Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Gezielt doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die vier Kern Histonproteine ​​H2A, H2B, H3 und H4 spielen eine zentrale Rolle in der Verdichtung, die Organisation und Funktion von eukaryotischen Chromosomen. Zwei Sätze von jeder dieser Histone bilden die Histonoktamer, ein Molekular Spule, die die Verpackung von ~ 147 Basenpaaren der DNA um sich ergeb leitet schließlich in der Bildung einer Nukleosomen 1. Nukleosomen sind aktive Teilnehmer in einer Vielzahl von Chromosom-basierte Prozesse, wie zum Beispiel die Regulation der Gen-Transkription und die Bildung von Euchromatin und Heterochromatin über Chromosomen, und als solche im Mittelpunkt intensiver Forschung im Laufe der vergangenen Jahrzehnte. Eine Anzahl von Mechanismen wurden durch die Nukleosomen beschrieben kann in einer Weise manipuliert werden, die Ausführung bestimmter Prozesse erleichtern können - diese Mechanismen posttranslationaler Modifikation von Histon-Reste, ATP-abhängige Nukleosom-Remodeling und ATP-unabhängige Nukleosom Reorganisation umfassenund Montage / Demontage 2, 3.

Die Bäckerhefe Saccharomyces cerevisiae ist ein besonders leistungsfähiges Modellorganismus für das Verständnis der Histon - Funktion in Eukaryoten. Dies kann weitgehend auf dem hohen Grad der evolutionären Konservierung der Histon - Proteine in der gesamten Domäne Eukarya und amenability von Hefe von genetischen und biochemischen experimentelle Ansätze 4 auf eine Vielzahl zurückzuführen. Reverse genetische Ansätze in Hefe wurden weitgehend verwendet, um die Auswirkungen der spezifischen Histon-Mutationen zu verschiedenen Aspekten der Chromatin Biologie zu studieren. Für diese Arten von Experimenten ist es oft bevorzugt, Zellen zu verwenden, bei dem die mutanten Histone aus ihren nativen genomischen Loci exprimiert werden, als Ausdruck von autonomen Plasmide zu abnormal intrazellulären Spiegel von Histon-Proteinen (durch eine unterschiedliche Anzahl von Plasmiden in Zellen) führen kann, und gleichzeitige Veränderung der Chromatinstruktur engebungen, die letztlich die Interpretation der Ergebnisse durcheinander bringen kann.

Hier beschreiben wir eine PCR-basierte Technik, die zur gezielten Mutagenese von Histon-Gene in ihrer nativen genomischen Stellen ermöglicht, die keine Klonierungsschritt und führt zur Erzeugung der gewünschten Mutation (en) ohne Überbleibsel exogenen DNA-Sequenzen in das Genom erfordert. Diese Technik nutzt die effiziente homologe Rekombinationssystem in Hefe und gemeinsam hat mehrere Funktionen mit anderen ähnlichen Techniken , die von anderen Gruppen entwickelt - insbesondere der Delitto Perfetto, ortsspezifischen genomischen (SSG) Mutagenese und Klonierung freien PCR-basierte Allel Ersatzmethoden 5, 6, 7. Jedoch hat die Technik, die wir beschreiben, einen Aspekt, dass es besonders gut geeignet für die Mutagenese von Histon-Gene macht. In haploiden Hefezellen, ist jeder der vier Core-Histone durch zwei nicht-a codiertllelic und hoch homologe Gene: zum Beispiel wird Histon H3 durch die HHT1 und HHT2 Gene kodiert, und die offenen Leserahmen (ORFs) der beiden Gene sind mehr als 90% in - Sequenz identisch. Dieser hohe Grad an Homologie kann Experimente komplizieren spezifisch eine der beiden für die Mutagenese Histon-kodierenden Gene entworfen abzuzielen. Während oft die oben genannten Verfahren die Verwendung von mindestens einigen Sequenzen innerhalb des ORF des Zielgens erfordern homologe Rekombination zu treiben, beschreiben die Technik, die wir hier macht die Verwendung von Sequenzen, die die ORFs der Histon-Gene flankieren (die viel weniger Sequenzhomologie teilen) für die Rekombinationsschritt, Steigerung somit die Wahrscheinlichkeit einer erfolgreichen Ausrichtung der Mutagenese an den gewünschten Ort. Darüber hinaus sind die homologen Regionen, die Rekombination fahren kann sehr umfangreich sein, weiter zu einer effizienten gezielte homologe Rekombination beiträgt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HINWEIS: Die experimentelle Strategie für die gezielte in - situ - Histon - Gen - Mutagenese umfasst mehrere Schritte (zusammengefasst in Figur 1). Diese Schritte umfassen: (1) Ersatz des Ziel Histon - Gens mit dem URA3 - Gen, (2) Erzeugung und Reinigung von PCR - Produkten auf zwei teilweise überlappenden Fragmenten des Ziel - Histon - Gens entspricht , unter Verwendung von Primern die gewünschte Mutation beherbergt (s), (3 ) Fusion PCR der beiden teilweise überlappende Fragmente PCR in voller Größe Produkte für die Integration zu erhalten, (4) Co-Transformation in voller Größe PCR-Produkte und Backbone-Plasmid und Selektion für Marker auf dem Plasmid, (5) Bildschirm für die 5-FOA-resistente Transformanten, (6) Reinigung von 5-FOA-resistenten Kolonien und Verlust des Rückgrats Plasmids, und (7) Molekularanalysen Assay für die richtige Integration des mutierten Allels.

Abbildung 1
in situ Mutagenese von Histon - Gene Gezielte. In diesem Beispiel ist das Zielgen HHT2, aber jede andere Kern Histon - Gens können auch unter Verwendung dieser Strategie mutagenisiert werden. (A) Haploid Hefezellen zwei Histon H3-kodierenden Gene beherbergen (HHT1 und HHT2) und zwei Histon - H4-kodierenden Gene (HHF1 und HHF2) angeordnet sind, wie in der Figur gezeigt ist (die HHT1 und HHF1 Gene auf Chromosom II und dem HHT2 und HHF2 Gene auf dem Chromosom XIV befindet - in jedem Fall sind die Pfeile zeigen in Richtung der Transkription). Im ersten Schritt des Verfahrens wird das ORF des HHT2 Gens mit dem URA3 - Gen ersetzt, was zu einer hht2Δ :: URA3 - Stamm. (B) In Teil 1, ein Wildtyp - Kopie des HHT2 - Gens aus einer genomischen DNA - Probe als Matrize für zwei PCR - Reaktionen zu Gattungen verwendette, die zwei teilweise überlappenden Fragmente des Gens. Der Reverse-Primer für die erste Reaktion umfasst eine oder mehrere fehlgepaarte Nukleotide (mit einem roten Kreis angedeutet), die der gewünschten Mutation (en) entsprechen, in das Genom eingeführt werden. Der Vorwärtsprimer für die zweite Reaktion hat den äquivalenten Mismatch in einer umgekehrten komplementären Konfiguration (auch mit einem roten Kreis gekennzeichnet). Die beiden PCR - Produkte erzeugt , in Teil 1 (Produkte A und B) werden dann als Matrizen für die Fusions - PCR unter Verwendung von zwei Primern , die Ausheilung zu den Produkten A und B in der Art und Weise teil 2. Daraus ergibt sich die Erzeugung von Vollgröße PCR gezeigt ist, verwendet Produkte (Produkt C in Teil 3) beherbergt , das die gewünschte Mutation (en). (C) Die hht2Δ :: URA3 Stamm ist dann co-transformiert mit dem Full-Size - PCR - Produkte und ein Backbone - Plasmid (a HIS3- Plasmid in diesem Beispiel markiert), und die Zellen werden auf das Vorhandensein des Plasmids (auf Medien selektiert fehlt histidine in diesem Beispiel). Transformanten werden dann für 5-FOA - Resistenz gescreent - resistenten Zellen sind Kandidaten für ein homologes Rekombinationsereignis zur Integration des PCR - Produkts und Exzision des URA3 - Gens führt laufen hat, wie gezeigt. Die anschließende Verlust des Rückgrats Plasmid durch mitotische Zellteilung führt zur letzten Histon Mutantenstamm gewünscht. Wir haben gezeigt, dass die Auswahl des Rückgrats Plasmid gefolgt gefunden durch Screenen auf 5-FOA - Resistenz führt zu einer viel höheren Frequenz der Identifizierung der richtigen Integrationsereignisse im Vergleich zur direkten Selektion auf 5-FOA - Platten, die meist identifiziert Zellen , die spontan URA3 Mutationen erworben haben. (Diese Zahl wurde von Referenz 14 modifiziert). Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

1. Ersatz des Ziel Histon - Gens mit dem URA3Gen

  1. Führen Sie Standard - PCR-vermittelte Ein-Schritt - Gen - Unterbrechung des ORF von Ziel Histon - Gens mit dem URA3 - Gen 8, 9 zu ersetzen.
    HINWEIS: Die Verwendung von Hefezellen , die ura3Δ0 Durchführung wird empfohlen, da diese Mutation das gesamte endogene URA3 ORF entfernt, wodurch die Integration des PCR - Produkts in den URA3 - Locus 8 vermieden wird . Alternativ kann das K. lactis - URA3 - Gen effektiv zur Erzeugung des Histon - Ersatz in jedem ura3 Hintergrund verwendet werden , wie es in S. cerevisiae funktionell ist , sondern nur eine teilweise Sequenzhomologie mit der S. cerevisiae - URA3 - Gen. Der Stamm sollte auch auxotroph sein, mindestens eine Verbindung, die zur Auswahl des Rückgrats Plasmids in dem Transformationsexperiment erlaubt (Schritt 4 dieses Protokolls). Dieser Schritt ist nicht erforderlich , wenn ein Ziel Histon geneΔ :: URA3Stamm ist bereits verfügbar.

2. Erzeugung und Reinigung von PCR-Produkten entsprechend zwei teilweise überlappend Fragmente des Ziel Histone Gene Primers Beherbergen die gewünschte Mutation (en) aufnehmen

  1. Erzeugen PCR - Produkte zu zwei teilweise überlappenden Fragmenten des Ziel - Histon - Gens entspricht.
    1. Bereiten Sie zwei PCR-Reaktionen wie folgt:
      1. PCR - Produkte zu erzeugen , um die erste Hälfte des Gens (Produkt eine in 1B), eingerichtet , um die folgende Reaktion: 1 entspricht ul Templat - DNA, 5 μl10 uM Vorwärtsprimer, 5 μl10 uM Reverse - Primer, 0,5 ul (1,25 U) thermo DNA - Polymerase, 10 & mgr; l 5x - DNA - Polymerase - Puffer, 5 & mgr; l dNTP - Gemisch (jeweils 2 mM) und 23,5 & mgr; l dH 2 O.
        HINWEIS: Die Template-DNA kann aus einem Wildtyp-Stamm für das Ziel-Histon-Gen abgeleitete genomische DNA isoliert Standard Pro mitverfahren 10. Zur Berücksichtigung Variationen in DNA - Konzentration und Menge an Verunreinigungen in unterschiedlichen genomischen Präparationen, wird empfohlen , um die Reaktionen zu optimieren , indem entweder unverdünnt DNA oder verschiedene Verdünnungen der genomischen Omen (beispielsweise 1:10 und 1: 100). Der Vorwärts-Primer anlagern sollte auf einen Bereich stromaufwärts des Zielgens. Der Reverse - Primer sollte innerhalb des ORF anlagern, werden ~ 40 Nukleotide lang und enthalten die gewünschte Mutation (n) irgendwo in der Mitte (siehe Abbildung 1B-1 und Repräsentative Ergebnisse Abschnitt für Beispiele). Die Verwendung einer High Fidelity DNA Polymerase wird empfohlen, um die Raten von unerwünschten Mutationen während der Synthese der PCR-Produkte zu reduzieren.
      2. Zur Erzeugung einzurichten PCR - Produkte entsprechend der zweiten Hälfte des Gens (Produkt b in Abbildung 1B), eine Reaktion wie in 2.1.1.1 , jedoch mit unterschiedlichen Primer angegeben.
        HINWEIS: Die vordere primer sollte innerhalb des ORF tempern, sein ~ 40 Nukleotide lang und enthalten die gewünschte Mutation (en) irgendwo in der Mitte. Man beachte, dass die Mutation (en) in diesem Primer das reverse Komplement der Mutation (en) in der Rückwärtsprimer in Schritt 2.1.1.1. Der reverse Primer des Zielgens stromabwärts (siehe 1B-1 und Repräsentative Ergebnisse Abschnitt Beispiele) zu einem Bereich anlagern soll.
    2. Legen Sie die Reaktionen in einem Thermocycler mit den folgenden Einstellungen: 94 ˚C 30 Sekunden; 30 Zyklen der folgenden Einstellungen: 98 C 10 sec, 60 ° C 5 s, 72 ° C 1,5 min; und 72 ° C 10 min.
      Hinweis: Optimierung der PCR-Parameter können für spezifische Primersätze und Ziel Histon-Gens erforderlich.
  2. Laufen 20-50 & mgr; l des Materials aus den PCR-Reaktionen auf einem 0,9% niedrigschmelzenden Agarosegel in 89 mM Tris-Base, 89 mM Borsäure, 2,5 mM EDTA (TBE) -Puffer.
  3. Schneiden Sie Agarosegel Abschnitte des PCR-pr enthältoducts aus Gel mit einem sauberen Skalpell oder einer Rasierklinge und übertragen die jeweils mit einem 1,5 ml Mikrozentrifugenröhrchen mit. Bewahren Sie Agarose Abschnitte mit PCR-Produkte bei -20 ° C bis zur Verwendung.

3. Fusion PCR der zwei teilweise überschneidende Fragmente zu erhalten Full Size PCR Produkte für die Integration

  1. Bereiten Matrize für die PCR - Reaktionen
    1. Melt Agarose-Gel-Abschnitte aus Schritt 2.3, indem die Reaktionsgefäße in einem Wärmeblocksatz bei 65 ° C für 5 Minuten (oder bis sie vollständig geschmolzen). Wirbelrohre alle 1 bis 2 min, den Schmelzvorgang zu erleichtern.
    2. Übertragen Sie eine festgelegte Menge des geschmolzenen Agarose aus jeder Probe (zB 50 & mgr; l jeweils für eine Gesamtmenge von 100 ul) in einem einzigen Reaktionsgefäß und mischen durch Vortexen. Verwenden Sie diese als Vorlage in den Fusions-PCR-Reaktionen. Das Röhrchen wird bei -20 ° C bis zur Verwendung.
  2. Amplify eine große Menge an in voller Größe PCR - Produkt (Produkt cin 1B)
    1. Set up sechs PCR-Reaktionen, die jeweils mit den folgenden Komponenten: 2 & mgr; l Matrizen-DNA, 10 ul 10 uM Vorwärtsprimer, 10 & mgr; l 10 & mgr; M Rückwärts-Primer, 1 & mgr; l (2,5 U) thermostabile DNA-Polymerase, 20 ul 5x DNA-Polymerasepuffer, 10 ul dNTP - Gemisch (jeweils 2 mM) und 47 & mgr; l dH 2 O.
      HINWEIS: Die Anzahl der Reaktionen können in Abhängigkeit von der PCR-Effizienz verändert werden. Die Templat-DNA (siehe 3.1.2) sollte auf 65 C erhitzt werden, bis durch Vortexen geschmolzen, gemischt und schließlich zu dem PCR-Reaktionsgemisch zugesetzt. Nach dem Hinzufügen mischen vorsichtig, aber gründlich, indem die Lösung Auf- und Abpipettieren mehrmals. Zur Berücksichtigung Variationen in DNA - Konzentration in den verschiedenen Proben, wird empfohlen, zuerst die Reaktionen zu optimieren , indem entweder unverdünnt Vorlage oder unterschiedlichen Verdünnungen der Matrize (zB 1:10 und 1: 100). Die zwei Primer verwendet werden, sollten teilweise überlappenden Fragmente des Zielgens als schlecht an die beiden anlagernustrated in 1B-2 und so gestaltet sein , dass die endgültigen PCR - Produkte mindestens 40 Basenpaare auf beiden Seiten homolog zu den Regionen haben den URA3 ORF flankieren, die die homologe Rekombination Schritt zu fahren (siehe Abschnitt Repräsentative Ergebnisse für Beispiele). Die Verwendung einer High Fidelity DNA Polymerase wird empfohlen, um die Raten von unerwünschten Mutationen während der Synthese der PCR-Produkte zu reduzieren.
    2. Die Röhrchen in einem Thermocycler mit den folgenden Einstellungen: 94 ˚C 30 Sekunden; 30 Zyklen der folgenden Einstellungen: 98 C 10 sec, 50 ° C 15 Sekunden, 72 ° C 1,5 min; und 72 ° C 10 min.
      HINWEIS: Optimierung der PCR-Parameter können für spezifische Primer-Sets und Ziel Histon-Gens erforderlich.

4. Co-Transformation von Full Size PCR Produkte und Backbone Plasmid und Selektion für Marker auf dem Plasmid

  1. Konzentration von PCR - Produkten
    1. Pool, die six PCR-Reaktionen (600 ul insgesamt) aus Schritt 3.2.2 in einem einzigen Reaktionsgefäß und mischen durch Vortexen.
    2. Teilen Sie die Probe in drei 200 ul Aliquots in Mikrozentrifugenröhrchen. Auszufällen die DNA in jedem Röhrchen durch Zugabe von 20 ul 3 M Natriumacetat (pH 5,2) und 550 ul 100% Ethanol. Mischen Sie die Lösung gründlich und auf Eis für mindestens 15 min. Sammeln DNA durch Zentrifugation bei ~ 14.000 g für 10 min, spülen Sie das Pellet mit 200 ul 70% Ethanol und Luft trocknen lassen.
    3. Resuspendieren jedes DNA - Pellet in 25 & mgr; l dH 2 O, und Pool in einem einzigen Rohr (für insgesamt 75 & mgr; l).
  2. Hefe - Co-Transformation
    1. Bereiten Sie 10 ml über Nacht Kultur des in Abschnitt erzeugte Stamm 1 in Hefeextrakt Pepton Dextrose (YPD) flüssiges Medium 11.
    2. Am nächsten Morgen impfen 400 ml YPD-Flüssigmedium mit 8 ml der gesättigten über Nacht Kultur und Inkubation durch Schüttelnbei 30 ° C für 4 - 5 h Zellen zu ermöglichen logarithmischen Wachstumsphase einzutreten.
    3. Sammle die Zellen durch Zentrifugation bei ~ 3.220 xg für 10 min, Verwerfen des flüssigen Mediums und Resuspendieren der Zellen in 1 Volumen 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 M Lithium-Acetat-Lösung (TE / LiAc) .
    4. Sammeln Sie die Zellen durch Zentrifugation bei ~ 3.220 × g für 10 min, und entsorgen Sie die TE / LiAc.
    5. Resuspendieren der Zellen in 1 ml TE / LiAc.
    6. Legen Sie die folgende Reaktion Cocktail in ein Mikrozentrifugenröhrchen bis 800 & mgr; l von Zellen aus Schritt 4.2.5, 40 ul gekocht 10 mg / ml Lachssperma-DNA, insgesamt 12,5 ug Rückgrat Plasmid-DNA und 75 & mgr; l konzentrierter PCR-Produkt aus Schritt 4.1.3.
      HINWEIS: Lachssperma-DNA sollte für 5 min und auf Eis für mindestens 5 min vor der Verwendung in der Reaktion abgekocht werden. Gesamtvolumen des DNA-Rückgrats Plasmid zugegeben wird, sollte auf ein Minimum (~ 80 & mgr; l oder weniger) gehalten werden. Siehe Repräsentative Ergebnisse Abschnitt für ein Beispiel eines Backbones plasmIch würde.
    7. Mischen Sie die Cocktail-Rohr gründlich und aliquoten gleichmäßig in acht Mikrozentrifugenröhrchen (Röhrchen 1 bis 8).
    8. Legen Sie die folgenden zwei Steuer Transformation Reaktionsröhrchen nach oben:
      1. Rohr 9 (kein PCR-Produkt Kontrolle): 100 & mgr; l von Zellen aus Schritt 4.2.5, 5 ul gekocht 10 mg / ml Lachssperma-DNA (für 5 min gekocht, siehe Schritt 4.2.6 Hinweis), insgesamt 1,56 ug Backbone Plasmid-DNA und kein PCR-Produkt zugegeben.
      2. Rohr 10 (kein DNA-Kontrolle): 100 & mgr; l der Zellen aus Schritt 4.2.5, 5 & mgr; l gekochter 10 mg / ml Lachssperma-DNA (siehe Schritt 4.2.6 Note), keine Backbone-Plasmid-DNA gegeben, und kein PCR-Produkt zugegeben.
      3. Das Vermischen der beiden Röhren vorsichtig, aber gründlich durch Auf- und Abpipettieren mehrmals.
    9. Inkubieren Sie die zehn Röhrchen bei 30 ° C für 30 min.
    10. Zu jedem Röhrchen, mit 1,2 ml 40% Polyethylenglycol (PEG 3350) in TE / LiAc. Mischen Sie gründlich mit einem P-1000 pipettieren, bis die Lösung homogen ist.
    11. Inkubieren Sie die zehn Röhrchen bei 30° C für 30 min. durch Pipettieren von oben und unten und dann Röhrchen bei 42 ° C für 15 min vorsichtig die Lösung mischen.
    12. Sammle die Zellen durch die Röhrchen in einer Mikrozentrifuge bei ~ 14.000 xg für 30 sec dreht. Entsorgen Sie die Flüssigkeit und Resuspendieren der Zellen in 1 ml sterilem dH 2 O.
    13. Sammle die Zellen durch die Röhrchen in einer Mikrozentrifuge bei ~ 14.000 xg für 30 sec dreht. Entsorgen Sie die Flüssigkeit und Resuspendieren der Zellen in 500 ul sterilem dH 2 O.
    14. Pool Röhren 1 bis 8 zusammen (Gesamtvolumen von 4 ml) und gründlich durch Auf- und Abpipettieren mischen.
    15. Platte 200 ul des obigen Gemisches auf jeder der zwanzig vollständige minimal dropout Mediumplatten 11 (Platten 1-20) zur Auswahl des Rückgrats Plasmids.
    16. Platte 200 ul des Gemisches aus Rohr 9 und 200 & mgr; l der Mischung aus Rohr 10, die jeweils auf einer eigenen Selektionsplatte (Platten 21 bzw. 22).
    17. Inkubieren Sie die 22 Platten bei 30 ° C für 3 - 5 Tage zuWählen Sie für Plasmid-Trans.
    18. Inspizieren Transformationsplatten nach 3 bis 5 Tagen Inkubation. Rund 5.000 Kolonien sollten auf Platten 1-21 (siehe Repräsentative Ergebnisse für ein Beispiel) sichtbar sein und keine Kolonien sollten auf der Platte 22 vorhanden sein.

5. Bildschirm für die 5-FOA-resistente Trans

  1. Übertragungszellen von den Platten 1 bis 20 (und Transformationsplatte 21 als Kontrolle) zu 5-Fluororotsäure (5-FOA) Platten 11 durch Replika-Plattierung 12 um für den Verlust des URA3 - Gens als Ergebnis der Integration der zu screenen PCR-Produkte an der gewünschten Stelle.
    1. Entfernen Sie die Platte Deckel und drücken Sie die Platte Kolonien auf einem sterilen Samt enthält. Übertragen Sie die Zellen aus dem Samt zu einem 5-FOA Platte durch die Platte auf dem Samt drücken. Die Platten bei 30 ° C für 2 Tage.
  2. Im Anschluss an die 2-tägige Inkubation kontrollieren sorgfältig die 5-FOA-Platten für growth.
    HINWEIS: Ein Kandidat Integrationsereignis wird von einem kleinen asymmetrischen "gestaucht" Kolonie auf einer 5-FOA Platte dargestellt werden - umgekehrt, kleine Papillen wachsen auf 5-FOA - Platten sind wahrscheinlich repräsentativ für spontane URA3 Mutationen , die auf die während des Wachstums der Kolonien entstanden Transformationsplatten und sind daher unwahrscheinlich , dass die gewünschte Integrationsereignis darzustellen (Abbildung 3 im Repräsentative Ergebnisse Abschnitt für weitere Ausführungen zu diesem Punkt und für einige Beispiele zu sehen).

6. Reinigung von 5-FOA-resistente Kolonien und Verlust der Backbone Plasmid

  1. Mit einer sterilen Zahnstochern, wählen Sie die Kandidaten Kolonien aus den 5-FOA-Platten in Schritt 5.2 beschrieben und Streifen für einzelne Kolonien auf YPD-Platten. Inkubieren für 2 - 3 Tage bei 30 ° C.
  2. Im Anschluss an die Inkubation Replik - Platte jede YPD Reinigung Platte auf eine frische YPD Platte, eine Drop-out - Platte ohne Uracil für den Verlust zu überprüfendes URA3 - Gens und eine zweite Drop-Out - Platte für die Anwesenheit oder Abwesenheit des Rückgrats Plasmids zu überwachen. Inkubieren für 1 bis 2 Tage bei 30 ° C.
  3. Nach der Inkubation eine Kolonie von jeder Kandidatenprobe zu identifizieren , die auf dem YPD Platte wächst , aber nicht wächst auf beiden Dropout-Platte ( eine solche Kolonie wird erwartet, haben das URA3 - Gen durch das Rekombinationsereignis verloren und verlor das Rückgrat Plasmids während der mitotischen Zellteilung). Restreak solche Kolonien auf frische YPD-Platten. Diese Kolonien sind die Integration Kandidaten und wird weiter in 7 Schritt analysiert werden.

7. Molekulare Analysen zur Assay für die ordnungsgemäße Integration des mutierten Allels

  1. Isolieren genomischer DNA aus den Kandidaten Proben unter Verwendung von Standardverfahren 10.
  2. Amplify genomischen Region der Zielstelle umfasst.
    1. Richten Sie die folgende PCR-Reaktion für jede Probe: 0,5 ul Templat-DNA, 5 ul10 & mgr; M Vorwärts - Primer, 5 & mgr; l 10 & mgr; M Rückwärts - Primer, 0,5 & mgr; l (2,5 Einheiten) Taq DNA - Polymerase, 5 ul 10x Taq - DNA - Polymerase - Puffer, 5 & mgr; l dNTP - Gemisch (jeweils 2 mM) und 29 & mgr; l dH 2 O.
      HINWEIS: Template-DNA ist die genomische DNA aus den Kandidatenproben abgeleitet. Es wird empfohlen , auch Reaktionen umfassen zwei Kontrolle: eine genomische DNA aus den ursprünglichen Histon geneΔ abgeleitet unter Verwendung :: URA3 - Stamm als Matrize und eine andere unter Verwendung von genomischer DNA aus einem Wildtyp - Histon - Stamm als Vorlage. Zur Berücksichtigung Variationen in DNA - Konzentration und Menge an Verunreinigungen in unterschiedlichen genomischen Präparationen, wird empfohlen , um die Reaktionen zu optimieren , indem entweder unverdünnt DNA oder verschiedene Verdünnungen der genomischen Omen (beispielsweise 1:10 und 1: 100). Es ist darauf zu achten , dass diese Primer an DNA - Sequenzen außerhalb der Region durch die mutmaßlich integrierte PCR - Produkt umfasste - diese Weise die Größe der PCR - Produkte in diesen rTELLUNGNAHMEN kann als diagnostisches Werkzeug für die Integration der Produkte in der richtigen genomischen Stelle (siehe Repräsentative Ergebnisse für ein Beispiel) verwendet werden.
    2. Legen Sie die Reaktionen in einem Thermocycler mit den folgenden Einstellungen: 94 ° C 3 min; 30 Zyklen mit den folgenden Einstellungen: 94 ° C 45 sec, 50 ° C 45 sec, 72 ° C 2 min; und 72 ° C 10 min.
      HINWEIS: Optimierung der PCR-Parameter können für spezifische Primer-Sets und Ziel Histon-Gens erforderlich.
  3. Verarbeitung von PCR - Produkten
    1. Laufen 20 ul von jeder Reaktion auf einem 0,8% TBE-Agarosegel.
    2. Beurteilung der Größe der PCR - Produkte unter Verwendung von DNA - Standards als Referenz zu bestimmen , ob das URA3 - Gen von der mutmaßlich mutierten Histon - Gen erfolgreich ersetzt wurde (siehe Repräsentative Ergebnisse für ein Beispiel).
      HINWEIS: In bestimmten Fällen kann die gewünschte Mutation (en) eingeführt in die Histon-Gene entweder erstellen oder eine Beschränkung zerstören sitzene. Wenn dies der Fall ist, kann die Anwesenheit der gewünschten Mutation in den PCR-Produkten der Größe anzeigt korrekte Integration, indem die Produkte der Verdauung mit dem entsprechenden Restriktionsenzym durch Gelelektrophorese-Analyse (siehe Repräsentative Ergebnisse für ein Beispiel), gefolgt beurteilen .
    3. Gegenstand PCR-Produkte der Größe anzeigt korrekte Integration der DNA-Sequenzierung die Gegenwart der gewünschten Mutation (en) zu bestätigen und sicherzustellen, dass keine zusätzlichen Mutationen in das Genom eingeführt worden ist.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wir beschreiben die Erzeugung eines hht2 Allel ein Histon H3 mutiertes Protein beherbergt eine Substitution an Position 53 von Arginin zu einem einer Glutaminsäure (H3-R53E - Mutante) als repräsentatives Beispiel für die gezielte in - situ - Mutagenese - Strategie exprimieren.

Wir erzielten einen Stamm , in dem das gesamte ORF von HHT2 durch das URA3 - Gen ersetzt (Schritt 1 des Protokolls). Dieser Stamm, yAAD156 birgt auch ein his3Δ200 Allel, die die Zellen veranlaßt auxotroph für Histidin sein. Im Anschluss an die in Schritt angegebenen Verfahren 2 des Protokolls erzielten wir dann die beiden teilweise überlappende Fragmente von HHT2. Forward Primer (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' und der Reverse Primer (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3' Die folgenden Primer wurden für das erste Fragment verwendet. Die folgende prForward Primer (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' und der Reverse-Primer (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3' IMers wurden für das zweite Fragment verwendet. Beachten Sie, dass der Reverse-Primer in der ersten Reaktion und der Forward-Primer in der zweiten Reaktion enthalten die Nukleotide gewünschte mutierte (in Kleinbuchstaben) - diese mutierten Nukleotide zwischen zwei langen Strecken von Wildtyp-Sequenzen eingebettet sind, wie dies für eine effiziente Glühen erlaubt des Primers an die Template-DNA trotz der Fehlanpassung an den mutierten Positionen. Beachten Sie auch, dass die mutierten Nukleotide in diesen beiden Primer sind revers komplementär zueinander und eine AG zu GA Mutation im Sense-Strang verursachen, was in einem AGA Codon resultiert Änderung GAA, die letztlich die R53E Mutation in dem codierten Protein produziert. Ergebnisse aus diesen PCR - Reaktionen sind in 2A gezeigt.

Unter Verwendung des Verfahrens in Schritt 3, wir dann gener die Full-Size-PCR-Produkte ATED. Die verwendeten Primer waren Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'und Reverse Primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Wenn dieser Primer entwerfen, ist es wichtig, sicherzustellen, dass die resultierenden Fusions-PCR-Produkte mindestens 40 Basenpaare umfassen entweder endet Reaktion die homologe Rekombination zu fahren (die die Regionen der Homologie länger, desto effizienter und spezifischer die homologe Rekombination wird Sein). In unserem Experiment die Full-Size - PCR - Produkte enthielten ein 195 Basenpaar - Region und 220 Basenpaar - Region homolog zu den Regionen vor und hinter dem HHT2 ORF sind. Eine Probe dieser PCR - Produkte wurden durch Agarose - Gelelektrophorese (2B) analysiert.

Die Full-Size - PCR - Produkte wurden dann zusammen mit Plasmid pRS413 co-transformiert (ein zentromerischen, markiert HIS3- Plasmidf "> 13) und Transformanten wurden auf Platten ohne Histidin (SC-his - Platten) ausgewählt , wie in Schritt 4 des Protokolls beschrieben. His + Kolonien wurden dann auf Widerstand 5-FOA gescreent nach den in Schritt 5 beschriebenen Verfahren des Protokolls. Abbildung 3 zeigt ein Beispiel einer Transformationsplatte (SC-sein) und 5-FOA - Platten folgende Replik-Plattierung von SC-seine Platten. Beispiele für Kandidatenproben sowie Proben unwahrscheinlich , dass die gewünschte Integrationsveranstaltungen zu repräsentieren , werden auch in Abbildung 3 in unserem Experiment., wir zwölf Kandidatenproben von ~ 90.000 Transformanten gescreent identifiziert. wurden gereinigt Diese Kandidaten dann wie in Schritt 6 des Protokolls beschrieben.

Die zwölf Kandidaten wurden dann 7 des Protokolls in Schritt beschrieben zur PCR - Analyse unterzogen , um zu bewerten , ob sie authentisch Ersatz des URA3 - Gens mit mutierten PCR - Produkte wider. Für unsere experiment, verwendeten wir einen Forward Primer, die 89 Basenpaare stromaufwärts von der Integrationsstelle des PCR-Produkts und eines Reverse Primer annealt, die 302 Basenpaare stromabwärts der Integrationsstelle des PCR-Produkts anlagert. Diese Primer erzeugen PCR - Produkte von 1217 Basenpaaren in der Größe , wenn die HHT2 Locus durch HHT2 belegt ist (oder mutierte Versionen von HHT2 beherbergen Substitutionen Basenpaar) oder PCR - Produkte von 2188 Basenpaaren in Größe , wenn der Ort durch den URA3 - Marker - Gen besetzt ist . Die Sequenz des Forward Primer verwendet (OAD476) ist: 5 'GAAACTATTGGCACGCCCTA und der der Reverse Primer verwendet (OAD477) ist: 5' CCTGCGAATCAACCGATACT 3 '. Von den zwölf Kandidaten , die wir identifiziert hatten, zeigten vier Integration eines PCR - Produkts an der richtigen Stelle (4A für ein Beispiel siehe). Schließlich, da die AG GA Mutation eine neue Eco RI - Restriktionsstelle erzeugt, wir PCR - Produkte von einem der erfolgreichen Integration Proben eine unterworfen 4B). In diesem Fall wir die PCR - Produkte nicht - Sequenz , die zusätzliche unerwünschte Mutationen worden war , um sicherzustellen , nicht in das Genom eingebaut: Jedoch haben wir ein Verfahren sehr ähnlich wie diese verwendet , um eine große Anzahl von HHT2 Mutationen in einer letzten Studie zu erzeugen 14, und festgestellt, dass die Mehrheit der integrierten mutierten Allele keine Mutationen andere als die gewünschten Einsen tragen.

Figur 2
Abbildung 2: Generierung von PCR - Produkten Beherbergung gewünschten Mutationen für die Integration in das Genom der Hefe. (A) PCR - Reaktion , die teilweise überlappenden Fragmente HHT2 beherbergen die gewünschten Mutationen zu erzeugen. Top: Cartoon Darstellung von ter zwei PCR - Reaktionen , die beiden HHT2 Fragmente zu erhalten (siehe Abbildung 1B-1). Rote Kreise stellen die mismatched Nukleotide an den Primer verwendet, um die AG zu GA-Mutation im Sense-Strang des Gens einzuführen. Unten: Gelelektrophorese Analyse der PCR - Produkte a und b (Bahnen 2 bzw. 3). DNA - Standards sind in Spur 1 (B) Fusion PCR - Reaktion gezeigt , für die Integration in Hefegenom voller Größe PCR - Produkt zu erzeugen (siehe 1B-2 gezeigt und 3). Top: Cartoon Darstellung der PCR - Reaktion und erwartete PCR - Produkt (Produkt c). Rote Kreise stellen gewünschte Mutation wie in (A) oben beschrieben. Unten: Gel - Elektrophorese - Analyse von PCR - Produkten c (Bahn 2). DNA - Standards sind in Spur 1 gezeigt Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.


Abbildung 3: Repräsentative Ergebnisse aus der Co-Transformation Experiment und 5-FOA - Bildschirm. Links: Vertreter SC-seine Platte plattiert mit zur Co-Transformation unterzogen Zellen nach einem 3-tägigen Inkubation bei 30 ° C. Rund 5.000 Kolonien wurden gezählt. Mitte: Vertreter 5-FOA Platte folgende Replik-Überzug aus einem SC-sein Co-Transformationsplatte nach einer 2-tägigen Inkubation bei 30 ° C. Die Proben 1 und 2 wurden durch eine erfolgreiche Integration Veranstaltung gegangen Kandidaten betrachtet aufgrund ihrer asymmetrischen Morphologien haben. Dies ist , weil eine wahr Ersatz des URA3 - Gens mit dem hht2 Allel ist wahrscheinlich , bevor das Auftreten (oder kurz danach) eine transformierte Zelle auf der SC-his Platte und als Folge beschichtet ist, die Kolonie , die an dieser Stelle entstehen enthalten zumeist, wenn nicht ausschließlich, 5-FOA-resistanT-Zellen - wenn eine solche Kolonie ist dann anschließend replica-plattiert auf eine 5-FOA Platte wird es zerquetscht werden, Aufstieg zu geben zu einem asymmetrischen aussehenden Flecken der Zellen auf der Platte. Im Gegensatz dazu, spontan Mutationen im URA3 - Gen , das während der Koloniebildung sind eher zu beschränken innerhalb einer kleinen Region einer Kolonie und damit eher zu verursachen Papillen wenn replica-plattiert auf eine 5-FOA Platte entstehen können. Rechts: ein anderer Vertreter 5-FOA Platte folgende Replik-Überzug aus einem SC-sein Co-Transformationsplatte nach einem 3-tägigen Inkubation bei 30 ° C. Eine zusätzliche Kandidaten (Probe 3) sowie zwei kleine Papillen sind auf dieser Platte (Proben 4 und 5) - solche Papillen, die am deutlichsten sichtbar sind , nach 3 oder mehr Tagen Inkubation wahrscheinlich spontane URA3 Mutationen darstellen und nicht die gewünschte Integrationsereignis. Bitte klicken Sie hier , umeine größere Version dieser Figur.

Abbildung 4
Abbildung 4: Molekulare Analysen der Kandidaten Integration Proben. (A) PCR - Test erfolgreiche Integration Ereignisse zu identifizieren. Top: Cartoon - Darstellungen der PCR - Reaktionen verwendet , um eine erfolgreiche Integration des hht2 Allelmutante in das Genom zu bewerten. Unten: Gelelektrophorese Analyse von PCR - Reaktionen unter Verwendung von genomischer DNA aus einem HHT2 abgeleiteten Wildtyp-Stamm (als Kontrolle verwendet, Spur 2), Stamm yAAD156 beherbergt das hht2Δ :: URA3 Ersatz (als Kontrolle verwendet, Spur 3), ein Kandidat Integration Probe (Bahn 4) und eine 5-FOA-resistente Papillen Probe (und somit unwahrscheinlich, dass eine korrekte Integration Ereignis darzustellen, Spur 5). DNA-Standards sind in Spur 1. Hinweis gezeigt, dass die Größen der PCR-Produkte für den Kandidaten Integration Probe consiste sindnt mit einer erfolgreichen Integrationsereignis, während die Größe der PCR - Produkte für die Papillen Probe ist in Übereinstimmung mit einem intakten hht2Δ :: URA3 - Locus. (B) EcoRI Verdauung Vorhandensein von mutierten Allels zu bestätigen. Top: Cartoon Darstellung der erwarteten Verdauung Fragmente , abgeleitet von einem EcoRI - Verdauungsreaktion von PCR - Produkten entweder die Wildtyp - HHT2 Gen oder das mutierte hht2 Allel enthält. Unten: Gelelektrophorese Analyse der Verdauung Reaktionen von PCR - Produkten , die von einem Wildtyp HHT2 Stamm (Spur 2, die PCR - Produkte , die hier verwendet wurden aus der gleichen Probe wie in Spur 2 von Feld A verwendet abgeleitet) und ein Kandidat Integration Probe ( Spur 3, die PCR Produkte, die hier verwendet wurden aus derselben Probe abgeleitet wie die in Spur 4 von Panel A) verwendet. DNA-Standards sind in Spur 1. Hinweis gezeigt, dass die Verdauung Muster bestätigen, dass die AG GA Mutation in das Genom des Kandidaten erfolgreich eingeführt wurde,Integration Probe. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die hohe Sequenzhomologie zwischen den zwei nicht allele Gene , die für jeden der vier Kern Histon - Proteine in haploiden S. cerevisiae - Zellen eine Herausforderung für die Forscher darstellen können , die wünschen speziell für die Mutagenese eines der beiden Gene abzuzielen. Zuvor Hefe Mutagenese Methodologien beschrieben, einschließlich der Delitto Perfetto, ortsspezifischen genomischen (SSG) Mutagenese und Klonierung freien PCR-basierten Allelaustausch Methoden 5, 6, 7, sowie neuere Hefe CRISPR-basierte Techniken 15, häufig angewiesen zumindest teilweise auf Sequenzen innerhalb des ORF eines Zielgens die Rekombination oder Reparatur Maschinen zur gewünschten genomischen Ort schließlich erzeugen das endgültige mutiertes Allel zu rekrutieren. Auf der anderen Seite ist die Strategie, die wir hier vorgestellt haben macht von DNA Sequenzen, die die gezielte ORF flankieren die homologo fahrenus Rekombinationsereignis für die Integration der Mutation erforderlich, und als Ergebnis ermöglicht eine spezifische Targeting eines Gens gegenüber einer anderen, trotz der beiden Gene in hohem Maße homolog ORFs aufweist. Diese Eigenschaft macht unsere Strategie besonders gut geeignet für Histon-Mutagenese. Jedoch kann diese Strategie auch für die Mutagenese anderer Gene in das Hefegenom angepasst werden.

Zusätzliche Merkmale unserer Strategie umfassen die Tatsachen, daß die Längen der Bereiche, die homologe Rekombination der mutierten Gene Antrieb kann so gestaltet werden sehr umfangreich zu sein, wodurch die Effizienz der Integration an der Ziel genomischen Ort erhöht und dass neben der gewünschten Mutation (en ) keine zusätzlichen DNA-Sequenzen in das Genom eingebracht. Ein weiterer Vorteil dieses Systems ist , dass , sobald eine Belastung eines spezifischen Histon - Gen URA3 mit beherberge Ersatz konstruiert worden ist , kann es für die Erzeugung jeder gewünschten mutanten Version dieser bestimmten hist verwendet werdenein Gen. So kann zum Beispiel der Stamm yAAD156, die der Forschungsgemeinschaft auf Anfrage erhältlich ist , kann verwendet werden , um jede gewünschte hht2 Mutation zu machen , ohne die Notwendigkeit des Aufbaus einer De - novo - hht2Δ :: URA3 Allel. Schließlich wird durch richtig entworfen PCR unter Verwendung von Primern, kann diese Strategie auch verwendet werden , Histon - Allele mit internen Deletionen zu erzeugen , oder mit Mutationen an mehreren Codons, solange sie relativ nahe zueinander sind (beispielsweise haben wir ein hht2 Allel codierend eine generierte H3-K56R, L61W doppelt mutierte Protein mit dieser Strategie).

Die Fähigkeit, spezifisch eine von zwei hoch homolog Histon-Gene für die Mutagenese gezielt konnte in einer Reihe von verschiedenen experimentellen Bedingungen nützlich sein. Da beispielsweise die HHT1-HHF1 Gene auf verschiedenen Ebenen im Vergleich zu den HHT2-HHF2 Gene 16 ausgedrückt werden, könnte es von Interesse sein , zu bestimmen , ob eine bestimmte H3 oder H4 Mutation di verleihtfferent Phänotypen in Abhängigkeit von dem Gen aus exprimiert wird. Ein weiteres Beispiel ist ein Szenario, in dem ein Ermittler haploiden Zellen zu erzeugen wünscht eine bestimmte Histon-Mutante von beiden entsprechenden Histon-Genen, die - dies zuerst erreicht werden konnte jedes Gen unabhängig voneinander in zwei verschiedenen Stämmen Mutagenisierung, und dann Doppelmutante haploiden Zellen durch ein Kreuz zu erhalten und anschließender Isolierung der gewünschten meiotic Produkte. Noch ein weiteres Beispiel einer Mutagenese von Histonen H2A und H2B bezieht: Angesichts der Tatsache, daß zwei geringfügig unterschiedliche Isoformen von jedem Protein, das von dem entsprechenden nicht-allelischen Gen Satz codiert werden, kann ein Forscher möchte die Auswirkungen einer bestimmten H2A oder H2B Mutation zu beurteilen, der Kontext jeder Isoform. Bei Experimenten Gestaltung der HTA1 und HTB1 Loci zu mutieren (kodieren H2A und H2B, beziehungsweise), sollten die Ermittler der jüngsten Erkenntnisse bewusst sein , die zeigen , dass Stämme ein (hta1-htb1) trägt Δ rentabel sind nur if sie amplifiziert 17 den HTA2-HTB2 locus (und in der Nähe HHT1-HHF1 Locus als auch) durch die Erzeugung einer kleinen kreisförmigen Chromosom, da dies die Interpretation der Ergebnisse erschweren könnte.

Wir haben kürzlich eine Version dieser Histon - Mutagenese - Strategie zu erzeugen Histon H3 Proteine exprimieren alle möglichen Aminosäuresubstitutionen in Position 61, die in der Regel besetzt durch die Aminosäure Leucin 14 verwendet. Für jene Versuche, statt yAAD156 als Ausgangsstamm für die Mutagenese verwendet, verwendeten wir Stamm yADP106, die einen Austausch des HHT2 ORF birgt sowohl mit dem URA3 und TRP1 Ernährungsmarker (statt nur URA3). Die Anwesenheit der beiden Markergenen erleichtert die Identifizierung von Kandidaten für die Integration der mutanten PCR-Produkte nach der 5-FOA-Bildschirm und Reinigungsschritt (Schritte 5 und 6 des Protokolls), die als solche candidates wurde phänotypisch Ura - und Trp -, während spontane URA3 - Mutation in Zellen mit einem Ura resultierte - Trp + -Phänotyp. yADP106 ist auch auf Anfrage, wie die Sequenz des URA3-TRP1 - Kassette, die als eine Einheit amplifiziert werden konnten und für die Mutagenese anderer Histon - Gene verwendet , um die Strategie , die hier beschrieben ist .

Unfähigkeit, die gewünschten Mutanten Histon diese Strategie zu erhalten unter Verwendung einer Reihe möglicher Gründe zurückzuführen sein könnten, einschließlich der nicht ausreichenden Menge von in voller Größe PCR-Produkte für die Integrationsstufe oder einer unzureichenden Anzahl von Transformanten nach der Co-Transformationsschritt verwendet. Das erstere Problem könnte durch Bündelung größere Sätze von PCR-Reaktionen oder durch die Entwicklung unterschiedlicher Primersätze adressiert werden, die eine höhere Ausbeute an Produkt zu produzieren, während das letztgenannte Problem durch Verwendung von höheren Mengen an Plasmid-Rückgrat in der Co-Transformationsexperiment gelöst werden könnte. Although, wie bereits angedeutet, kann man dieses Verfahren verwenden, um Histon-Mutanten beherbergen zwei oder mehr Aminosäuresubstitutionen, die gezielte Aminosäuren erzeugen relativ nahe, da die jeweiligen Codons zueinander sein müssen, innerhalb des gleichen Primermoleküls befinden. Somit kann diese Strategie nicht ohne weiteres für die Erzeugung von Histonen mit mehreren Mutationen weitläufig über die Länge der Proteine ​​voneinander angeordnet angepasst werden.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Gezielt<em&gt; In Situ</em&gt; Mutagenese von Histon-Gene in Bäckerhefe
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter