Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Målrettet doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De fire centrale histonproteiner H2A, H2B, H3 og H4 spille centrale roller i komprimeringen, organisation og funktion af eukaryote kromosomer. To sæt af hver af disse histoner danne histon octamer, en molekylær spole, der dirigerer indpakning af ~ 147 basepar af DNA rundt om sig selv, i sidste ende resulterer i dannelsen af en nukleosom 1. Nukleosomer er aktive deltagere i en bred vifte af kromosom-baserede processer, såsom regulering af gen transskription og dannelsen af ​​euchromatin og heterochromatin tværs kromosomer, og som sådan har været genstand for en intens forskning i løbet af de sidste mange årtier. En række mekanismer er blevet beskrevet, hvorved nukleosomer kan manipuleres på måder, der kan lette udførelsen af ​​særlige processer - disse mekanismer indbefatter posttranslationelle modifikation af histon-rester, ATP-afhængig nukleosom remodeling, og ATP-uafhængige nukleosom reorganiseringog montering / demontering 2, 3.

Den spirende gær Saccharomyces cerevisiae er en særlig kraftig model organisme for forståelsen af histon funktion i eukaryoter. Dette kan i vid udstrækning tilskrives den høje grad af evolutionære konservering af histonproteinerne hele domænet Eukarya og modtagelighed af gær til en række genetiske og biokemiske eksperimentelle tilgange 4. Reverse-genetiske metoder i gær er ofte blevet brugt til at undersøge effekten af ​​specifikke histon mutationer på forskellige aspekter af kromatin biologi. For disse typer af eksperimenter er det ofte at foretrække at anvende celler, hvori de mutante histoner udtrykkes fra deres native genomiske loci, som ekspression fra autonome plasmider kan føre til unormale intracellulære niveauer af histon-proteiner (på grund af varierende antal plasmider i celler) og samtidig ændring af kromatin environments, hvilket i sidste ende kan forvirre fortolkning af resultaterne.

Her beskriver vi en PCR-baseret teknik, som muliggør målrettet mutagenese af histon-gener ved deres native genomiske placeringer, der ikke kræver et kloningstrin og resulterer i dannelsen af ​​den ønskede mutation (er) uden efterladenskaber exogene DNA-sekvenser i genomet. Denne teknik drager fordel af effektive homolog rekombination-system i gær og har flere træk til fælles med andre lignende teknikker udviklet af andre grupper - især den Delitto Perfetto, stedsspecifik genomisk (SSG) mutagenese og kloning-fri PCR-baseret allel udskiftning metoder 5, 6, 7. Men den teknik beskriver vi har et aspekt, der gør det særligt velegnet til mutagenese af histon-gener. I haploide gærceller, er hver af de fire kernehistoner indkodet af to ikke-allelic og meget homologe gener: for eksempel histon H3 kodet af HHT1 og HHT2 gener, og de åbne læserammer (ORF'er) af de to gener er over 90% identisk i sekvens. Denne høje grad af homologi kan komplicere eksperimenter designet til specifikt at målrette en af ​​de to histon-kodende gener for mutagenese. Hvorimod de førnævnte fremgangsmåder kræver ofte anvendelse af mindst nogle sekvenser i ORF af målgenet til at køre homolog rekombination, teknikken beskriver vi her gør brug af sekvenser, der flankerer ORF'erne af histon-gener (som deler meget mindre sekvenshomologi) for rekombinationen trin, hvilket øger sandsynligheden for vellykket målretning af mutagenese til den ønskede locus. Desuden kan de homologe områder, der driver rekombination være meget omfattende, hvilket yderligere bidrager til effektiv målrettet homolog rekombination.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

BEMÆRK: Den eksperimentelle strategi for målrettet in situ histon gen mutagenese omfatter flere trin (opsummeret i figur 1). Disse trin indbefatter: (1) Udskiftning af målet histon-genet med URA3-genet, (2) Generation og oprensning af PCR-produkter svarende til to delvist overlappende fragmenter af target histon-genet under anvendelse af primere indeholdende den ønskede mutation (er), (3 ) Fusion PCR af de to delvist overlappende fragmenter for at opnå fuld størrelse PCR-produkter for integration, (4) Co-transformation af fuld størrelse PCR-produkter og backbone plasmid, og selektion for markør på plasmidet, (5) Screening for 5-FOA-resistente transformanter, (6) Oprensning af 5-FOA-resistente kolonier og tab af backbone plasmid, og (7) Molecular analyser til analyse for korrekt integration af den mutante allel.

figur 1
in situ Mutagenese histon gener i Spirende Gær. I dette eksempel målgenet er HHT2, men enhver anden kerne histon-gen kan også mutageniseres ved hjælp af denne strategi. (A) Haploide gærceller harbor to histon H3-kodende gener (HHT1 og HHT2) og to histon H4-kodende gener (HHF1 og HHF2) anbragt som vist i figuren (de HHT1 og HHF1 gener er lokaliseret på kromosom II og HHT2 og HHF2 gener er lokaliseret på kromosom XIV - i hvert tilfælde, pilene peger i retning af transkription). I det første trin i proceduren, er ORF'en af HHT2 genet erstattet med URA3-genet, der giver anledning til en hht2Δ :: URA3-stammen. (B) I del 1, er en vildtype kopi af HHT2 gen fra en genomisk DNA-prøve anvendt som skabelon for to PCR reaktioner på slægterte de to delvist overlappende fragmenter af genet. Den reverse primer for den første reaktion indbefatter en eller flere fejlparrede nukleotider (angivet med en rød cirkel), der svarer til at blive indført i genomet den ønskede mutation (er). Den fremadrettede primer for den anden reaktion har tilsvarende mismatch i en modsat komplementær konfiguration (også angivet med en rød cirkel). De to PCR-produkter dannet i del 1 (produkt A og B) anvendes derefter som templates for fusion PCR under anvendelse af to primere, som annealer til produkt A og B i mode i del 2. Dette resulterer i genereringen af fuld størrelse PCR produkter (produkt C i del 3), der huser den ønskede mutation (er). (C) The hht2Δ :: URA3-stammen er derefter co-transformeret med fuld størrelse PCR-produkter og en rygrad plasmid (a HIS3- mærket plasmid i dette eksempel), og celler udvælges for tilstedeværelsen af plasmidet (på medier, der mangler histidine i dette eksempel). Transformanter screenes derefter for 5-FOA resistens - resistente celler er kandidater til at være underkastet en homolog rekombinationsbegivenhed, der fører til integration af PCR-produktet og udtagelse af URA3-genet, som vist. Efterfølgende tab af rygraden plasmidet ved mitotisk celledeling fører til den endelige ønskede histon mutantstamme. Vi har fundet, at udvælgelse af skelettet plasmid efterfulgt af screening for 5-FOA resistens resulterer i en meget højere frekvens af identifikation af korrekt integration events sammenlignet med direkte selektion på 5-FOA-plader, som for det meste identificerer celler, der har erhvervet spontane URA3 mutationer. (Dette tal er blevet ændret fra henvisning 14). Klik her for at se en større version af dette tal.

1. Udskiftning af Target histon Gene med URA3Gene

  1. Udføre standard-PCR-medieret ettrins genafbrydelse erstatte ORF af target histon-genet med URA3-genet 8, 9.
    BEMÆRK: Det anbefales at bruge af gærceller, der bærer ura3Δ0 som denne mutation fjerner hele endogene URA3 ORF, og dermed undgå integration af PCR-produktet ind i URA3 locus 8. Alternativt kan K. lactis URA3 genet anvendes effektivt til frembringelse af histon udskiftning i enhver ura3 baggrund som den er funktionel i S. cerevisiae, men har kun partiel sekvens homologi med S. cerevisiae URA3-genet. Stammen bør også være auxotrof for mindst en forbindelse, der vil tillade selektion af rygraden plasmid i transformationsforsøget (se trin 4 i denne protokol). Dette trin er ikke nødvendigt, hvis et mål histon geneΔ :: URA3stamme er allerede tilgængelige.

2. Generation og oprensning af PCR-produkter svarende til to delvist overlappende Fragmenter af Target histon Gene hjælp Primere huser den ønskede mutation (er)

  1. Generere PCR-produkter svarende til to delvist overlappende fragmenter af target histon-genet.
    1. Forbered to PCR-reaktioner som følger:
      1. For at generere PCR-produkter svarende til den første halvdel af genet (produkt en i figur 1B), der blev oprettet følgende reaktion: 1 pi skabelon-DNA, 5 μl10 uM fremad primer, 5 μl10 uM reverse primer, 0,5 pi (1,25 U) varmestabil DNA-polymerase, 10 pi 5x DNA-polymerase-buffer, 5 pi dNTP-blanding (2 mM af hver), og 23,5 pi dH 2 O.
        BEMÆRK: Template-DNA'et kan være genomisk DNA afledt fra en stamme vildtype for målet histon-genet isoleret ved anvendelse af standard proprocedurer 10. At tage højde for variationer i DNA-koncentration og niveau af urenheder i forskellige genomiske præparater, anbefales det at optimere reaktionerne ved anvendelse af enten ufortyndet DNA eller forskellige fortyndinger af de genomiske præparater (fx 1:10 og 1: 100). Den fremadrettede primer bør anneale til en region opstrøms for målgenet. Den reverse primer bør anneale i ORF, være ~ 40 nukleotider i længde, og indeholder den ønskede mutation (er) et sted i midten af det (se figur 1B-1 og Repræsentative resultater sektion for eksempler). Anvendelsen af ​​en high fidelity DNA polymerase anbefales for at reducere satserne for uønskede mutationer under syntesen af ​​PCR-produkterne.
      2. For at generere PCR-produkter svarende til anden halvdel af genet (produkt B i figur 1B), nedsat en reaktion som angivet i 2.1.1.1, men med forskellige primere.
        BEMÆRK: fremad primer bør anneale i ORF, være ~ 40 nukleotider i længde, og indeholder den ønskede mutation (er) et sted i midten af ​​det. Bemærk, at mutationen (r) i denne primer er den omvendte komplement af mutationen (r) i den reverse primer i trin 2.1.1.1. Den reverse primer bør anneale til en region nedstrøms for målgenet (se figur 1 B-1 og Repræsentative resultater sektion for eksempler).
    2. Placer reaktionerne i en thermocycler med følgende indstillinger: 94 ˚C 30 sek; 30 cyklusser af følgende indstillinger: 98 ˚C 10 sek, 60 ˚C 5 sek, 72 ˚C 1,5 min; og 72 ° C 10 min.
      Bemærk: Det kan være nødvendigt Optimering af PCR-parametre til specifikke primer sæt og målrette histon gen.
  2. Køre 20 - 50 pi materialet fra PCR-reaktionerne på en 0,9% lavtsmeltende agarosegel i 89 mM Tris-base, 89 mM borsyre, 2,5 mM EDTA (TBE) buffer.
  3. Cut agarose gel sektioner og indeholder PCR products fra gel med en ren skalpel eller barberblad og overføre hver til et 1,5 ml mikrocentrifugerør. Opbevar agarose afsnit med PCR-produkter ved -20 ˚C indtil den er klar til brug.

3. Fusion PCR af de to delvist overlappende Fragmenter at opnå fuld størrelse PCR produkter til integration

  1. Forbered skabelon for PCR-reaktioner
    1. Smelt agarose gel sektioner fra trin 2.3 ved at anbringe mikrocentrifugerør i en varmeblok sæt ved 65 ° C i 5 min (eller indtil fuldstændig smeltet). Vortexrør hver 1 - 2 min for at lette smelteprocessen.
    2. Overføre et fast beløb af smeltet agarose fra hver prøve (fx 50 pi hver, i alt 100 ul) i en enkelt mikrocentrifugerør og vortexes. Brug dette som template i fusion PCR-reaktioner. Glasset anbringes ved -20 ˚C indtil den er klar til brug.
  2. Amplificere en stor mængde af fuld størrelse PCR-produkt (produkt Ci figur 1B)
    1. Oprettet seks PCR-reaktioner, hver med følgende komponenter: 2 pi template-DNA, 10 pi 10 pM forward primer, 10 pi 10 pM reverse primer, 1 pi (2,5 U) termostabil DNA-polymerase, 20 pi 5x DNA-polymerase-buffer, 10 pi dNTP-blanding (2 mM af hver), og 47 pi dH 2 O.
      BEMÆRK: kan ændres Antallet af reaktioner afhængigt af PCR effektivitet. Template-DNA (se 3.1.2) bør opvarmes til 65 C, indtil smeltet, blandet ved vortexbehandling og tilsættes sidst til PCR-reaktionsblandingen. Når tilføjede, bland forsigtigt, men grundigt ved pipettering løsningen op og ned flere gange. At tage højde for variationer i DNA-koncentration i de forskellige prøver, anbefales det først at optimere reaktionerne ved anvendelse af enten ufortyndet skabelon eller forskellige fortyndinger af skabelonen (f.eks 1:10 og 1: 100). De to anvendte primere bør anneale til de to delvist overlappende fragmenter af målgenet som sygustrated i figur 1 B-2 og være udformet således, at de endelige PCR-produkter vil have mindst 40 basepar på hver side homologe til regioner, der flankerer URA3 ORF, der vil drive den homologe rekombination trin (se Repræsentative resultater afsnittet for eksempler). Anvendelsen af ​​en high fidelity DNA polymerase anbefales for at reducere satserne for uønskede mutationer under syntesen af ​​PCR-produkterne.
    2. Anbring rørene i en thermocycler med følgende indstillinger: 94 ° C 30 sek; 30 cyklusser af følgende indstillinger: 98 ˚C 10 sek, 50 ˚C 15 sek, 72 ˚C 1,5 min; og 72 ° C 10 min.
      BEMÆRK: Det kan være nødvendigt Optimering af PCR-parametre for specifikke primer sæt og target histon-gen.

4. Co-transformation af fuld størrelse PCR Produkter og Backbone Plasmid, og Selection for Marker på plasmid

  1. Koncentration af PCR-produkter
    1. Samle six PCR-reaktioner (600 pi alt) fra trin 3.2.2 i et enkelt mikrocentrifugerør og vortexes.
    2. Split prøven i tre 200 pi prøver i mikrocentrifugerør. Udfælde DNA'et i hvert rør ved tilsætning af 20 pi 3 M natriumacetat (pH 5,2) og 550 pi 100% ethanol. Blande opløsningen grundigt og anbring på is i mindst 15 min. Indsamle DNA ved centrifugering ved ~ 14.000 xg i 10 minutter, skylles pelleten med 200 pi af 70% ethanol og lufttørre.
    3. Resuspender hver DNA pellet i 25 pi dH2O og pool i et enkelt rør (for i alt 75 pi).
  2. Gær cotransformation
    1. Forbered 10 ml overnatskultur af stammen genereres i afsnit 1 i gærekstrakt Peptone Dextrose (YPD) flydende medium 11.
    2. Den følgende morgen, pode 400 ml YPD flydende medium med 8 ml af mættet overnatskultur og inkuberes ved rystningved 30 ° C i 4 - 5 timer for at tillade celler at indtaste logaritmisk vækstfase.
    3. Indsamle cellerne ved centrifugering ved ~ 3.220 x g i 10 minutter, kassere det flydende medium, og cellerne resuspenderes i 1 volumen 10 mM Tris-HCI (pH 8,0), 1 mM EDTA, 0,1 M lithiumacetat opløsning (TE / LiAc) .
    4. Saml cellerne ved centrifugering ved ~ 3220 xg i 10 min, og kassér TE / LiAc.
    5. Resuspender cellerne i 1 ml TE / LiAc.
    6. Oprettet følgende reaktion cocktail i et mikrocentrifugerør: 800 pi celler fra trin 4.2.5, 40 pi kogt 10 mg / ml laksesperma-DNA, i alt 12,5 ug backbone plasmid-DNA, og 75 pi koncentreret PCR-produkt fra trin 4.1.3.
      BEMÆRK: laksesperma-DNA bør koges i 5 minutter og anbragt på is i mindst 5 min før anvendelse i reaktionen. Samlet volumen af ​​backbone plasmid-DNA tilføjet bør holdes på et minimum (~ 80 pi eller mindre). Se Repræsentant Resultater sektion for et eksempel på en rygrad plasmid.
    7. Bland cocktail rør grundigt og prøve jævnt i otte mikrocentrifugerør (Tubes 1 - 8 ud).
    8. Opsæt følgende to kontrol transformation reaktionsrør:
      1. Rør 9 (intet PCR produkt kontrol): 100 pi celler fra trin 4.2.5, 5 pi kogt 10 mg / ml laksesperma-DNA (kogt i 5 min, se trin 4.2.6 note), i alt 1,56 ug backbone plasmid-DNA og intet PCR produkt tilsat.
      2. Røret 10 (intet DNA kontrol): 100 pi celler fra trin 4.2.5, 5 pi kogt 10 mg / ml laksesperma-DNA (se trin 4.2.6 Note), ingen rygrad plasmid-DNA tilsat, og intet PCR produkt tilsat.
      3. Bland begge rør forsigtigt, men grundigt ved pipettering op og ned adskillige gange.
    9. Inkubér ti rør ved 30 C i 30 minutter.
    10. Til hvert rør tilsættes 1,2 ml 40% polyethylenglycol (PEG 3350) i TE / LiAc. Bland grundigt med en P-1000 pipette, indtil opløsningen er homogen.
    11. Inkubér ti rør ved 30° C for 30 min. Forsigtigt blande opløsningen ved pipettering op og ned og derefter inkuberes rørene ved 42 ° C i 15 min.
    12. Opsamle cellerne ved at dreje rørene i et mikrocentrifuge ved ~ 14.000 x g i 30 sek. Kassér væsken og udeluk cellerne i 1 ml sterilt dH 2 O.
    13. Opsamle cellerne ved at dreje rørene i et mikrocentrifuge ved ~ 14.000 x g i 30 sek. Kassér væsken og udeluk cellerne i 500 pi sterilt dH 2 O.
    14. Pool rør 1-8 sammen (samlet volumen på 4 ml) samt bland grundigt ved pipettering op og ned.
    15. Plade 200 pi af den ovennævnte blanding på hver af tyve komplette minimal dropout medium pladerne 11 (plader 1-20) til udvælgelse af rygraden plasmid.
    16. Plade 200 pi af blandingen fra Tube 9 og 200 pi blanding fra røret 10 hver på sit eget udvalg plade (plader 21 og 22, henholdsvis).
    17. Inkubér 22 plader ved 30 ° C i 3 - 5 dage tilselektere for plasmidet transformanter.
    18. Inspicere transformationsplader efter 3 - 5 dages inkubation. Ca. 5.000 kolonier skal være synlig på plader 1-21 (se Repræsentative Resultater for et eksempel), og ingen kolonier bør være til stede på plade 22.

5. Skærm for 5-FOA-resistente transformanter

  1. Overfør celler fra plader 1 - 20 ud (og transformation pladen 21 som kontrol) til 5-fluororotsyre (5-FOA) plader 11 ved replika-udpladning 12 for at screene for tab af URA3-genet som følge af integration af PCR-produkter på det ønskede sted.
    1. Tag pladen låget og trykke på plade indeholdende kolonier på en steril fløjl. Overfør cellerne fra velvet til en 5-FOA plade ved at trykke pladen på fløjl. Pladerne inkuberes ved 30 C i 2 dage.
  2. Efter 2 dages inkubation omhyggeligt inspicere 5-FOA-plader til growth.
    BEMÆRK: En kandidat integration begivenhed vil være repræsenteret ved en lille asymmetrisk "smadret" koloni på en 5-FOA plade - omvendt lille papiller vokser på 5-FOA-plader sandsynligvis repræsentative for spontane URA3 mutationer, der opstod under væksten af kolonier på transformation plader, og er således usandsynligt, at repræsentere den ønskede integration begivenhed (se figur 3 i afsnittet Repræsentative resultater for yderligere uddybning af dette punkt, og for nogle eksempler).

6. Rensning af 5- FOA-resistente kolonier og Tab af Backbone Plasmid

  1. Ved hjælp af sterile tandstikkere, plukke kandidatlandene kolonier fra 5-FOA-plader, der er beskrevet i trin 5.2 og streak for enkelte kolonier på YPD-plader. Der inkuberes i 2 - 3 dage ved 30 ° C.
  2. Efter inkuberingen replika - plade hver YPD oprensning plade til en frisk YPD plade, en drop-out plade uden uracil at kontrollere for tabaf URA3-genet, og en anden drop-out plade til at overvåge for tilstedeværelse eller fravær af rygraden plasmid. Der inkuberes i 1 - 2 dage ved 30 ° C.
  3. Efter inkuberingen identificere en koloni fra hver kandidat prøve, der vokser på YPD plade, men ikke vokser på enten frafald plade (forventes en sådan koloni at have mistet URA3-genet gennem rekombinationsbegivenhed og tabt rygraden plasmidet under mitotiske celledeling). Restreak sådanne kolonier på friske YPD plader. Disse kolonier er integration kandidater og vil blive analyseret yderligere i trin 7.

7. Molekylære analyser til Assay for korrekt integration af mutante allel

  1. Isoler genomisk DNA fra ansøgerlandene prøver ved hjælp af standardprocedurer 10.
  2. Amplificere genomisk region, der omfatter målstedet.
    1. Opsæt den følgende PCR-reaktion for hver prøve: 0,5 pi skabelon DNA 5 pi10 uM fremadrettet primer, 5 pi 10 pM revers primer, 0,5 pi (2,5 enheder) Taq-DNA-polymerase, 5 pi 10x Taq DNA polymerase buffer, 5 pi dNTP-blanding (2 mM af hver), og 29 pi dH 2 O.
      BEMÆRK: Template DNA er det genomiske DNA afledt fra kandidat- prøver. Det anbefales også at indbefatte to kontrolreaktioner: en anvendelse af genomisk DNA afledt fra de oprindelige histon geneΔ :: URA3-stammen som template og en anden anvendelse af genomisk DNA fra en vildtype-histon-stammen som template. At tage højde for variationer i DNA-koncentration og niveau af urenheder i forskellige genomiske præparater, anbefales det at optimere reaktionerne ved anvendelse af enten ufortyndet DNA eller forskellige fortyndinger af de genomiske præparater (fx 1:10 og 1: 100). Det er vigtigt at sikre, at disse primere annealer til DNA-sekvenser uden for regionen omfattet af den putativt integrerede PCR-produkt - denne måde størrelsen af PCR-produkterne i disse reactions kan anvendes som et diagnostisk værktøj til integration af produkterne på det korrekte genomiske placering (se Repræsentative Resultater for et eksempel).
    2. Placer reaktionerne i en thermocycler med følgende indstillinger: 94 ° C 3 min; 30 cykler af følgende indstillinger: 94 ° C 45 sek, 50 ° C 45 sek, 72 ° C 2 minutter; og 72 ° C 10 min.
      BEMÆRK: Det kan være nødvendigt Optimering af PCR-parametre for specifikke primer sæt og target histon-gen.
  3. Forarbejdning af PCR-produkter
    1. Kør 20 pi fra hver reaktion på en 0,8% TBE agarosegel.
    2. Vurdere størrelsen af PCR-produkterne under anvendelse af DNA-standarder som en reference for at bestemme om URA3-genet er blevet erstattet af den putativt muterede histon-gen (se Repræsentative resultater for et eksempel).
      BEMÆRK: I visse tilfælde den ønskede mutation (er) indført i histon gener enten oprette eller ødelægge en begrænsning siddee. Hvis dette er tilfældet, kan tilstedeværelsen af ​​den ønskede mutation i PCR-produkterne af den størrelse, der indikerer korrekt integration vurderes ved at udsætte produkterne for fordøjelse med det tilsvarende restriktionsenzym efterfulgt af gelelektroforese analyse (se Repræsentative resultater for et eksempel) .
    3. Om PCR-produkter af størrelsen indikerer korrekt integration til DNA-sekventering for at bekræfte tilstedeværelsen af ​​den ønskede mutation (er) og sikre, at ingen yderligere mutationer er blevet indført i genomet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi beskriver genereringen af en hht2 allel udtrykker et histon H3 mutantprotein huser en substitution i position 53 fra en arginin til en glutaminsyre (H3-R53E mutant) som et repræsentativt eksempel på den målrettede in situ-mutagenese strategi.

Vi genererede et stamme, hvor hele ORF af HHT2 erstattes af URA3-genet (se trin 1 i protokol). Denne stamme, yAAD156, også havne en his3A200 allel, som forårsager, at cellerne til at være auxotrof for histidin. Efter fremgangsmåden i trin 2 i protokollen, så genererede vi de to delvist overlappende fragmenter af HHT2. Følgende primere blev anvendt til det første fragment: Forward Primer (OAD20): 5'GCGTTCATTATCGCCCAATGTG 3 'og revers primer (R53Erev): 5'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. Følgende primers blev anvendt til andet fragment: Forward Primer (R53Efor): 5'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3 'og revers primer (OAD21): 5'GCGCTTGATCAGCAGTTCATCG 3'. Bemærk, at den reverse primer i den første reaktion og den fremadrettede primer i den anden reaktion indeholder de ønskede muterede nucleotider (med små bogstaver) - disse muterede nucleotider er beliggende i mellem to lange strækninger af vildtypesekvenser, da dette giver mulighed for effektiv annealing af primeren til skabelon-DNA'et på trods af mismatch ved de muterede positioner. Bemærk også, at de muterede nukleotider i disse to primere er revers komplementære med hinanden og forårsage en AG GA mutation i sense-strengen, hvilket resulterer i en AGA at GAA kodonændring, som i sidste ende frembringer den R53E mutation i det kodede protein. Resultater fra disse PCR-reaktioner er vist i figur 2A.

Under anvendelse af proceduren i trin 3, vi så Gener ated i fuld størrelse PCR-produkter. De anvendte primere var Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'og Reverse Primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Ved udformningen af ​​disse primere, er det vigtigt at sørge for, at de resulterende fusion PCR produkter omfatter mindst 40 basepar på begge ender til at drive den homolog rekombination reaktion (jo længere regionerne homologi, vil de mere effektive og specifikke de homologe rekombination begivenheder være). I vort eksperiment, i fuld størrelse PCR-produkter indeholdt et 195 basepar region og 220 basepar region homolog med regionerne opstrøms og nedstrøms for HHT2 ORF hhv. En prøve af disse PCR-produkter blev analyseret ved agarosegelelektroforese (figur 2B).

De fuld størrelse PCR-produkter blev derefter co-transformeret sammen med plasmidet pRS413 (en centromerisk, HIS3- mærket plasmidf "> 13), og transformanter blev selekteret på plader, der mangler histidin (SC-His plader) som beskrevet i trin 4 i protokollen. His + kolonier blev derefter screenet for 5-FOA resistens følge procedurerne beskrevet i trin 5 i protokollen. Figur 3 viser et eksempel på en transformation plade (SC-hans) og 5-FOA-plader efter replika-plating fra SC-hans plader. Eksempler på kandidat prøver samt prøver usandsynligt at repræsentere de ønskede integration begivenheder præsenteres også i figur 3 . i vores eksperiment, vi identificeret tolv ansøgerlande prøver ud af ~ 90.000 transformanter screenet. Disse kandidater blev derefter renset som beskrevet i trin 6 i protokollen.

De tolv kandidater blev derefter udsat for PCR-analyse beskrevet i trin 7 i protokollen for at vurdere, om de afspejler autentiske udskiftninger af URA3-genet med mutant PCR-produkter. For vores eksperimenterendet, vi anvendte en fremadrettet primer, der annealer 89 basepar opstrøms for integrationsstedet af PCR-produktet og en revers primer, der annealer 302 basepar nedstrøms for integrationsstedet af PCR-produktet. Disse primere genererer PCR-produkter af 1217 basepar i størrelse, hvis HHT2 locus er besat af HHT2 (eller mutante versioner af HHT2 huser basepar substitutioner), eller PCR-produkter af 2188 basepar i størrelse, hvis locus er besat af URA3-markørgenet . Sekvensen for Forward Primer anvendte (OAD476) er: 5 'GAAACTATTGGCACGCCCTA og den for Reverse Primer anvendte (OAD477) er: 5' CCTGCGAATCAACCGATACT 3 '. Af de tolv kandidater vi havde identificeret, fire viste integration af et PCR-produkt på den korrekte placering (se figur 4A for et eksempel). Endelig da AG til GA mutation genererer en ny Eco RI restriktion site, vi udsat PCR-produkter fra en af de succesfulde integration prøver til en figur 4B). I dette særlige tilfælde har vi ikke sekventere PCR-produkterne for at sikre, at yderligere uønskede mutationer ikke var blevet indarbejdet i genomet: dog har vi brugt en procedure meget lig dette til at generere et stort antal HHT2 mutationer i et tidligere studie 14, og fandt, at størstedelen af ​​de integrerede mutante alleler bærer ingen andre end de ønskede dem mutationer.

Figur 2
Figur 2: Dannelse af PCR produkter huser Ønsket Mutationer til integration i gærgenomet. (A) PCR-reaktion for at danne de delvist overlappende fragmenter af HHT2 indeholdende de ønskede mutationer. Top: tegneserie repræsentation af than to PCR-reaktioner for at opnå de to HHT2 fragmenter (se Figur 1B-1). Røde cirkler repræsenterer de fejlparrede nukleotider på primerne anvendt til at indføre AG GA mutation i sense-strengen af ​​genet. Nederst: gelelektroforese analyse af PCR-produkter A og B (bane 2 og 3, henholdsvis). DNA-standarder er vist i bane 1. (B) Fusion PCR-reaktion for at generere fuld størrelse PCR-produkt til integration i gær genomet (se Figur 1B-2 og 3). Top: tegneserie repræsentation af PCR-reaktionen og forventede PCR-produkt (produkt C). Røde cirkler repræsenterer ønskede mutation som beskrevet i (A) ovenfor. Nederst: gelelektroforese analyse af PCR-produkter c (bane 2). DNA-standarder er vist i bane 1. Klik her for at se en større version af dette tal.


Figur 3: Repræsentative resultater fra Co-transformation Experiment og 5-FOA Screen. Venstre: repræsentativ SC-hans plade belagt med celler udsat for co-transformation procedure efter en 3-dages inkubation ved 30 ° C. Cirka 5.000 kolonier blev talt. I midten: repræsentativ 5-FOA plade efter replica plating fra en SC-hans co-transformation plade efter et 2-dages inkubation ved 30 ° C. Prøver 1 og 2 blev anset kandidater for at have været igennem en vellykket integration begivenhed på grund af deres asymmetriske morfologier. Dette skyldes, at en sand erstatning af URA3-genet med hht2 allel forventes at optræde før (eller meget snart efter) en transformeret celle udplades på SC-sin plade og, som et resultat, kolonien, der vil opstå på det sted vil indeholde det meste, hvis ikke udelukkende, 5-FOA-resistanT-celler - når en sådan koloni er så efterfølgende replika-udpladet til et 5-FOA plade det vil blive klemt, hvilket giver anledning til et asymmetrisk udseende plaster af celler på pladen. Omvendt spontan mutationer i URA3-genet, der kan opstå under kolonidannelse er mere tilbøjelige til at blive indesluttet i en lille region af en koloni, og dermed mere tilbøjelige til at give anledning til papiller når replika-udpladet til et 5-FOA plade. Højre: en anden repræsentant 5-FOA plade efter replika-udpladning fra en SC-His cotransformation plade efter en 3-dages inkubation ved 30 ° C. En yderligere kandidat (prøve 3) samt to små papiller er synlige på denne plade (prøverne 4 og 5) - sådan papiller, der er mest tydeligt synlige efter 3 eller flere dages inkubation, kan forventes at repræsentere spontane URA3 mutationer og ikke den ønskede integration event. Klik her for at seen større version af denne figur.

Figur 4
Figur 4: Molekylær Analyser af Candidate Integration prøver. (A) PCR assay til at identificere vellykkede integration begivenheder. Top: tegneserie repræsentationer af PCR-reaktioner anvendes til at vurdere vellykket integration af de hht2 mutant allel i genomet. Nederst: gelelektroforese analyse af PCR-reaktioner under anvendelse af genomisk DNA afledt af en HHT2 vildtypestamme (anvendt som kontrol, bane 2), stamme yAAD156 huser hht2Δ :: URA3 udskiftning (anvendt som kontrol, bane 3), en kandidat integration prøve (bane 4), og en 5-FOA-resistente papiller prøve (og således sandsynligvis ikke repræsentere en korrekt integration begivenhed, bane 5). DNA-standarder er vist i bane 1. Bemærk, at størrelserne af PCR-produkterne for kandidaten integration prøven er consistent med en vellykket integration begivenhed, hvorimod størrelsen af PCR-produkterne for papiller prøven er konsistent med en intakt hht2Δ :: URA3-locus. (B) EcoRI-fordøjelse for at bekræfte tilstedeværelsen af mutant allel. Top: tegneserie repræsentation af de forventede fordøjelse fragmenter afledt fra en EcoRI-fordøjelse omsætning af PCR-produkter indeholdende enten vildtype HHT2 genet eller mutant hht2 allel. Nederst: gelelektroforese analyse af fordøjelse reaktioner af PCR-produkter afledt af en vildtype HHT2 stamme (bane 2; PCR-produkterne anvendes her blev afledt fra den samme prøve som den, der anvendes i bane 2 i panel A) og en kandidat integration prøve ( bane 3, PCR-produkterne anvendes her blev afledt fra den samme prøve som den, der anvendes i bane 4 i pladen A). DNA-standarder er vist i bane 1. Bemærk, at fordøjelsesmønstre bekræfter, at AG GA mutation er blevet indført i genomet af kandidatenintegration prøve. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det høje niveau af sekvenshomologi mellem de to ikke-allele gener, der koder for hver af de fire centrale histonproteiner i haploide S. cerevisiae-celler kan repræsentere en udfordring for forskere, der ønsker at specifikt mod et af de to gener for mutagenese. Tidligere beskrevne gær mutagenese-metoder, herunder Delitto Perfetto, stedspecifik genomisk (SSG) mutagenese, og kloningsvektorer-free PCR-baserede allel udskiftning metoder 5, 6, 7, såvel som nyere gær CRISPR-baserede teknikker 15, ofte afhængige i det mindste delvist på sekvenser i ORF af et målgen at ansætte de rekombination eller reparation machineries til det ønskede genomiske sted til sidst generere den endelige mutant allel. På den anden side, den strategi, vi har præsenteret her gør brug af DNA-sekvenser, der flankerer målrettet ORF at drive homologoos rekombinationsbegivenhed nødvendig for integration af mutationen, og som et resultat, giver mulighed for mere specifik målretning af et gen over en anden på trods af de to gener med meget homologe ORF'er. Denne funktion gør vores strategi særdeles velegnet til histon mutagenese. Dog kan denne strategi også tilpasses til mutagenese af andre gener i gærgenomet.

Yderligere funktioner i vores strategi omfatter de kendsgerninger, som længderne af de regioner, der driver homolog rekombination af de mutante gener kan designes til at være meget omfattende, hvilket øger effektiviteten af ​​integration på målet genomisk placering, og at der ud over den ønskede mutation (er ) ingen yderligere DNA-sekvenser indføres i genomet. En yderligere fordel ved dette system er, at når en stamme, der huser udskiftning af en specifik histon-gen med URA3 er blevet konstrueret, kan den anvendes til frembringelsen af enhver ønsket mutant version af denne særlige histet gen. Således for eksempel stamme yAAD156, som er tilgængelig for forskersamfundet efter anmodning, kan bruges til at gøre enhver ønsket hht2 mutation uden behov for at konstruere en de novo hht2Δ :: URA3 allelen. Endelig ved at anvende korrekt udformet PCR-primere, denne strategi kan også anvendes til at generere histon alleler med interne deletioner eller med mutationer ved multiple kodoner, så længe de er relativt tæt på hinanden (f.eks Vi har genereret en hht2 allel koder for en H3-K56R, L61W dobbelt mutant protein under anvendelse af denne strategi).

Evnen til specifikt at målrette en af ​​to meget homologe histon gener for mutagenese kunne være nyttig i en række forskellige eksperimentelle indstillinger. For eksempel, da HHT1-HHF1 gener udtrykkes på forskellige niveauer i forhold til HHT2-HHF2 gener 16, kunne det være af interesse at bestemme, om en bestemt H3 eller H4 mutation giver different fænotyper, afhængigt af hvilken genet det udtrykkes fra. Et andet eksempel er et scenarie, hvor en undersøger ønsker at generere haploide celler, der udtrykker en bestemt histon mutant fra begge tilsvarende histon-gener - dette kan opnås ved først mutagenisering hvert gen uafhængigt i to forskellige stammer, og derefter opnå dobbeltmutantstammer haploide celler gennem et indlæg og efterfølgende isolering af de ønskede meiotiske produkter. Endnu et andet eksempel angår mutagenese af histoner H2A og H2B: i betragtning af, at to lidt forskellige isoformer af hvert protein kodes af den tilsvarende ikke-allele gensæt kan en investigator ønsker at vurdere virkningerne af en specifik H2A eller H2B mutation i forbindelse med enten isoform. Når du designer eksperimenter for at mutagenisere HTA1 og HTB1 loci (koder H2A og H2B henholdsvis), bør efterforskere være opmærksom på de seneste resultater viser, at stammer bærer en (hta1-htb1) Δ er levedygtige kun if de har forstærket HTA2-HTB2 locus (og nærliggende HHT1-HHF1 locus såvel) ved produktion af en lille cirkulær kromosom 17, da dette kan vanskeliggøre fortolkningen af resultaterne.

Vi har for nylig brugt en version af denne histon mutagenesestrategi at generere histon H3-proteiner, der udtrykker alle mulige aminosyresubstitutioner i position 61, der normalt optages af aminosyren leucin 14. For de eksperimenter, i stedet for anvendelse yAAD156 som udgangsstammen for mutagenese, vi anvendte stamme yADP106, som huser en udskiftning af HHT2 ORF med både URA3 og TRP1 ernæringsmæssige markører (i stedet for bare URA3). Tilstedeværelsen af ​​både markørgener lettet identifikation af kandidater til integration af de muterede PCR-produkter efter 5-FOA-skærm og rensning trin (trin 5 og 6 i protokollen), som sådan candidates blev fænotypisk Ura - og Trp -, mens spontan URA3 mutation resulterede i celler med et Ura - Trp + fænotype. yADP106 er også tilgængelig på anmodning, som er sekvensen af URA3-TRP1 kassette, som kunne amplificeres som en enhed og anvendes til mutagenese af andre histon gener ved anvendelse af strategien beskrevet heri.

Manglende evne til at opnå de ønskede histon mutanter bruger denne strategi kunne tilskrives en række mulige årsager, herunder utilstrækkelig mængde fuld størrelse PCR-produkter, der anvendes til integration trin eller et utilstrækkeligt antal transformanter efter co-transformation trin. Den tidligere problem kunne løses ved at samle sammen større sæt af PCR-reaktioner eller ved at designe forskellige primersæt, der producerer et højere udbytte af produktet, mens det sidstnævnte problem kunne løses ved hjælp af større mængder af backbone-plasmid i co-transformation eksperiment. althoUH, som indikeret tidligere, kan man anvende denne procedure til at generere histon-mutanter, der huser to eller flere aminosyresubstitutioner, de målrettede aminosyrer skal være relativt tæt på hinanden, da de respektive kodoner behøver at være placeret i samme primermolekyle. Således er denne strategi kan ikke let tilpasses til frembringelse af histoner med multiple mutationer placeret fjernt fra hinanden over længden af ​​proteinerne.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Målrettet<em&gt; I Situ</em&gt; Mutagenese af histon-gener i knopskydende gær
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter