Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

gerichte doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De vier kern histon-eiwitten H2A, H2B, H3, H4 en spelen een centrale rol in de verdichting, organisatie en functie van eukaryote chromosomen. Twee sets van elk van deze histonen vormen de histon octameer, een moleculaire spoel dat de verpakking van ~ 147 basenparen van DNA rond zichzelf richt, uiteindelijk resulterend in de vorming van een nucleosoom 1. Nucleosomen actief deel aan een verscheidenheid van chromosoom processen, zoals de regulering van gentranscriptie en de vorming van heterochromatine en euchromatine in chromosomen, en als zodanig zijn de focus van intens onderzoek in de loop van de afgelopen decennia. Een aantal mechanismen beschreven waarmee nucleosomen kan worden gemanipuleerd op een manier die uitvoering van specifieke processen vergemakkelijken - deze mechanismen omvatten posttranslationele modificatie van histon residuen, ATP-afhankelijke nucleosoom remodeling en ATP-onafhankelijke nucleosoom reorganisatieen montage / demontage 2, 3.

De gist Saccharomyces cerevisiae is een bijzonder krachtige modelorganisme voor het begrijpen van histone functie in eukaryoten. Dit is grotendeels te wijten aan de hoge mate van evolutionaire conservering van het histon eiwitten gehele domein Eukarya en de ontvankelijkheid van gist aan een verscheidenheid van genetische en biochemische experimentele benaderingen 4. Omgekeerde genetische technieken in gist zijn op grote schaal gebruikt om de effecten van specifieke histon mutaties op de verschillende aspecten van chromatine biologie bestuderen. Voor deze soorten experimenten is het vaak de voorkeur om cellen waarin het mutant histonen tot expressie gebracht vanaf hun eigen genomische loci, zoals expressie van autonome plasmiden gebruik kan leiden tot abnormale intracellulaire niveaus van histon eiwitten (vanwege variërende aantallen plasmiden in cellen) en gelijktijdige wijziging van chromatine environments, die uiteindelijk de interpretatie van de resultaten kan verwarren.

Hier beschrijven we een PCR-gebaseerde techniek die het mogelijk maakt voor gerichte mutagenese van histon genen op hun oorspronkelijke genomische locaties die geen kloneringsstap en resulteert in het genereren van de gewenste mutatie (s) zonder overgebleven exogene DNA-sequenties in het genoom vereist. Deze techniek maakt gebruik van een efficiënte homologe recombinatie systeem in gist en heeft een aantal kenmerken gemeen met andere soortgelijke technieken ontwikkeld door andere groepen - vooral de Delitto Perfetto, plaatsspecifieke genomische (SSG) mutagenese en kloneren vrij-PCR allel vervangingsmethoden 5, 6, 7. De techniek beschrijven we de beeldverhouding dat maakt het bijzonder geschikt voor mutagenese van histon-genen. In haploïde gistcellen, elk van de vier kernhistonen wordt gecodeerd door twee niet-allelic en zeer homologe genen: bijvoorbeeld, histon H3 wordt gecodeerd door de HHT1 en HHT2 genen, en de open leesramen (ORFs) van beide genen dan 90% identiek in sequentie. Deze hoge mate van homologie kunnen experimenten ontworpen om specifiek op een van de twee-histon coderende genen voor mutagenese bemoeilijken. Dat voornoemde werkwijzen vereisen vaak het gebruik van ten minste enkele sequenties binnen het ORF van het doelwitgen homologe recombinatie drijven de techniek hier beschreven maakt gebruik van sequenties die het ORF van het histon-genen (die veel minder sequentiehomologie delen) voor de recombinatie stap, waardoor de kans op succesvolle targeting van mutagenese verhogen tot de gewenste locus. Bovendien kan de homologe gebieden die recombinatie rijden zeer omvangrijk zijn, wat verder bijdraagt ​​aan efficiënte gerichte homologe recombinatie.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

OPMERKING: De experimentele strategie voor gerichte in situ mutagenese histon-gen omvat verschillende stappen (samengevat in figuur 1). Deze stappen omvatten: (1) Vervanging van het doel histon-gen het URA3-gen, (2) Productie en zuivering van PCR-producten die overeenkomen met twee gedeeltelijk overlappende fragmenten van het doel histon-gen onder toepassing van primers die het op gewenste mutatie (s), (3 ) Fusion PCR van de twee gedeeltelijk overlappende fragmenten volledige grootte PCR producten te verkrijgen voor integratie, (4) Co-transformatie van volledige grootte PCR producten en ruggengraat plasmide en selectie voor markering op plasmide (5) scherm voor 5-FOA-resistente transformanten, (6) Zuivering van 5-FOA-resistente kolonies en verlies van plasmide backbone, en (7) Moleculaire analyses om te testen op een goede integratie van het mutante allel.

Figuur 1
in situ Mutagenese van histon genen in gist. In dit voorbeeld het doelgen is HHT2, maar andere kern histon-gen kan ook worden gemutageniseerd met behulp van deze strategie. (A) haploïde gistcellen herbergen twee histon-H3 coderende genen (HHT1 en HHT2) en twee histon H4 coderende genen (HHF1 en HHF2) opgesteld als aangegeven in de figuur (de HHT1 en HHF1 genen zijn gelokaliseerd op chromosoom II en HHT2 en HHF2 genen zijn gelokaliseerd op chromosoom XIV - telkens de pijlen in de richting van transcriptie). In de eerste stap van de procedure, het ORF van het HHT2 gen wordt vervangen door het URA3-gen, die tot een hht2Δ :: URA3 stam. (B) In deel 1, is een wildtype kopie van het HHT2 gen uit een genomisch DNA monster wordt gebruikt als matrijs voor twee PCR reacties generatE de twee gedeeltelijk overlappende fragmenten van het gen. De omgekeerde primer voor de eerste reactie een of meer niet passende nucleotiden (aangegeven met een rode cirkel) die overeenkomen met de gewenste mutatie (s) in het genoom worden ingebracht. De voorwaartse primer voor de tweede reactie is het equivalent mismatch in een omgekeerde complementaire configuratie (ook aangeduid met een rode cirkel). De twee PCR-producten gegenereerd in deel 1 (producten a en b) worden vervolgens als matrijzen gebruikt voor fusie PCR met behulp van twee primers die hybridiseren aan producten A en B in de wijze getoond in deel 2. Dit resulteert in de generatie van full-size PCR producten (product c in deel 3) het herbergen van de gewenste mutatie (s). (C) De hht2Δ :: URA3 stam dan co-getransformeerd met de zo groot PCR-producten en een plasmide backbone (a HIS3- gemerkt plasmide in dit voorbeeld) en cellen worden geselecteerd op de aanwezigheid van het plasmide (op medium dat histidine in dit voorbeeld). Transformanten worden vervolgens op 5-FOA resistentie - resistente cellen zijn kandidaten voor een homologe recombinatiegebeurtenis die leidt tot de integratie van het PCR-product en excisie van het URA3-gen hebben ondergaan, zoals getoond. Daaropvolgende verlies van de ruggengraat plasmide door mitotische celdeling leidt tot de uiteindelijke gewenste histon mutante stam. We hebben dat selectie van de ruggengraat plasmide, gevolgd door screening op 5-FOA resistentie resulteert in een veel hogere frequentie identificatie correcte integratiegebeurtenissen vergelijking met directe selectie op 5-FOA platen, die meestal identificeert cellen die spontane URA3 mutaties verworven gevonden. (Dit cijfer is gewijzigd ten opzichte van referentie 14). Klik hier om een grotere versie van deze figuur te bekijken.

1. Vervanging van de Target Histon Gene met de URA3Gen

  1. Voer standaard PCR-gemedieerde eenstaps genverstoring vervanging van het ORF van target histon-gen met de URA3 gen 8, 9.
    Opmerking: Het gebruik van gistcellen die de ura3Δ0 wordt aanbevolen als deze mutatie verwijdert de gehele ORF endogene URA3, waardoor integratie van het PCR-product te vermijden in de URA3-locus 8. Als alternatief kan de K. lactis URA3 gen effectief worden gebruikt voor het genereren van de histone vervangende één URA3 achtergrond als functioneel in S. cerevisiae maar heeft slechts gedeeltelijke sequentiehomologie met het S. cerevisiae URA3-gen. De stam moet ook auxotroof zijn voor ten minste één verbinding die het mogelijk maakt selectie van het plasmide ruggengraat in de transformatie experiment (zie stap 4 van het protocol). Deze stap is niet nodig als een target histon geneΔ :: URA3stam is al beschikbaar.

2. Generation en zuivering van PCR producten die overeenstemmen met twee gedeeltelijk overlappende Fragmenten van de Target Histon Gene met behulp van primers herbergen van de gewenste mutatie (s)

  1. PCR-producten genereren die overeenkomen met twee gedeeltelijk overlappende fragmenten van de gewenste histon-gen.
    1. Bereid twee PCR reacties als volgt:
      1. 1 pl template-DNA, 5 μl10 pM forward primer, 5 μl10 uM reverse primer, 0,5 ui (1,25 U) thermostabiele: om PCR-producten die overeenkomen met de eerste helft van het gen (product een in figuur 1B), het opzetten van de volgende reactie te genereren DNA polymerase, 10 pl 5x DNA polymerase buffer, 5 pl dNTP mengsel (2 mM elk) en 23,5 pl dH 2 O.
        OPMERKING: De template DNA kan genoom DNA afkomstig van een wildtype stam van het doelwit histon gen geïsoleerd met behulp van standaard proprocedures 10. Ter compensatie van verschillen in DNA-concentratie en het niveau van verontreinigingen in verschillende genomische preparaten, is het raadzaam om de reacties te optimaliseren door hetzij onverdund DNA of verschillende verdunningen van het genomische preparaten (bijvoorbeeld, 1:10 en 1: 100). De voorwaartse primer moet hybridiseren met een gebied stroomopwaarts van het doelwitgen. De reverse primer moet hybridiseren binnen het ORF, worden ~ 40 nucleotiden lang, en bevat de gewenste mutatie (s) ergens in het midden ervan (zie Figuur 1B-1 en Representatieve resultaten sectie voor voorbeelden). Het gebruik van een high fidelity DNA polymerase wordt aanbevolen om tarieven van ongewenste mutaties in de synthese van de PCR producten te verminderen.
      2. PCR producten die overeenstemmen met de tweede helft van het gen (product B in figuur 1B) te genereren, het opzetten van een reactie zoals aangegeven in 2.1.1.1 maar met verschillende primers.
        LET OP: De voorwaartse primer moet hybridiseren binnen het ORF, worden ~ 40 nucleotiden lang, en bevat de gewenste mutatie (s) ergens in het midden ervan. Merk op dat de mutatie (s) in deze primer is het omgekeerde complement van de mutatie (s) in de reverse primer in stap 2.1.1.1. De reverse primer moet hybridiseren met een gebied stroomafwaarts van het bedoelde gen (zie Figuur 1B-1 en Representatieve resultaten sectie voor voorbeelden).
    2. Leg de reacties in een thermocycler met de volgende instellingen: 94 ˚C 30 sec; 30 cycli van de volgende instellingen: 98 C 10 sec, 60 ˚C 5 sec, 72 ° C 1,5 min; en 72 ° C 10 min.
      Opmerking: Optimalisatie van PCR parameters die nodig zijn voor specifieke primersets en target histon gen.
  2. Run 20-50 pl van het materiaal van de PCR-reacties op een 0,9% laag smeltpunt agarose gel in 89 mM Tris-base, 89 mM boorzuur, 2,5 mM EDTA (TBE) buffer.
  3. Snijd agarosegel secties met de PCR producten uit gel met een schone scalpel of scheermesje en dragen elk een 1,5 ml microcentrifugebuis. Bewaar agarose gedeelten met PCR-producten bij -20 ° C tot gebruik.

3. Fusie PCR van de twee gedeeltelijk overlappende fragmenten te verkrijgen Full Size PCR producten voor integratie

  1. Bereid matrijs voor PCR reacties
    1. Smelt agarosegel secties van stap 2.3 door het plaatsen van de microcentrifugebuizen in een warmte-blok set bij 65 ° C gedurende 5 minuten (of tot volledig gesmolten). Vortexbuizen elke 1-2 min om het smelten te vergemakkelijken.
    2. Transfer een ingestelde gesmolten agarose uit elk monster (bijvoorbeeld 50 pl elk voor een totaal van 100 ui) in een microcentrifugebuis en door vortexen gemengd. Met dit als de matrijs in het fusie-PCR reacties. Plaats de buis bij -20 ° C tot gebruik.
  2. Amplificeren een grote hoeveelheid volledige grootte PCR-product (product cfiguur 1B)
    1. Opgericht zes PCR-reacties, elk met de volgende componenten: 2 pl matrijs-DNA, 10 pl 10 pM forward primer, 10 pi 10 uM reverse primer, 1 ui (2,5 U) thermostabiel DNA-polymerase, 20 pl 5x DNA polymerase buffer, 10 pl dNTP mengsel (2 mM elk), en 47 gl dH 2 O.
      Opmerking: Het aantal reacties kunnen worden gewijzigd afhankelijk van de PCR efficiëntie. Het matrijs-DNA (zie 3.1.2) worden verwarmd tot 65 ° C tot het gesmolten, gemengd door vortexen, en de laatste toegevoegd aan de PCR-mix. Eenmaal toegevoegd, meng grondig, maar voorzichtig door pipetteren de oplossing op en neer meerdere malen. Ter compensatie van verschillen in DNA-concentratie in de verschillende monsters, wordt aanbevolen om eerst de reacties te optimaliseren door hetzij onverdund sjabloon of verschillende verdunningen van het sjabloon (bijvoorbeeld 1:10 en 1: 100). De twee primers gebruikt moet hechten aan de twee gedeeltelijk overlappende fragmenten van het doelgen als ziekustrated in Figuur 1B-2 en zijn zodanig ontworpen dat de uiteindelijke PCR producten ten minste 40 baseparen aan beide zijden homoloog zijn aan de flankerende gebieden van het URA3 ORF dat homologe recombinatie stap (zie paragraaf Representatieve resultaten voor voorbeelden) rijdt zal. Het gebruik van een high fidelity DNA polymerase wordt aanbevolen om tarieven van ongewenste mutaties in de synthese van de PCR producten te verminderen.
    2. Plaats de buizen in een thermocycler met de volgende instellingen: 94 ˚C 30 sec; 30 cycli van de volgende instellingen: 98 C 10 sec, 50 ° C 15 sec, 72 ° C 1,5 min; en 72 ° C 10 min.
      OPMERKING: Optimalisatie van PCR parameters vereist zijn voor specifieke primersets en target histon-gen.

4. Co-transformatie van Full Size PCR Producten en Backbone Plasmid en selectie voor Marker op Plasmid

  1. Concentratie van PCR producten
    1. Zwembad de six PCR reacties (600 pi totaal) uit stap 3.2.2 in een enkele microcentrifugebuis en meng door vortexen.
    2. Splits de steekproef in drie 200 ui porties in microcentrifugebuizen. Precipiteren van het DNA in elke buis door toevoeging van 20 pl 3 M natriumacetaat (pH 5,2) en 550 pl 100% ethanol. Meng de oplossing grondig en plaats op ijs gedurende ten minste 15 min. Verzamel DNA door centrifugatie bij ~ 14.000 xg gedurende 10 minuten, spoel de pellet met 200 pl 70% ethanol en drogen.
    3. Resuspendeer elk DNA pellet in 25 ul van dH 2 O en bundelen tot een enkele buis (voor een totaal van 75 ui).
  2. Gist cotransformatie
    1. Bereid 10 ml overnacht cultuur van de stam gegenereerd in deel 1 in gistextract pepton dextrose (YPD) vloeibaar medium 11.
    2. De volgende ochtend, enten 400 ml YPD vloeibaar medium met 8 ml van de verzadigde kweek gedurende de nacht en incubeer door schuddenbij 30 ° C gedurende 4-5 uur om cellen logaritmische groeifase voeren.
    3. Verzamel de cellen door centrifugatie bij ~ 3220 xg gedurende 10 min, gooi het vloeibare medium en resuspendeer de cellen in 1 volume van 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 M lithium acetaat oplossing (TE / LiAc) .
    4. Verzamel de cellen door centrifugatie bij ~ 3220 xg gedurende 10 min en gooi de TE / LiAc.
    5. Resuspendeer de cellen in 1 ml TE / LiAc.
    6. Stel de volgende reactie cocktail in een microcentrifuge buis: 800 pi cellen uit stap 4.2.5, 40 ui gekookt 10 mg / ml zalmsperma DNA, totaal 12,5 ug ruggengraat plasmide DNA en 75 pl geconcentreerde PCR product uit stap 4.1.3.
      OPMERKING: zalmsperma DNA worden gekookt gedurende 5 minuten en geplaatst op ijs gedurende ten minste 5 minuten vóór gebruik in de reactie. Totale ruggengraat plasmide-DNA toegevoegd tot een minimum (~ 80 pi of minder) worden gehouden. Zie Representatieve resultaten sectie voor een voorbeeld van een backbone plasmaID kaart.
    7. Meng de cocktail buis grondig en hoeveelheid gelijkmatig in acht microcentrifugebuizen (Buizen 1-8).
    8. Stel de volgende twee controlegroepen transformatie reageerbuisjes:
      1. Buis 9 (geen PCR product control): 100 pi cellen uit stap 4.2.5, 5 ui gekookt 10 mg / ml zalmsperma DNA (gekookt gedurende 5 min; zie stap 4.2.6 Note), in totaal 1,56 ug ruggengraat plasmide-DNA en geen PCR product toegevoegd.
      2. Buis 10 (geen DNA controle): 100 pi cellen uit stap 4.2.5, 5 ui gekookt 10 mg / ml zalmsperma DNA (zie stap 4.2.6 opmerking) geen ruggengraat plasmide DNA toegevoegd, en er geen PCR-product toegevoegd.
      3. Meng beide buizen grondig, maar voorzichtig door en neer te pipetteren meerdere malen.
    9. Incubeer de tien buizen bij 30 ° C gedurende 30 min.
    10. Aan elke buis, voeg 1,2 ml 40% polyethyleenglycol (PEG 3350) in TE / LiAc. Meng goed met een P-1000 pipet totdat de oplossing homogeen is.
    11. Incubeer de buizen bij 30 tien° C gedurende 30 minuten. Voorzichtig de oplossing te mengen door en neer te pipetteren en incubeer buisjes bij 42 ° C gedurende 15 minuten.
    12. Verzamel de cellen door het draaien van de buizen in een microcentrifuge bij ~ 14.000 xg gedurende 30 sec. Gooi de vloeistof en resuspendeer de cellen in 1 ml steriele dH 2 O.
    13. Verzamel de cellen door het draaien van de buizen in een microcentrifuge bij ~ 14.000 xg gedurende 30 sec. Gooi de vloeistof en resuspendeer de cellen in 500 pi steriel dH 2 O.
    14. Zwembad tubes 1-8 samen (totaal volume van 4 ml) en meng door en neer te pipetteren.
    15. Plaat 200 pi van het bovenstaande mengsel over elk van twintig volledige uitval minimaal mediumplaten 11 (platen 1-20) voor selectie van de ruggengraat plasmide.
    16. Plaat 200 ul van het mengsel uit buis 9 en 200 pi mengsel van buis 10 elk op zijn eigen selectie plaat (platen 21 en 22, respectievelijk).
    17. Incubeer de platen bij 22 30 ° C gedurende 3-5 dagenselecteren op plasmide transformanten.
    18. Inspecteer transformatieplaten na 3-5 dagen incubatie. Ongeveer 5000 kolonies moet zichtbaar op platen 1-21 (zie Representatieve resultaten voor een voorbeeld) en er geen kolonies moet aanwezig zijn op de plaat 22 zijn.

5. Scherm voor 5-FOA-resistente transformanten

  1. Transfer cellen van platen 1-20 (en transformatie plaat 21 als controle) tot 5-fluororotinezuur (5-FOA) platen 11 door replica-plating 12 om te screenen op verlies van het URA3-gen als gevolg van integratie van de PCR producten op de gewenste plaats.
    1. Verwijder de plaat deksel en druk op de plaat met kolonies op een steriele fluweel. Overdracht van de cellen van de fluwelen aan een 5-FOA plaat door te drukken op de plaat op het fluweel. Incubeer de platen bij 30 ° C gedurende 2 dagen.
  2. Naar aanleiding van de 2-daagse incubatie, zorgvuldig te inspecteren de 5-FOA platen voor growth.
    LET OP: Een kandidaat integratie evenement zal worden vertegenwoordigd door een kleine asymmetrische "geplet" kolonie op een 5-FOA plate - omgekeerd, kleine papillen groeien op 5-FOA-platen zijn waarschijnlijk representatief voor spontane URA3 mutaties die ontstonden tijdens de groei van kolonies op de transformatieplaten, en dus waarschijnlijk niet de gewenste integratiegebeurtenis (zie figuur 3 in het gedeelte Representatieve resultaten voor nadere uitwerking van dit punt en voor enkele voorbeelden) vertegenwoordigen.

6. Zuivering van 5-FOA-resistente kolonies en het verlies van Backbone Plasmid

  1. Met behulp van steriele tandenstokers, kies de kandidaat-kolonies van de 5-FOA platen in stap 5.2 en streak beschreven voor enkele kolonies op YPD-platen. Incubeer gedurende 2-3 dagen bij 30 ° C.
  2. Na de incubatie, replica - plaat elk YPD zuivering plaat om een frisse YPD plaat, een drop-out plaat zonder uracil om te controleren op verliesvan het URA3-gen en een tweede drop-out plate te controleren op de aanwezigheid of afwezigheid van het plasmide ruggengraat. Incubeer gedurende 1-2 dagen bij 30 ° C.
  3. Na de incubatie, te identificeren een kolonie van elke kandidaat monster dat groeit op de YPD plaat, maar niet groeien op beide drop-out plaat (zoals een kolonie wordt verwacht dat het URA3-gen te hebben verloren door de recombinatie en verloor de ruggengraat plasmide tijdens mitotische celverdeling). Restreak zulke kolonies op verse YPD platen. Deze kolonies zijn de inburgeraars en zal in stap 7 worden geanalyseerd.

7. Moleculaire Analyses om te testen op een goede integratie van de Mutant allel

  1. Isoleer genomisch DNA van de kandidaat monsters onder toepassing van standaard procedures 10.
  2. Amplify genomische regio omvat het doelgebied.
    1. Stel de volgende PCR-reactie voor elk monster: 0,5 pl template-DNA, 5 ui10 pM forward primer, 5 pl 10 uM reverse primer, 0,5 pl (2,5 eenheden) Taq DNA polymerase, 5 pl 10x Taq DNA polymerase buffer, 5 pl dNTP mengsel (2 mM elk), en 29 gl dH 2 O.
      OPMERKING: Template DNA is genomisch DNA afgeleid uit de kandidaat-monsters. Het verdient aanbeveling om ook twee controlereacties: één gebruikmaking van genomisch DNA afkomstig van de oorspronkelijke histon geneΔ :: URA3 stam als template en andere met genomisch DNA van een wildtype histon-stam als sjabloon. Ter compensatie van verschillen in DNA-concentratie en het niveau van verontreinigingen in verschillende genomische preparaten, is het raadzaam om de reacties te optimaliseren door hetzij onverdund DNA of verschillende verdunningen van het genomische preparaten (bijvoorbeeld, 1:10 en 1: 100). Het is belangrijk om ervoor te zorgen dat deze primers hybridiseren aan DNA-sequenties buiten het gebied omvat door de vermeende geïntegreerde PCR product - deze wijze de grootte van de PCR producten in deze reactions kan worden gebruikt als een diagnostisch hulpmiddel voor integratie van de producten op de juiste genome plaats (zie Representatieve resultaten voor een voorbeeld).
    2. Leg de reacties in een thermocycler met de volgende instellingen: 94 ° C 3 min; 30 cycli van de volgende instellingen: 94 ° C 45 seconden, 50 ° C 45 seconden, 72 ° C 2 min; en 72 ° C 10 min.
      OPMERKING: Optimalisatie van PCR parameters vereist zijn voor specifieke primersets en target histon-gen.
  3. Verwerking van PCR producten
    1. Run 20 ui van elke reactie op een 0,8% TBE agarosegel.
    2. Beoordeelt de grootte van de PCR producten met behulp van DNA standaarden als referentie om te bepalen of de URA3 gen succesvol is vervangen door de vermeende gemuteerde histon-gen (zie Representatieve resultaten voor een voorbeeld).
      Opmerking: In sommige gevallen, de gewenste mutatie (s) die in de histone genen ofwel creëren of te vernietigen beperking zittene. Als dit het geval is, kan de aanwezigheid van de gewenste mutatie in de PCR-producten van de grootte indicatief juist mogelijk worden beoordeeld door het onderwerpen van de producten aan digestie met de overeenkomstige restrictie-enzym, gevolgd door gel-elektroforese analyse (zie Representatieve resultaten voor een voorbeeld) .
    3. Betreft PCR producten van de grootte indicatief juist mogelijk om DNA-sequentiebepaling om de aanwezigheid van de gewenste mutatie (s) bevestigen en dat er geen aanvullende mutaties zijn geïntroduceerd in het genoom.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

We beschrijven het genereren van een hht2 allel tot expressie histon H3 mutant eiwit herbergen een substitutie op positie 53 van een arginine naar een glutaminezuur (H3-R53E mutant) als een representatief voorbeeld van de beoogde in situ mutagenese strategie.

We genereerden een stam waarin het gehele ORF van HHT2 wordt vervangen door de URA3-gen (zie stap 1 van het protocol). Deze stam, yAAD156, herbergt een his3A200 allel, waardoor de cellen auxotrofe voor histidine. Naar aanleiding van de procedure aangegeven in stap 2 van het protocol, dan gegenereerd we de twee gedeeltelijk overlappende fragmenten van HHT2. De volgende primers werden gebruikt voor de eerste fragment: voorwaartse primer (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' en de reverse primer (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. De volgende prIMERS werden gebruikt voor de tweede fragment: voorwaartse primer (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' en de reverse primer (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Merk op dat de omgekeerde primer in de eerste reactie en de voorwaartse primer in de tweede reactiezone bevatten de gewenste gemuteerde nucleotiden (kleine letters) - Deze gemuteerde nucleotiden zijn gelegen tussen twee uitgestrekte wildtype sequenties, omdat hiermee efficiënte hybridisatie de primer aan het matrijs-DNA al past bij de gemuteerde posities. Merk ook op dat de gemuteerde nucleotiden beide primers omgekeerd complementair aan elkaar en veroorzaken een AG GA mutatie in de sense streng, waardoor een AGA codon veranderingen, die uiteindelijk produceert R53E mutatie in het gecodeerde eiwit gaa. Resultaten van deze PCR reacties zijn getoond in figuur 2A.

Met behulp van de procedure in stap 3, we dan gener ated de full-size PCR-producten. De gebruikte primers waren Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'en Reverse Primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Bij het ontwerpen van deze primers, is het belangrijk ervoor te zorgen dat het resulterende fusie PCR producten ten minste 40 baseparen aan beide uiteinden om de homologe recombinatie reactie (hoe langer de gebieden met homologie, hoe efficiënter en specifieker de homologe recombinatie gebeurtenissen rijdt worden). In ons experiment de zo groot PCR producten bevatten een 195 basenparen en 220 basenparen homoloog is met de gebieden stroomopwaarts en stroomafwaarts van het ORF HHT2 respectievelijk. Een monster van deze PCR-producten werd geanalyseerd door agarose gelelektroforese (figuur 2B).

De full-size PCR-producten werden vervolgens co-getransformeerd, samen met plasmide pRS413 (een centromeer, HIS3- gemerkt plasmidef "> 13) en transformanten werden geselecteerd op platen zonder histidine (SC-zijn platen) zoals beschreven in stap 4 van het protocol. His + kolonies werden vervolgens gescreend op 5-FOA resistentie volgens de in stap 5 van het protocol beschreven procedures. figuur 3 toont een voorbeeld van een transformatie plaat (SC-zijn) en 5-FOA-platen na-replica plating van SC-zijn platen. Voorbeelden van kandidaat-monsters, alsook monsters waarschijnlijk de gewenste integratie gebeurtenissen representeren worden ook in figuur 3 . in ons experiment, identificeerden we twaalf kandidaat-monsters uit ~ 90.000 transformanten gescreend. Deze kandidaten werden vervolgens gezuiverd zoals beschreven in stap 6 van het protocol.

De twaalf kandidaten werden vervolgens onderworpen aan de PCR-analyse in stap 7 van het protocol beschreven te beoordelen of ze gereflecteerd authentieke vervanging van het URA3-gen met mutant PCR producten. Voor onze Experiment, gebruikten we een voorwaartse primer die 89 bp stroomopwaarts hybridiseert van de integratieplaats van het PCR-product en een reverse primer die 302 basenparen stroomafwaarts hybridiseert van de integratieplaats van het PCR-product. Deze primers genereren PCR producten van 1217 basenparen formaat als het HHT2 locus bezet door HHT2 (of mutante versies van HHT2 herbergen basenparen substituties), of PCR producten van 2188 baseparen groot als de locus bezet door de URA3 marker-gen . De sequentie van de voorwaartse primer gebruikt (OAD476) is: 5 'GAAACTATTGGCACGCCCTA en dat van de Reverse Primer gebruikt (OAD477) is: 5' CCTGCGAATCAACCGATACT 3 '. Van de twaalf kandidaten we geïdentificeerd, vier vertoonden integratie van een PCR-product op de juiste plaats (zie figuur 4A voor een voorbeeld). Tenslotte, aangezien de AG GA mutatie produceert een nieuwe EcoRI restrictieplaats, we onderworpen PCR producten van een van de geslaagde integratie monsters naar een figuur 4B). In dit geval hebben we geen sequentie de PCR producten dat bijkomende ongewenste mutaties niet was opgenomen in het genoom: hebben we echter een procedure die vergelijkbaar met deze van een groot aantal HHT2 mutaties genereren in een vorig onderzoek 14, en vond dat de meerderheid van de geïntegreerde mutante allelen geen andere dan de gewenste berichten mutaties.

Figuur 2
Figuur 2: Vorming van PCR producten Haveland Gewenste mutaties voor integratie in het genoom van gist. (A) PCR reactie met de gedeeltelijk overlappende fragmenten van HHT2 die het op gewenste mutaties te genereren. Top: cartoon vertegenwoordiging van thij twee PCR reacties op de twee HHT2 fragmenten te verkrijgen (zie figuur 1B-1). Rode cirkels geven de niet passende nucleotiden op de primers gebruikt om de AG GA mutatie in de sense streng van het gen te introduceren. Onder: gelelektroforese analyse van PCR producten A en B (lanen 2 en 3, respectievelijk). DNA standaarden zijn in baan 1 (B) Fusion PCR reactie voor groot formaat PCR product voor integratie in gist genoom te genereren (zie figuur 1B-2 en 3). Top: cartoon vertegenwoordiging van de PCR-reactie en de verwachte PCR-product (product c). Rode cirkels vertegenwoordigen gewenste mutatie zoals beschreven in (A) hierboven. Onder: gelelektroforese analyse van PCR producten c (laan 2). DNA-standaarden worden weergegeven in baan 1. Klik hier om een grotere versie van deze figuur te bekijken.


Figuur 3: representatieve resultaten van de co-transformatie Experiment en 5-FOA scherm. Links: vertegenwoordiger SC-zijn bord bedekt met cellen onderworpen aan de co-transformatie procedure na een 3-daagse incubatie bij 30 ° C. Ongeveer 5000 kolonies werden geteld. Midden: vertegenwoordiger 5-FOA plaat na replica-plating van een SC-zijn co-transformatie plaat na een 2-daagse incubatie bij 30 ° C. Monsters 1 en 2 werden als kandidaten voor gegaan door een succesvolle integratie gebeurtenis door hun asymmetrische morfologieën. Dit komt omdat een echte vervanging van het URA3-gen met de hht2 allel waarschijnlijk voor (of zeer kort na) een getransformeerde cel wordt uitgeplaat op SC-zijn bord en, als gevolg daarvan, de kolonie die op die locatie zal ontstaan zal meestal, zo niet uitsluitend, 5-FOA-resistan bevattent cellen - wanneer een dergelijke kolonie dan vervolgens replica-geplateerd een 5-FOA plaat zal worden platgedrukt, hetgeen leidt tot een asymmetrische uitziende stuk cellen op de plaat. Omgekeerd, spontane mutaties in de URA3 gen die kunnen ontstaan tijdens kolonievorming vaker beperkt binnen een klein gebied van een kolonie, en derhalve eerder tot papillen geven bij replica-uitgeplaat een 5-FOA plaat. Rechts: een andere vertegenwoordiger 5-FOA plaat na replica-plating van een SC-zijn co-transformatie plaat na een 3-daagse incubatie bij 30 ° C. Een extra kandidaat (monster 3) en twee kleine papillen zichtbaar op deze plaat (voorbeelden 4 en 5) - zoals papillen, die het duidelijkst zichtbaar na 3 of meer dagen incubatie zijn waarschijnlijk spontane URA3 mutaties en niet die de gewenste integratiegebeurtenis. Klik hier om te bekijkeneen grotere versie van deze figuur.

figuur 4
Figuur 4: Moleculaire analyses van de kandidaat-Integration monsters. (A) PCR succesvolle integratie gebeurtenissen te identificeren. Top: cartoon vertegenwoordiging van de PCR-reacties gebruikt om succesvolle integratie van de hht2 mutant allel in het genoom te beoordelen. Onder: gelelektroforese analyse van PCR-reacties met behulp van genomische DNA afgeleid van een HHT2 wildtype (gebruikt als controle, laan 2), stam yAAD156 herbergt de hht2Δ :: URA3 vervangen (gebruikt als controle, laan 3), een kandidaat integratie monster (laan 4), en een 5-FOA-resistente papillen monster (en derhalve waarschijnlijk geen correcte integratie gebeurtenis vertegenwoordigt, laan 5). DNA standaarden worden weergegeven in baan 1. Merk op dat de grootte van de PCR-producten voor de kandidaat integratie monster consistent met een succesvolle integratie gebeurtenis, terwijl de grootte van de PCR-producten van de papillen monster wordt bevestigd door een intacte hht2Δ :: URA3-locus. (B) EcoRI vertering de aanwezigheid van mutant allel bevestigen. Top: cartoonvertegenwoordiging van de verwachte digestie fragmenten verkregen uit een EcoRI digestie reactiemengsel van PCR-producten die hetzij de wildtype HHT2 gen of het mutante allel hht2. Onder: gelelektroforese analyse van digestie reacties van PCR-producten afgeleid van een wildtype HHT2 stam (laan 2, de PCR-producten die hier gebruikt zijn afgeleid van hetzelfde monster als gebruikt in laan 2 van paneel A) en een kandidaat integratie monster ( laan 3, de PCR-producten die hier gebruikt zijn afgeleid van hetzelfde monster als gebruikt in laan 4 van panel A). DNA standaarden worden weergegeven in baan 1. Merk op dat de digestiepatronen bevestigen dat de AG GA mutatie met succes is ingebracht in het genoom van de kandidaatintegratie monster. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De hoge sequentie homologie tussen de twee niet-allelische genen die coderen voor elk van de vier kern histon eiwitten in S. cerevisiae haploïde cellen een uitdaging voor onderzoekers die willen specifiek op een van de twee genen voor mutagenese kan vertegenwoordigen. Eerder beschreven gist mutagenese methoden, waaronder Delitto Perfetto, plaatsspecifieke genomische (SSG) mutagenese en kloneren vrij-PCR-allel vervangingsmethoden 5, 6, 7, en recentere gist-CRISPR gebaseerde technieken 15, vaak afhankelijk althans gedeeltelijk op sequenties binnen het ORF van een doelgen de recombinatie of reparatie machines rekruteren van de gewenste genomische plaats uiteindelijk genereren van de uiteindelijke mutante allel. Anderzijds, de strategie die we hier gepresenteerde maakt gebruik van DNA sequenties die de beoogde ORF naar homologo drijvenons recombinatiegebeurtenis nodig voor de integratie van de mutatie, en daardoor zorgt voor specifieke targeting van een gen op een andere ondanks de twee genen die sterk homologe ORFs. Deze eigenschap maakt onze strategie bijzonder geschikt voor histon mutagenese. Echter kan deze strategie worden aangepast voor mutagenese van andere genen in het genoom van gist.

Extra functies van onze strategie omvatten het feit dat de lengten van de gebieden die homologe recombinatie van de gemuteerde genen drijven kunnen worden ontworpen om zeer uitgebreid zijn, waardoor de efficiëntie van integratie toeneemt met de beoogde genomische locatie en dat naast de gewenste mutatie (s ) zonder extra DNA-sequenties worden ingebracht in het genoom. Een bijkomend voordeel hiervan is dat zodra een stam die vervanging van een specifieke histon gen met URA3 is geconstrueerd, kan het worden gebruikt voor het genereren van elke gewenste mutante versie van dat histeen gen. Aldus, bijvoorbeeld, stam yAAD156, dat beschikbaar is voor de onderzoeksgemeenschap op verzoek, kan worden gebruikt om een gewenste mutatie hht2 zonder de noodzaak van het construeren van een de novo hht2Δ :: URA3-allel. Tenslotte, met goed ontworpen PCR-primers Deze strategie kan ook worden gebruikt om histon allelen interne deleties of mutaties op verschillende codons genereren, zolang ze relatief dicht bij elkaar (bijvoorbeeld, hebben we een hht2 allel codeert voor een gegenereerd H3-K56R, L61W dubbele mutant eiwit met behulp van deze strategie).

Het vermogen om specifiek te richten op twee zeer homologe histone genen voor mutagenese kan nuttig zijn in een aantal verschillende experimentele settings. Bijvoorbeeld, omdat de HHT1 HHF1-genen tot expressie op verschillende niveaus ten opzichte van de HHT2-HHF2 genen 16 Het kan interessant zijn om te bepalen of een bepaald H3 of H4-mutatie different fenotypen afhankelijk van welk gen wordt tot expressie gebracht van. Een ander voorbeeld is een situatie waarin een onderzoeker wil haploïde cellen die een bepaalde histon mutant Beide overeenkomstige histon genen genereren - dit kan worden bereikt door eerst elk gen mutageniseren onafhankelijk in twee verschillende stammen, en het verkrijgen van dubbel gemuteerde haploïde cellen door een kruis en daaropvolgende isolatie van het gewenste meiotische producten. Nog een ander voorbeeld betreft mutagenese van histonen H2A en H2B: aangezien twee licht verschillende isovormen van elk eiwit wordt gecodeerd door het overeenkomstige niet-allelische set genen, kan een onderzoeker willen de effecten van een bepaalde H2A en H2B mutatie in beoordelen het kader van beide isovorm. Bij het ontwerpen van experimenten om de HTA1 en HTB1 loci mutageniseren (coderend voor H2A en H2B, respectievelijk), onderzoekers moeten zich bewust zijn van de recente bevindingen laten zien dat stammen die een (hta1-htb1) Δ zijn, zijn alleen levensvatbaar if dat ze de HTA2-HTB2 locus (en de nabijgelegen HHT1-HHF1 locus ook) door het genereren van een kleine cirkelvormige chromosoom 17 versterkt, aangezien dit de interpretatie van de resultaten kunnen bemoeilijken.

We hebben onlangs gebruikt een versie van deze histon mutagenesestrategie histon H3 eiwitten tot expressie alle mogelijke aminozuursubstituties op positie 61, die normaal wordt ingenomen door het aminozuur leucine 14 genereren. Voor die experimenten, in plaats van yAAD156 als uitgangsstam voor de mutagenese, gebruikten we yADP106 stam, die een vervanging van de HHT2 ORF zowel de URA3 en TRP1 voeding markers (in plaats van URA3) herbergt. De aanwezigheid van beide merkergenen vergemakkelijkt de identificatie van kandidaten voor integratie van de mutant PCR producten na de 5-FOA scherm zuiveringsstap (stap 5 en 6 van het protocol), als zodanig candidates werd fenotypisch Ura - en Trp -, terwijl spontane URA3 mutatie resulteerde in cellen met een Ura - Trp + fenotype. yADP106 is op aanvraag beschikbaar, zoals de sequentie van het URA3-cassette TRP1, dat kan worden geamplificeerd als een eenheid en wordt gebruikt voor mutagenese van andere histon genen toepassing van de hierin beschreven strategie.

Onvermogen om de gewenste histone mutanten met behulp van deze strategie worden toegeschreven aan een aantal mogelijke redenen, waaronder onvoldoende hoeveelheid grote PCR-producten voor de integratiestap of een onvoldoende aantal transformanten na de co-transformatie stap zou kunnen verkrijgen. De eerstgenoemde probleem kan worden aangepakt door bundelen grotere sets van PCR reacties of door het ontwerpen van verschillende primersets die een hogere opbrengst aan product te produceren, terwijl het laatste probleem kan worden opgelost door grotere hoeveelheden plasmide ruggengraat in de co-transformatie-experiment. although, zoals eerder aangegeven, kan deze procedure histone mutanten herbergen twee of meer aminozuursubstituties produceren, de beoogde aminozuren relatief dicht bij elkaar, aangezien de respectieve codons moeten worden binnen dezelfde primer molecule zijn. Aldus is deze strategie niet gemakkelijk worden aangepast voor het genereren van histonen met meerdere mutaties verte zich van elkaar over de lengte van de eiwitten.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
gerichte<em&gt; In Situ</em&gt; Mutagenese van histon genen in gist
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter