامل المنشود وتعرض أيضا في الشكل (3) وفي تجربتنا، حددنا اثني عشر عينات مرشح للخروج من ~ 90،000 transformants فرزهم ثم تم تنقيته هؤلاء المرشحين كما هو موضح في الخطوة 6 من البروتوكول.

ثم تعرضوا المرشحين الاثني عشر لتحليل PCR هو موضح في الخطوة 7 من بروتوكول لتقييم ما إذا أنها تعكس بدائل حقيقية من الجين URA3 مع منتجات PCR متحولة. لدينا التجربهر، استخدمنا التمهيدي إلى الأمام أن anneals 89 أزواج قاعدة المنبع من موقع التكامل المنتج PCR والتمهيدي عكس ذلك anneals 302 أزواج قاعدة المصب من موقع التكامل المنتج PCR. هذه البادئات توليد منتجات PCR من 1217 زوج من القواعد في الحجم إذا احتلت مكان HHT2 التي كتبها HHT2 (أو الإصدارات متحولة من HHT2 إيواء استبدال زوج قاعدة)، أو منتجات PCR من 2188 زوج من القواعد في الحجم إذا احتلت مكان بواسطة الجينات علامة URA3 . تسلسل التمهيدي إلى الأمام تستخدم (OAD476) هو: 5 'GAAACTATTGGCACGCCCTA وذلك من التمهيدي العكسي المستخدمة (OAD477) هو: 5' CCTGCGAATCAACCGATACT 3 ". ومن بين المرشحين الاثني عشر كنا قد حددت أربعة أظهرت دمج منتج PCR في الموقع الصحيح (انظر الشكل 4A للحصول على مثال). وأخيرا، منذ AG لGA طفرة يولد موقع جديد تقييد ايكو RI، أخضعنا المنتجات PCR من واحدة من العينات التكامل الناجحة ل الشكل 4B). في هذه الحالة بالذات لم نكن تسلسل المنتجات PCR لضمان لم أدرجت أن الطفرات إضافية غير المرغوب فيها في الجينوم: ومع ذلك، فقد استخدمنا إجراء مشابهة جدا لهذا لتوليد عدد كبير من الطفرات HHT2 في دراسة الماضية 14، ووجد أن الغالبية العظمى من أليل متحولة متكاملة لا تحمل أي طفرات أخرى غير تلك المطلوبة.

الشكل 2
الشكل 2: جيل من PCR المنتجات ايواء المرغوب الطفرات عن الاندماج في الجينوم الخميرة. رد فعل (A) PCR لتوليد شظايا متداخلة جزئيا من HHT2 إيواء الطفرات المطلوبة. كارتون تمثيل ر: كبار وقال انه اثنين من ردود الفعل PCR للحصول على اثنين HHT2 شظايا (انظر الشكل 1B-1). تمثل الدوائر الحمراء النيوكليوتيدات غير متطابقة على الاشعال تستخدم لإدخال AG لGA طفرة في حبلا الشعور الجين. التحليل الكهربائي للهلام المنتجات PCR أ و ب (الممرات 2 و 3 على التوالي): أسفل. وترد المعايير الحمض النووي في حارة 1. (ب) رد فعل الانصهار PCR لتوليد بالحجم الكامل المنتج PCR للاندماج الخميرة الجينوم (انظر الشكل 1B-2 و 3). كبار: كارتون تمثيل تفاعل PCR ويتوقع المنتج PCR (المنتج ج). الدوائر الحمراء تمثل المطلوب طفرة كما هو موضح في الفقرة (أ) أعلاه. التحليل الكهربائي للهلام المنتجات PCR ج (حارة 2): أسفل. وترد المعايير الحمض النووي في حارة 1. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الآثار البيئية-together.within الصفحات = "1"> الشكل (3)
الرقم 3: ممثل النتائج من تجربة المشارك التحول وشاشة 5-FOA. اليسار: SC-ممثله لوحة مطلي مع الخلايا تخضع لإجراءات شارك في التحول بعد حضانة لمدة 3 أيام في 30C. تم إحصاء حوالي 5000 المستعمرات. الأوسط: لوحة تمثيلية 5 FOA التالية متماثلة الطلاء من لوحة SC-شريكه في التحول بعد حضانة 2 يوم عند 30C. واعتبرت عينات 1 و 2 مرشحين لمرورنا حدث الاندماج الناجح بسبب الأشكال التضاريسية بها غير المتماثلة. وذلك لأن بديل حقيقي لهذا الجين URA3 مع أليل hht2 من المرجح أن تحدث قبل (أو في وقت قريب جدا بعد) هو مطلي خلية تحولت على SC-لوحة له، ونتيجة لذلك، فإن المستعمرة التي ستنشأ في هذا الموقع سوف تحتوي معظمها، إن لم يكن حصرا، 5 FOA-resistanخلايا تي - عندما تكون هذه المستعمرة ثم في وقت لاحق إلى لوحة 5-FOA سيتم سحق عليه، مما أدى إلى التصحيح تبحث غير المتماثلة من الخلايا على لوحة مطلية نسخة طبق الأصل. على العكس من ذلك، عفوية من المرجح أن تكون محصورة في منطقة صغيرة من مستعمرة، وبالتالي من المرجح أن تؤدي إلى الحليمات عندما متماثلة مطلي لوحة 5-FOA طفرات في الجين URA3 التي يمكن أن تنشأ خلال تشكيل مستعمرة. الحق: ممثل مختلفة 5-FOA لوحة التالية متماثلة الطلاء من لوحة SC-شريكه في التحول بعد حضانة لمدة 3 أيام في 30 درجة مئوية. مرشح إضافي (عينة 3) فضلا عن اثنين من الحليمات الصغيرة مرئية على هذه اللوحة (عينات 4 و 5) - هذه الحليمات، والتي هي الأكثر واضحة للعيان بعد 3 أيام أو أكثر من الحضانة، من المحتمل أن تمثل الطفرات URA3 عفوية وليس حالة التكامل المنشود. الرجاء الضغط هنا للمشاهدةنسخة أكبر من هذا الرقم.

الشكل (4)
الشكل (4): التحليلات الجزيئية لعينات المرشح التكامل. (أ) فحص PCR لتحديد أحداث التكامل الناجحة. تمثيل الرسوم المتحركة من ردود الفعل PCR المستخدمة لتقييم التكامل الناجح للأليل متحولة hht2 في الجينوم: العلوي. أسفل: هلام التحليل الكهربائي من ردود الفعل PCR باستخدام الحمض النووي الجيني المستمدة من HHT2 من نوع السلالة البرية (التي تستخدم كعنصر تحكم، 2 لين)، سلالة yAAD156 إيواء استبدال hht2Δ :: URA3 (التي تستخدم كعنصر تحكم، حارة 3)، وهو مرشح عينة التكامل (حارة 4)، وعينة الحليمات المقاومة لل5 FOA (وبالتالي من غير المحتمل أن تمثل حدثا التكامل الصحيح، حارة 5). وترد المعايير الحمض النووي في حارة 1. لاحظ أن أحجام المنتجات PCR لعينة التكامل المرشحة consisteالإقليم الشمالي مع الحدث الاندماج الناجح، في حين أن حجم المنتجات PCR لعينة الحليمات يتسق مع سليمة موضع hht2Δ :: URA3. (ب) ايكو RI الهضم لتأكيد وجود أليل متحولة. الأعلى: الكرتون تمثيل شظايا الهضم المتوقع المشتقة من الهضم رد فعل ايكو RI من المنتجات PCR التي تحتوي إما من النوع البري HHT2 الجين أو أليل hht2 متحولة. التحليل الكهربائي للهلام من ردود الفعل هضم منتجات PCR مستمدة من النوع البري HHT2 سلالة (حارة 2، والمنتجات PCR المستخدمة هنا مستمدة من نفس العينة التي استخدمت في حارة 2 من لوحة أ) وعينة التكامل مرشح (: قاع حارة 3، والمنتجات PCR المستخدمة هنا مستمدة من نفس العينة التي استخدمت في حارة 4 من لوحة A). وترد المعايير الحمض النووي في حارة 1. لاحظ أن أنماط الهضم تؤكد أن AG لGA طفرة أدخلت بنجاح في جينوم المرشحعينة التكامل. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

على مستوى عال من تسلسل تناظر بين الجينين غير أليلية أن رمز لكل من البروتينات هيستون الأساسية الأربعة في الخلايا البيرة س فرداني يمكن أن تمثل تحديا للمحققين الذين يرغبون خصيصا لاستهداف واحد من اثنين من الجينات لالطفرات. سبق وصفها منهجيات الطفرات الخميرة، بما في ذلك Delitto بيرفيتو، الجينوم (SSG) الطفرات في مواقع محددة، وأساليب استبدال أليل القائم على PCR خالية من استنساخ وكذلك المزيد من التقنيات المعتمدة كريسبر الخميرة الأخيرة 15، وغالبا ما تعتمد على الأقل في جزء منها على تسلسل داخل ORF من الجينات المستهدفة لتجنيد إعادة التركيب أو إصلاح الأجهزة إلى الموقع الجيني المطلوب لتوليد نهاية المطاف أليل متحولة النهائي. من ناحية أخرى، فإن استراتيجية قدمناه هنا يجعل من استخدام تسلسل الحمض النووي المرافقة ORF تستهدف دفع homologoلنا الحدث إعادة التركيب اللازمة لتحقيق التكامل بين الطفرات، ونتيجة لذلك، يسمح لأكثر استهداف محدد من الجينات على آخر على الرغم من وجود اثنين من الجينات ORFS المتجانسة للغاية. هذه الميزة يجعل استراتيجيتنا بشكل خاص مناسبة تماما لالطفرات هيستون. ومع ذلك، فإن هذه الاستراتيجية يمكن أيضا أن تتكيف لالطفرات من جينات أخرى في الجينوم الخميرة.

ميزات إضافية من استراتيجيتنا تشمل الحقائق التي أطوال المناطق التي تدفع إعادة التركيب مثلي من الجينات الطافرة يمكن أن تكون مصممة لتكون واسعة جدا، وبالتالي زيادة كفاءة التكامل في الموقع الجيني الهدف، وأنه إلى جانب الطفرة المطلوبة (الصورة ) يتم إدخال أي تسلسل الحمض النووي إضافية في الجينوم. ميزة إضافية لهذا النظام هو أنه بمجرد أن تم بناؤها سلالة إيواء استبدال الجينات هيستون محددة مع URA3، يمكن استخدامه لتوليد أي نسخة متحولة المطلوب من أن اصمت معينجين واحد. وهكذا، على سبيل المثال، سلالة yAAD156، والذي يتوفر للمجتمع العلمي عند الطلب، ويمكن استخدامها لجعل أي طفرة hht2 المطلوبة دون الحاجة إلى بناء من جديد hht2Δ :: URA3 أليل. وأخيرا، وذلك باستخدام بادئات PCR مصمم بشكل صحيح، فإن هذه الاستراتيجية يمكن أن تستخدم أيضا لتوليد الأليلات هيستون مع الحذف الداخلية أو مع الطفرات في الكودونات متعددة، طالما أنها نسبيا بالقرب من بعضها البعض (على سبيل المثال، فإننا قد ولدت الأليل hht2 ترميز ل H3-K56R، L61W البروتين متحولة مزدوج باستخدام هذه الاستراتيجية).

القدرة خصيصا لاستهداف واحد من اثنين من الجينات هيستون المتجانسة للغاية لالطفرات يمكن أن تكون مفيدة في عدد من إعدادات التجريبية المختلفة. على سبيل المثال، منذ يتم التعبير عن الجينات HHT1-HHF1 على مختلف المستويات مقارنة الجينات HHT2-HHF2 16، ويمكن أن تكون ذات فائدة لتحديد ما إذا كان H3 H4 معين أو طفرة يمنح ديالظواهر fferent اعتمادا على الجينات يتم التعبير عن ذلك من. مثال آخر هو السيناريو الذي محقق يرغب في توليد خلايا فرداني تعبر عن متحولة هيستون معين من كل من الجينات هيستون المقابلة - وهذا يمكن تحقيقه عن طريق mutagenizing أولا كل الجينات بشكل مستقل في اثنين من سلالات مختلفة، ومن ثم الحصول على خلايا فرداني متحولة مزدوجة من خلال الصليب والعزلة لاحقة من المنتجات الانتصافي المطلوب. مثال آخر يتعلق الطفرات من الهستونات H2A وH2B: نظرا لحقيقة أن اثنين الإسوية مختلفة قليلا من كل بروتين يتم ترميز بواسطة مجموعة الجينات غير أليلية المقابلة، محقق قد ترغب في تقييم الآثار المترتبة على H2A محددة أو طفرة H2B في في سياق إما الإسوي. عند تصميم التجارب لmutagenize وHTA1 ومواضع HTB1 (ترميز H2A وH2B، على التوالي)، وينبغي للمحققين أن يكون على بينة من النتائج الأخيرة تبين أن السلالات يحمل (hta1-htb1) Δ وقابلة للحياة فقط طو لديهم تضخم في موضع HTA2-HTB2 (وقريب موضع HHT1-HHF1 أيضا) من خلال توليد كروموسوم دائري صغير 17، لأن ذلك قد يعقد تفسير النتائج.

وقد استخدمنا مؤخرا نسخة من هذه الاستراتيجية الطفرات هيستون لتوليد هيستون البروتينات H3 معربا عن بدائل الأحماض الأمينية الممكنة في موقف 61، التي يحتلها عادة من قبل يسين الأحماض الأمينية 14. لتلك التجارب، بدلا من استخدام yAAD156 لان السلالة البداية لالطفرات، كنا سلالة yADP106، التي تؤوي استبدال HHT2 ORF مع كل من URA3 وTRP1 علامات الغذائية (بدلا من مجرد URA3). بحضور كل من الجينات علامة يسر تحديد المرشحين للتكامل المنتجات PCR متحولة التالية الشاشة وتنقية الخطوة 5-FOA (الخطوات 5 و 6 من البروتوكول)، وهذا candidatأصبح وفاق ظاهريا أورا - والتربتوفان في حين أسفرت عفوية URA3 الطفرة في الخلايا مع أورا - النمط الظاهري التربتوفان +. yADP106 هو متاح أيضا عند الطلب، كما هو تسلسل الكاسيت URA3-TRP1، والتي يمكن التوسع كوحدة وتستخدم لالطفرات الجينات هيستون أخرى باستخدام استراتيجية الموصوفة هنا.

عدم القدرة على الحصول على طفرات هيستون المطلوب باستخدام هذه الاستراتيجية يمكن أن تعزى إلى عدد من الأسباب المحتملة، بما في ذلك كمية كافية من المنتجات PCR كاملة الحجم تستخدم للخطوة الاندماج أو وجود العدد الكافي من transformants بعد خطوة شارك في التحول. ويمكن معالجة هذه المشكلة السابقة عن طريق تجميع مجموعات معا أكبر من ردود الفعل PCR أو من خلال تصميم مجموعات التمهيدي المختلفة التي تنتج عائدات أعلى من الناتج، في حين يمكن حل المشكلة الأخيرة عن طريق استخدام كميات أكبر من البلازميد العمود الفقري في التجربة شارك في التحول. Althoهتاف اشمئزاز، كما هو مبين في وقت سابق، يمكن للمرء أن استخدام هذا الإجراء لتوليد المسوخ هيستون بإيواء اثنين أو أكثر من بدائل الأحماض الأمينية، والأحماض الأمينية المستهدفة يجب أن تكون قريبة نسبيا من بعضها البعض منذ الكودونات منها تحتاج إلى أن يكون موجودا في نفس الجزيء التمهيدي. وبالتالي، فإن هذه الاستراتيجية لا يمكن أن تتكيف بسهولة لتوليد الهستونات مع طفرات متعددة تقع بعيدة عن بعضها البعض عبر طول البروتينات.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
المستهدفة<em&gt; في الموقع</em&gt; الطفرات من هيستون الجينات في مهدها الخميرة
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter