Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

ממוקד doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ארבעת החלבונים היסטון הליבה H2A, H2B, H3, ו- H4 ממלאים תפקידים מרכזיים הדחיסה, ארגון ותפקוד של כרומוזומים איקריוטיים. שני סטים של כל אחד היסטונים אלה יוצרים את octamer היסטון, סליל מולקולרי שמנתב את העטיפה של זוגות בסיסים ~ 147 של DNA סביב עצמו, בסופו של דבר וכתוצאה מכך ההיווצרות של הנוקלאוזום 1. נוקלאוזום הם משתתפים פעילים במגוון תהליכים מבוסס כרומוזום, כגון הסדרת שעתוק גנים לבין ההיווצרות של euchromatin ו heterochromatin פני הכרומוזומים, וככזה הוא העיקר של מחקר אינטנסיבי במהלך העשורים האחרונים. מספר המנגנונים תואר שבאמצעותו נוקלאוזום ניתן להשפיע בדרכים שיכולים להקל על ביצוע של תהליכים ספציפיים - מנגנונים אלה כוללים שינוי posttranslational של שאריות היסטון, שיפוץ הנוקלאוזום תלוי ATP, וארגון מחדש הנוקלאוזום ATP-עצמאיוהרכבה / פירוק 2, 3.

השמרים ניצני שמר האפייה הוא אורגניזם מודל חזק במיוחד להבנת תפקוד היסטון אאוקריוטים. זו ניתן לייחס במידה רבה את הרמה הגבוהה של שימור אבולוציוני של חלבונים היסטון ברחבי eukarya תחום רמת המוכנות של שמרים למגוון ניסיוני גנטיים ביוכימיים מתקרב 4. גישות Reverse-גנטיות בשמרים היו בשימוש נרחב כדי לחקור את ההשפעות של מוטציות ספציפיות היסטון על היבטים שונים של ביולוגיה הכרומטין. עבור אלו סוגים של ניסויים הוא לעתים קרובות עדיף להשתמש בתאים בם ההיסטונים המוטציה באים לידי ביטוי מן הלוקוסים הגנומי מולדתם, כמו ביטוי מן פלסמידים אוטונומיים יכול להוביל לרמות תאיים החריגות של חלבונים היסטון (עקב מספרים שונים של פלסמידים בתאים) ו שינוי מקביל של הכרומטין environments, אשר בסופו של דבר יכול לבלבל את הפרשנות של תוצאות.

כאן אנו מתארים טכניקה PCR מבוססת המאפשרת mutagenesis הממוקד של גני היסטון במקומות גנומי מולדתם שאינו דורשים צעד שיבוט ותוצאות בדור של המוטציה הרצויה (ים) ללא רצפי DNA אקסוגני שאריות בגנום. טכניקה זו מנצלת את המערכה ההומולוגית היעילה שמרים ויש לו כמה תכונות משותפות עם בטכניקות דומות אחרות שפותחו על ידי קבוצות אחרות - בעיקר Delitto Perfetto, אתר ספציפי גנומי (SSG) mutagenesis, שיבוט ללא אלל מבוסס PCR שיטות החלפה 5, 6, 7. עם זאת, הטכניקה נתאר יש היבט זה עושה את זה במיוחד מתאים היטב mutagenesis של גני היסטון. בתאי שמרים הפלואידים, כל אחד ההיסטונים הליבה ארבעה מקודד על ידי שתי שאינוגני llelic ו הומולוגיים מאוד: למשל, H3 היסטון מקודדים על ידי גני HHT1 ו HHT2, ואת מסגרות הקריאה הפתוחות (ORFs) משני הגנים הן מעל 90% זהות ברצף. רמה גבוהה זו של הומולוגיה יכולה לסבך ניסויים שנועדו למקד ספציפי אחד הגנים שני קידוד-היסטון עבור mutagenesis. בעוד השיטות הנ"ל לעתים קרובות דורשים שימוש לפחות כמה רצפים בתוך ORF של גן המטרה לנהוג הומולוגיים, הטכניקה שאנו מתארים כאן עושה שימוש רצפים איגוף ORFs של גנים היסטון (אשר חולקים הרבה פחות הומולוגיה ברצף) עבור צעד רקומבינציה, ובכך להגדיל את הסבירות של מיקוד המוצלח של mutagenesis אל המוקד הרצוי. יתר על כן, באזורים ההומולוגיים שמניעים רקומבינציה יכולים להיות מאוד נרחבים, ובכך תורמים עוד יותר הומולוגי ממוקדים ויעיל.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הערה: האסטרטגיה ניסיוני ממוקד mutagenesis גנים היסטון באתרו כוללת מספר שלבים (שהעיקריים בהם פורטו איור 1). צעדים אלה כוללים: (1) החלפת גן היסטון היעד עם גן URA3, (2) דור וטיהור של מוצרי ה- PCR המתאימים שני שברים חופף חלקי של גני היסטון היעד באמצעות פריימרים מחסה את המוטציה הרצויה (ים), (3 PCR Fusion) של שני שברים חופף חלקית להשיג מוצרי PCR בגודל מלאים עבור אינטגרציה, (4) Co-טרנספורמציה של מוצרי ה- PCR בגודל מלא פלסמיד עמוד שדרה, ובחירה עבור סמן על פלסמיד, (5) מסך עבור 5-פואה עמיד transformants, (6) טיהור של 5-פואה עמיד מושבות ואובדן פלסמיד עמוד השדרה, ו (7) מולקולרי מנתח assay לשילוב נכון של אלל מוטנטי.

איור 1
ממוקד mutagenesis באתרו של גני היסטון שמרים ניצנים. בדוגמא זו הגן הממוקד הוא HHT2, אבל כל גן היסטון ליבה אחר יכול גם להיות mutagenized באמצעות אסטרטגיה זו. (א) בתאי שמרים הפלואידים הנמל שני גנים היסטון קידוד H3 (HHT1 ו HHT2) ושני גנים H4 קידוד היסטון (HHF1 ו HHF2) מסודרים כפי שמוצג באיור (הגנים HHT1 ו HHF1 ממוקמים על כרומוזום השנייה ואת HHT2 גני HHF2 ממוקמים על XIV כרומוזום - בכל מקרה, החצים מצביעים לכיוון של שעתוק). בשלב הראשון של ההליך, ORF של גן HHT2 מוחלף גן URA3, והוליד זן hht2Δ :: URA3. (ב) חלק 1, עותק wild-type של הגן HHT2 ממדגם הדנ"א הגנומי משמש כתבנית עבור שתי תגובות PCR לסוגיםte שני שברים חופפים חלקית של הגן. פריימר הפוכה התגובה הראשונה כוללת נוקלאוטידים אחד או יותר תואם (מסומנים בעיגול אדום) התואמים את המוטציה הרצויה (ים) יוכנס הגנום. פריימר קדימה עבור התגובה השנייה קיים אי ההתאמה המקבילה בתצורת משלימים הפוכה (מסומנת גם עם עיגול אדום). שני מוצרי PCR שנוצרו חלק 1 מוצרים ב) משמשים כתבניות היתוך PCR באמצעות שני פריימרים כי לחשל למוצרי A ו- B ב האופנה מוצגת חלק 2. התוצאה היא הדור בגודל מלא PCR מוצרים מוצר חלקי 3) מחסה את המוטציה הרצויה (ים). (ג) hht2Δ :: זן URA3 אז שיתוף טרנספורמציה עם מוצרי ה- PCR בגודל מלא פלסמיד עמוד שדרה (א HIS3- מסומן פלסמיד בדוגמא זו), ותאים נבחרים עבור הנוכחות של פלסמיד (על התקשורת החסרה histidine בדוגמה זו). Transformants אז מוקרן על 5-פואה התנגדות - תאים עמידים הם מועמדים שעבר אירוע רקומבינציה הומולוגי המוביל אינטגרציה של מוצר ה- PCR כריתה של גן URA3, כפי שמוצג. הפסד בתקופות עוקבות של הפלסמיד עמוד השדרה על ידי חלוקת התא mitotic מוביל בזן העכברים המוטנטים היסטון הרצוי הסופי. מצאנו כי בחירה של פלסמיד עמוד השדרה ואחריו הקרנה עבור תוצאות התנגדות 5-פואה בתדירות גבוהה הרבה יותר של זיהוי של אירועי אינטגרציה נכונים לעומת בחירה ישירה על צלחות של 5 פואה, אשר רובם מזהה תאים רכשו מוטציות URA3 ספונטניות. (נתון זה כבר שונה מהתייחסות 14). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

1. החלפת ג'ין היסטון היעד עם URA3גֵן

  1. בצע סטנדרטי בתיווך PCR שיבוש גנטי צעד אחד החלפת ORF של גן היסטון יעד עם גן URA3 8, 9.
    הערה: שימוש בתאי שמרים נושאים את ura3Δ0 מומלץ כמו מוטציה זו מסירה את URA3 אנדוגני כולו ORF, וכך למנוע שילוב של מוצר ה- PCR לתוך מוקד URA3 8. לחלופין, הגן ק lactis URA3 ניתן להשתמש ביעילות עבור הדור של החלפת היסטון בכל רקע URA3 כפי שהוא פונקציונלי cerevisiae ס אבל יש הומולוגיה ברצף חלקית בלבד עם הגן URA3 cerevisiae ס. הזן צריך להיות גם auxotrophic לפחות תרכובת כזו אשר תאפשר לבחירה של פלסמיד עמוד השדרה בניסוי טרנספורמציה (ראה שלב 4 של פרוטוקול זה). שלב זה אינו הכרחי אם geneΔ היסטון היעד :: URA3זן הוא כבר זמין.

הדור וטיהור 2. של PCR מוצרים המתאימים שני שברים חופפים חלקית של יעד היסטון ג'ין באמצעות פריימרים מחסה את המוטציה הרצויה (ים)

  1. צור מוצרי PCR המתאימים שני שברים חופף חלקי של גני היסטון היעד.
    1. הכן שתי תגובות PCR כדלקמן:
      1. כדי ליצור מוצרים PCR המתאים במחצית הראשונה של הגן (מוצר באיור 1B), להגדיר את התגובה הבאה: 1 תבנית ה- DNA μl, 5 μl10 מיקרומטר פריימר קדימה, 5 μl10 מיקרומטר פריימר הפוכה, 0.5 μl (1.25 U) thermostable DNA פולימרז, 10 μl חיץ פולימראז 5x DNA, 5 μl תערובת dNTP (2 מ"מ כל אחד), ו 23.5 μl dH 2 O.
        הערה: תבנית ה- DNA יכול להיות הדנ"א הגנומי נגזר wild-type זן עבור גן היסטון היעד מבודד באמצעות פרו רגילפרוצדורות 10. כדי להסביר וריאציות בריכוז DNA ורמת זיהומים בהכנות גנומי שונים, מומלץ לייעל את התגובות או באמצעות DNA חי או דילולים שונים של ההכנות גנומי (למשל, 1:10 ו 1: 100). פריימר קדימה צריך לחשל לאזור במעלה הזרם של גן המטרה. פריימר ההפוכה צריכה לחשל בתוך ORF, להיות ~ 40 נוקלאוטידים אורך, ומכילה את המוטציה הרצויה (ים) אי שם באמצע של זה (ראה סעיף איור 1 ב- 1 ונציג תוצאות עבור דוגמאות). שימוש DNA פולימרז איכות גבוהה מומלץ על מנת להפחית את השיעורים של מוטציות לא רצויות במהלך הסינתזה של מוצרי ה- PCR.
      2. כדי ליצור מוצרי PCR מתאימים במחצית השנייה של הגן מוצר באיור 1B), להקים תגובה כמצוין 2.1.1.1 אבל עם פריימרים שונים.
        הערה: פרי קדימהmer צריך לחשל בתוך ORF, להיות ~ 40 נוקלאוטידים אורך, ומכיל את המוטציה הרצויה (ים) אי שם באמצע של זה. ראוי לציין, כי מוטציה (ים) פריימר זה הוא המשלים השני של מוטציה (ים) של פריימר הפוכה בשלב 2.1.1.1. פריימר ההפוכה צריכה לחשל לאזור במורד זרם של גן המטרה (ראה איור 1 ב- 1 ו נציג תוצאות סעיף לדוגמות).
    2. מניחים את התגובות ב thermocycler עם ההגדרות הבאות: 94 ג 30 שניות; 30 מחזורים של ההגדרות הבאות: 98 ג '10 שניות, 60 ג 5 שניות, 72 1.5 C דקות; ו -72 ג '10 דק'.
      הערה: אופטימיזציה של פרמטרי PCR עשויה להידרש סטים פריימר ספציפיים ולכוון גני היסטון.
  2. הפעל 20 - 50 μl של החומר על פי התגובות PCR על ג'ל agarose נקודת התכה נמוכה 0.9% ב -89 בסיס מ"מ טריס, 89 מ"מ חומצת בור, 2.5 mM EDTA חיץ (TBE).
  3. חותכים סעיפים agarose ג'ל המכיל את pr PCRoducts מן ג'ל באמצעות סכין אזמל או גילוח נקי ולהעביר כל צינור 1.5 מ"ל microcentrifuge. אחסן סעיפי agarose המכילים מוצרי ה- PCR ב -20 C עד מוכן לשימוש.

3. Fusion PCR של שברי חופפים שני חלקית להשיג בגודל מלא מוצרים PCR עבור אינטגרציה

  1. הכן תבנית עבור PCR תגובות
    1. ממיסים סעיפים ג'ל agarose משלב 2.3 על ידי הנחת צינורות microcentrifuge ב סט גוש חום 65 צלזיוס למשך 5 דקות (או עד שהיא נמסה לחלוטין). צינורות וורטקס כל 1 - 2 דקות כדי להקל על תהליך ההיתוך.
    2. העבר סכום קבוע של נמס agarose מכל מדגם (למשל, 50 μl כל, עבור סכום כולל של 100 μl) לתוך צינור microcentrifuge יחיד ומערבבים ידי vortexing. השתמש באפשרות זו כתבנית בתגובות PCR ההיתוך. מניחים את הצינור ב -20 C עד מוכן לשימוש.
  2. להגביר כמות גדולה של מוצר ה- PCR בגודל מלא המוצרבאיור 1B)
    1. הגדרת שישה התגובות PCR, כל עם הרכיבים הבאים: תבנית ה- DNA 2 μl, 10 μl 10 מיקרומטר פריימר קדימה, 10 μl 10 מיקרומטר פריימר הפוכה, 1 μl (2.5 U) DNA פולימרז thermostable, 20 μl חיץ פולימראז 5x DNA, 10 μl תערובת dNTP (2 מ"מ כל אחד), ו -47 μl dH 2 O.
      הערה: מספר תגובות ניתן לשנות בהתאם את יעילות PCR. ה- DNA התבנית (ראה 3.1.2) צריך להיות מחומם ל -65 C עד שהיא נמסה, מעורבב ידי vortexing, והוסיף אחרון לתערובת תגובת PCR. לאחר ההוספה, ומערבבים בעדינות אך ביסודיות על ידי pipetting הפתרון מעלה ומטה מספר פעמים. כדי להסביר וריאציות בריכוז DNA בדגימות השונות, מומלץ ראשון לייעל את התגובות או באמצעות תבנית חייה או דילולים שונים של התבנית (למשל, 1:10 ו 1: 100). שני פריימרים המשמשים צריך לחשל את שני שברי חופפים חלקית של גן המטרה כחולהustrated באיור 1 ב- 2 ו להיות מתוכנן כך מוצרי PCR הסופיים יהיו לפחות 40 זוגות בסיסים משני הומולוגי צד לאזורי איגוף ORF URA3 אשר יניעו את הצעד ההומולוגי (ראה סעיף נציג תוצאות לדוגמות). שימוש DNA פולימרז איכות גבוהה מומלץ על מנת להפחית את השיעורים של מוטציות לא רצויות במהלך הסינתזה של מוצרי ה- PCR.
    2. מניחים את צינורות thermocycler עם ההגדרות הבאות: 94 ג 30 שניות; 30 מחזורים של ההגדרות הבאות: 98 ג '10 שניות, 50 ג 15 שניות, 72 1.5 C דקות; ו -72 ג '10 דק'.
      הערה: אופטימיזציה של פרמטרי PCR עשויה להידרש סטים פריימר ספציפיים היסטון יעד גן.

4. Co-טרנספורמציה של גודל מלא מוצרים PCR ו עמוד השדרה פלסמיד, בחירה עבור מרקר על פלסמיד

  1. ריכוז של מוצרי ה- PCR
    1. פינת ה- Six PCR תגובות (600 סך μl) משלב 3.2.2 לתוך צינור יחיד microcentrifuge ומערבבים ידי vortexing.
    2. פיצול המדגם לשלוש 200 aliquots μl צינורות microcentrifuge. להאיץ את ה- DNA בצינור אחד על ידי הוספת 20 μl של נתרן אצטט 3M (pH 5.2) ו 550 μl של אתנול 100%. מערבבים את הפתרון ביסודיות ומניחים על קרח למשך לפחות 15 דקות. אסוף DNA על ידי צנטריפוגה ב ~ 14,000 XG במשך 10 דקות, לשטוף את הגלולה עם 200 μl של 70% אתנול, ו אוויר יבש.
    3. Resuspend כל גלולה DNA לתוך 25 μl של DH 2 O, ובריכת לתוך צינור אחד (עבור סכום כולל של 75 μl).
  2. שיתוף טרנספורמציה שמרים
    1. כן 10 מיליליטר של תרבות הלילה של המתח שנוצר בסעיף 1 ב תמצית שמרי Peptone דקסטרוז (YPD) נוזל 11 בינוני.
    2. למחרת בבוקר, לחסן 400 מ"ל של מדיום נוזלי YPD עם 8 מ"ל של תרבות לילה רווי דגירה ידי ניעורב 30 מעלות צלזיוס למשך 4 - 5 שעות על מנת לאפשר לתאים להיכנס בשלב לוגריתמים של צמיחה.
    3. אוספים את התאים על ידי צנטריפוגה ב ~ 3,220 XG במשך 10 דקות, לבטל את במדיום נוזלי, ו resuspend התאים 1 נפח של 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.1 M פתרון Acetate ליתיום (TE / LiAc) .
    4. אוספים את התאים על ידי צנטריפוגה ב ~ 3,220 XG במשך 10 דקות, וזורקים את TE / LiAc.
    5. Resuspend התאים 1 מ"ל TE / LiAc.
    6. הגדר את קוקטייל התגובה הבאה בצינור microcentrifuge: 800 μl של תאים משלב 4.2.5, 40 μl של ה- DNA זרע 10 מ"ג מבושלים / מ"ל ​​סלמון, סך של 12.5 מיקרוגרם של ה- DNA פלסמיד עמוד השדרה, ו -75 μl של מוצר ה- PCR מרוכז משלב 4.1.3.
      הערה: DNA זרע סלמון צריך להיות מבושל במשך 5 דקות והניח על קרח דק לפחות 5 לפני השימוש התגובה. נפח כולל של פלסמיד דנ"א עמוד השדרה הוסיף צריכה להישמר עד למינימום (~ 80 μl או פחות). ראה סעיף נציג תוצאות עבור דוגמא plasm עמוד שדרהתְעוּדַת זֶהוּת.
    7. מערבבים את קוקטייל צינור ביסודיות aliquot שווה לשמונה צינורות microcentrifuge (צינורות 1 - 8).
    8. הגדר את צינורות תגובת טרנספורמציה השנייה מלא הבאים:
      1. Tube 9 (אין שליטה המוצר PCR): 100 μl של תאים משלב 4.2.5, 5 μl של ה- DNA זרע מבושלים 10 מ"ג / מ"ל ​​סלמון (מבושל במשך 5 דקות, ראה שלב 4.2.6 הערה), סך של 1.56 מיקרוגרם של פלסמיד דנ"א עמוד השדרה ולא מוצר PCR הוסיף.
      2. Tube 10 (אין שליטה DNA): 100 μl של תאים משלב 4.2.5, 5 μL של מבושלים 10 מ"ג / מ"ל ​​סלמון זרע DNA (ראה הערה צעד 4.2.6), לא פלסמיד עמוד השדרה DNA הוסיף, ולא מוצר PCR הוסיף.
      3. מערבבים את שני צינורות בעדינות אך ביסודיות על ידי pipetting מעלה ומטה מספר פעמים.
    9. דגירת עשרת הצינורות ב 30 צלזיוס למשך 30 דקות.
    10. כדי צינור אחד, להוסיף 1.2 מ"ל של פוליאתילן גליקול 40% (PEG 3350) ב TE / LiAc. מערבבים היטב באמצעות pipet P-1000 עד הפתרון הוא הומוגני.
    11. דגירת עשרת הצינורות ב 30° C למשך 30 דקות. לערבב בעדינות את הפתרון על ידי pipetting למעלה ולמטה ואז דגירה צינורות ב 42 מעלות צלזיוס למשך 15 דקות.
    12. אוספים את התאים על ידי ספינינג צינורות microcentrifuge בבית ~ 14,000 XG במשך 30 שניות. מחק את נוזלי resuspend התאים 1 מ"ל של סטרילי DH 2 O.
    13. אוספים את התאים על ידי ספינינג צינורות microcentrifuge בבית ~ 14,000 XG במשך 30 שניות. מחק את נוזלי resuspend התאים 500 μl של א '2 סטרילי DH
    14. בריכת צינורות 1 - 8 יחד (הנפח הכולל של 4 מ"ל) ומערבבים היטב על ידי pipetting למעלה ולמטה.
    15. פלייט 200 μl של התערובת שלעיל בכל עשרים צלחות בינוניות נשירה מינימאלית מלאות 11 (צלחות 1-20) לבחירה של פלסמיד עמוד השדרה.
    16. פלייט 200 μl של התערובת מתחנת הרכבת התחתית 9 ו -200 μl של תערובת מתחנת הרכבת התחתית 10 כל בצלחת מבחר משלה (צלחות 21 ו -22, בהתאמה).
    17. דגירה 22 צלחות על 30 מעלות צלזיוס במשך 3 - 5 ימיםלבחור עבור transformants פלסמיד.
    18. בדוק צלחות שינוי לאחר 3 - 5 ימי דגירה. כ -5,000 מושבות צריכות להיות גלויות על צלחות 1-21 (ראה נציג תוצאות עבור דוגמא) ולא מושבות צריכות להיות נוכחים על הצלחה 22.

מסך 5. עבור 5-פואה עמיד transformants

  1. העברת תאים מצלחות 1 - 20 (צלחת טרנספורמציה 21 כביקורת) עד 5-fluoroorotic חומצה (5-פואה) 11 צלחות על ידי העתק-ציפוי 12 כדי להקרין על אובדן של הגן URA3 כתוצאה אינטגרציה של מוצרי ה- PCR במקום הרצוי.
    1. מסירים את המכסה צלחת ולחץ על צלחת המכילה מושבות על קטיפה סטרילית. מעבירים את התאים מן קטיפה לצלחת 5-פואה ידי לחיצה על הצלחת על קטיפה. דגירה צלחות על 30 צלזיוס למשך 2 ימים.
  2. לאחר דגירה 2 ימים, בזהירות לבדוק את הצלחות של 5 פואה עבור גרowth.
    הערה: אירוע אינטגרצית המועמד יהיה מיוצג על ידי מושבה "פחוסה" אסימטרי קטנה על צלחת 5-פואה - ומנגד, גבשושיות קטנות גדלו על צלחות של 5 פואה המייצגים סבירים של מוטציות URA3 ספונטניות שהתעוררו במהלך הצמיחה של מושבות על צלחות שינוי, ועל כן הם לא סבירות כדי לייצג את אירוע אינטגרציה הרצוי (ראה איור 3 בקטע נציג התוצאות עבור פירוט נוסף על נקודה זו ובמשך כמה דוגמאות).

טיהור 6. 5-פואה עמיד המושבות והפסד של פלסמיד חוט שדרה

  1. באמצעות קיסמים סטרילי, לאסוף המושבות המועמדות מצלחות 5-פואה כמתוארות בשלב 5.2 פס עבור מושבות אחת על גבי צלחות YPD. דגירה של 2 - 3 ימים ב 30 מעלות צלזיוס.
  2. לאחר דגירה, העתק - צלחת כל צלחת טיהור YPD לצלחת YPD טרי, צלחת הנשירה חסר אורציל לבדוק הפסדשל גן URA3, וצלחת החוצה ושחרר שנייה כדי לפקח על קיומו או אי קיומו של פלסמיד עמוד השדרה. דגירה של 1 - 2 ימים ב 30 מעלות צלזיוס.
  3. לאחר דגירה, לזהות מושבה מכל מדגם מועמד אשר גדל על הצלחת YPD אבל לא גדל משני צלחת הנשירה (מושבה כזו צפויה איבדו את הגן URA3 דרך אירוע רקומבינציה ואיבד את הפלסמיד עמוד השדרה במהלך mitotic חלוקת תא). Restreak מושבות כאלה על צלחות YPD טריות. מושבות אלה הם המועמדים אינטגרציה ינותחו עוד בשלב 7.

7. ניתוח מולקולרי כדי Assay עבור שילוב הנכון של אלל מוטנטי

  1. לבודד הדנ"א הגנומי ממדגמים המועמד באמצעות נהלים סטנדרטיים 10.
  2. להגביר באזור גנומי המקיף לאתר היעד.
    1. הגדר את תגובת PCR הבא עבור כל דגימה: 0.5 תבנית ה- DNA μl, 5 μlפריימר 10 מיקרומטר קדימה, 5 μl 10 מיקרומטר פריימר הפוכה, 0.5 μl (2.5 יחידות) פולימראז תקי DNA, 5 μl 10x חיץ פולימראז תקי DNA, 5 μl תערובת dNTP (2 מ"מ כל אחד), ו -29 μl DH 2 O.
      הערה: תבנית ה- DNA הוא הדנ"א הגנומי נגזר דגימות מועמד. מומלץ לכלול גם שתי תגובות שליטה: אחד באמצעות הדנ"א הגנומי נגזר geneΔ היסטון המקורי :: זן URA3 כתבנית ועוד הדנ"א הגנומי באמצעות מן זן היסטון wild-type כתבנית. כדי להסביר וריאציות בריכוז DNA ורמת זיהומים בהכנות גנומי שונים, מומלץ לייעל את התגובות או באמצעות DNA חי או דילולים שונים של ההכנות גנומי (למשל, 1:10 ו 1: 100). חשוב לוודא כי לחשל פריימרים אלה כדי רצפי DNA מחוץ לאזור מוקפת המוצר PCR משולב putatively - זו הדרך, בגודל של מוצרי ה- PCR ב אלה Reactions יכול לשמש ככלי אבחוני אינטגרציה של המוצרים במיקום הגנומי הנכון (ראה נציג תוצאות עבור דוגמא).
    2. מניחים את התגובות ב thermocycler עם ההגדרות הבאות: 94 ° C 3 דקות; 30 מחזורים של ההגדרות הבאות: 94 ° C 45 שניות, 50 ° C 45 שניות, 72 ° C 2 דקות; ו -72 מעלות צלזיוס 10 דקות.
      הערה: אופטימיזציה של פרמטרי PCR עשויה להידרש סטים פריימר ספציפיים היסטון יעד גן.
  3. עיבוד של מוצרי ה- PCR
    1. הפעל 20 μl מכל תגובה על ג'ל agarose 0.8% TBE.
    2. להעריך את גודל מוצרי PCR באמצעות סטנדרטי DNA כהתייחסות לקבוע אם גן URA3 הוחלף בהצלחה על ידי גן היסטון מוטצית putatively (ראה נציג תוצאות עבור דוגמא).
      הערה: במקרים מסוימים, את המוטציה הרצויה (ים) מוחדרת גני היסטון ליצור או להרוס הגבלה לשבתדואר. אם זה מקרה, הנוכחות של המוטציה הרצויה מוצרי PCR של הגודל מעיד על אינטגרציה נכונה ניתן להעריך על ידי העמדת מוצרי עיכול עם אנזים ההגבלה המקביל ואחריו ניתוח ג'ל אלקטרופורזה (ראה נציג תוצאות עבור דוגמא) .
    3. מוצרי ה- PCR נושא הגודל מעיד על שילוב נכון רצפי DNA כדי לאשר את קיומו של המוטציה הרצויה (ים) ו, כדי לוודא ששום מוטציות נוספות הוכנסו לתוך הגנום.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

אנו מתארים את הדור של אלל hht2 לבטא חלבון מוטנטי H3 היסטון מחסה חילוף במיקום 53 מתוך ארגינין חומצת גלוטמית (H3-R53E מוטציה) בתור דוגמה מייצגת של ממוקדת באסטרטגיה mutagenesis באתרו.

יצרנו זן שבו ORF כולו של HHT2 מוחלף גן URA3 (ראה שלב 1 של הפרוטוקול). זן זה, yAAD156, גם אוצרים בתוכם אלל his3Δ200, אשר גורם לתאים להיות auxotrophic עבור היסטידין. בעקבות הליך המצוין בשלב 2 של פרוטוקול, אז ייצרנו שני שברים חופפים חלקית של HHT2. פריימרים הבאים שימשו שבר הראשון: פריימר קדימה (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' ואת פריימר הפוך (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. ה- PR הבאimers שמש שהבר השני: פריימר קדימה (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' ואת פריימר ההפוך (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. ראוי לציין, כי פריימר הפוך את התגובה הראשונה ואת פריימר קדימה התגובה השנייה להכיל את נוקלאוטידים מוטציה הרצוי (באותיות קטנות) - נוקלאוטידים מוטציה אלה השוכן בין שני פרקי זמן ארוכים של רצפים wild-type, כמו זו מאפשרת עבור חישול ביותר של פריימר אל תבנית ה- DNA למרות חוסר ההתאמה בעמדות המוטציה. כמו כן שימו לב כי נוקלאוטידים המוטציה בשני פריימרים הללו הם היפך משלים אחד את השני ולגרום AG מוטצית GA ב גדיל התחושה, שתוצאתה AGA כדי GAA שינוי קודון, אשר בסופו של דבר מייצר מוטצית R53E בחלבון המקודד. תוצאות PCR תגובות אלה מוצגות באיור 2A.

באמצעות ההליך בשלב 3, אז אנחנו גנר ated מוצרי PCR בגודל מלא. פריימרים השתמשו היו פריימר קדימה (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'לאחור תחל (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. בעת תכנון פריימרים אלה, חשוב לוודא כי מוצרי PCR היתוך וכתוצאה לכלול לפחות 40 זוגות בסיסים באחד משני קצותיו לנהוג תגובה ההומולוגית (ככל האזורים של הומולוגיה, יעילים יותר וספציפיים האירועים ההומולוגיים יהיו לִהיוֹת). בניסוי שלנו, את מוצרי PCR בגודל מלא הכילו אזור זוג 195 בסיס 220 הומולוגי בסיס זוג באזור לאזורים במעלה או במורד זרם של ORF HHT2, בהתאמה. מדגם של מוצרי ה- PCR אלה נותח על ידי ג'ל אלקטרופורזה agarose (איור 2 ב).

המוצרים PCR בגודל מלא היו אז במשותף טרנספורמציה יחד עם pRS413 פלסמיד centromeric, HIS3- מסומן פלסמידf "> 13) ו transformants נבחרו על צלחות חסרות היסטידין (SC-שלו צלחות) כמתואר בשלב 4 של הפרוטוקול. המושבות + שלו שודרו להתנגדות 5-פואה בעקבות ההליכים המתוארים בשלב 5 של הפרוטוקול. איור 3 הציג דוגמא של צלחת טרנספורמציה (SC-שלו) ו -5 פואה צלחות הבאות ציפוי העתק מן SC-שלו צלחות. דוגמאות דגימות מועמד כמו גם דגימות סבירות לייצג את אירועי אינטגרציה הרצויות מוצג גם באיור 3 . בניסוי שלנו, זיהינו עשר דגימות מועמד מתוך ~ 90,000 transformants הוקרן. מועמדים אלה היו מטוהרים אז כמתואר בשלב 6 של פרוטוקול.

שנים עשר מועמדים אז היו נתונים ניתוח PCR כמתואר בשלב 7 של הפרוטוקול להעריך אם הם שיקפו מחליפים אותנטי של הגן URA3 עם מוצרי ה- PCR מוטציה. לקבלת experimen שלנוt, השתמשנו פריימר קדימה כי anneals 89 זוגות בסיסים upstream מאתר שילוב של מוצר ה- PCR פריימר הפוכה כי anneals 302 זוגות בסיסים במורד הזרם מאתר אינטגרציה של המוצר PCR. פריימרים אלה מייצרים מוצרי ה- PCR של 1217 זוגות בסיסים בגודל אם הלוקוס HHT2 היא נכבשה על ידי HHT2 (או גרסאות מוטציה של HHT2 מחסה החלפות זוג בסיס), או מוצרים PCR של זוגות בסיסים 2188 בגודל אם הלוקוס היא נכבשה על ידי הגן סמן URA3 . הרצף של פריימר קדימה בשימוש (OAD476) הוא: 5 'GAAACTATTGGCACGCCCTA וכי של פריימר ההפוך משמש (OAD477) הוא: 5' CCTGCGAATCAACCGATACT 3 '. שנתי העשרה המועמדים אנו זיהינו, ארבעה הראו אינטגרציה של מוצר ה- PCR במיקום הנכון (ראה איור 4 א עבור דוגמא). לבסוף, מאז AG מוטצית GA מייצרת אתר הגבלה חדש Eco RI, חשפנו מוצרי PCR מאחד דגימות שילוב המוצלחות ל איור 4 ב). במקרה הספציפי הזה אנחנו לא שממפה את מוצרי ה- PCR על מנת להבטיח מוטציות לא רצויות נוספות שלא שולבו הגנום: עם זאת, השתמשנו הליך דומה מאוד זו כדי ליצור מספר רב של מוטציות HHT2 במחקר בעבר 14, ומצא כי הרוב המכריע של אללים מוטנטים המשולבים ולזכור שאין מוטציות אחרות מאלו הרצויים.

איור 2
איור 2: הדור של PCR מוצרים מחסה הרצוי מוטציות עבור אינטגרציה לתוך הגנום שמרים. (א) התגובה PCR על מנת ליצור את שברי חופפים חלקית של HHT2 מחסה מוטציות הרצוי. ייצוג קריקטורה של t: Top הוא שתי תגובות PCR כדי להשיג את שני שברי HHT2 (עיין באיור 1 ב- 1). עיגולים אדומים מייצגים את נוקלאוטידים תואמים על פריימרים להשתמש כדי להציג את המוטציה AG כדי GA ב גדיל תחושה של הגן. תחתונה: ניתוח ג'ל אלקטרופורזה של מוצרי ה- PCR ו- B (נתיבי 2 ו -3, בהתאמה). סטנדרטי DNA מוצגים שביל 1. (ב) תגובת ההיתוך PCR כדי ליצור מוצר PCR בגודל מלא להשתלבות הגנום שמרים (עיין באיור 1 ב- 2 ו -3). למעלה: ייצוג קריקטורה של תגובת PCR וצפוי מוצר ה- PCR המוצר). עיגולים אדומים מייצגים רצויים מוטציה כמתוארת ב (א) לעיל. התחתון: ניתוח ג'ל אלקטרופורזה של ג מוצרי ה- PCR (מסלול 2). סטנדרטי DNA מוצגים שביל 1. אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

יפ-together.within-page = "1"> איור 3
איור 3: תוצאות נציגת ניסוי Co-טרנספורמציה מסך 5-פואה. משמאל: נציג SC-שלו הצלחת מצופית עם תאים נתונים הליך שינוי השיתוף לאחר דגירת 3 ימים ב 30C. כ -5,000 מושבות נספרו. התיכון: צלחת נציג 5-פואה הבאים העתק-ציפוי מתוך SC-שלו צלחת שיתוף השינוי לאחר דגירה 2 ימים ב 30C. דוגמאות 1 ו -2 נחשבו מועמדים שעבר אירוע שילוב מוצלח בשל המורפולוגיות הסימטריות שלהם. הסיבה לכך היא תחליף אמיתי של גן URA3 עם האלל hht2 צפוי להתרחש לפני (או בקרוב מאוד אחרי) תא טרנספורמציה הוא מצופה על SC-שלו הצלחת, וכתוצאה מכך, המושבה שתתעורר במיקום זה יכיל בעיקר, אם לא אך ורק, 5-פואה-ההתנגדתאי T - כאשר מושבה כזה היא מייד לאחר מכן אתה העתק מצופה לצלחת 5-פואה זה יהיה מעוך, והוליד רטייה אסימטרית למראה של תאים על הצלחת. לעומת זאת, ספונטני מוטציות בגן URA3 שיכולות להתעורר במהלך היווצרות המושבה יש סיכוי גבוה יותר להיות כלוא בתוך אזור קטן של מושבה, ולכן יש יותר סיכוי להצמיח גבשושיות כאשר העתק מצופה לצלחת 5-פואה. מימין: צלחת שונה נציג 5-פואה הבא העתק-ציפוי מתוך SC-ושותף טרנספורמציה צלחת לאחר דגירה של 3 ימים ב 30 מעלות צלזיוס. מועמד נוסף (מדגם 3) וכן שתי גבשושיות קטנות גלויים על צלחת זו (דגימות 4 ו -5) - גבשושי כאלה, אשר גלויים באופן ברור ביותר לאחר 3 או יותר ימי דגירה, הם אמורים לייצג מוטציות URA3 ספונטניות ולא במקרה אינטגרציה הרצוי. אנא לחץ כאן לצפייהגרסה גדולה יותר של דמות זו.

איור 4
איור 4: ניתוח מולקולרי של דוגמאות אינטגרצית מועמד. (א) assay PCR לזהות אירועים שילוב מוצלח. למעלה: קריקטורת ייצוגים של תגובות PCR המשמשות להערכת שילוב מוצלח של אלל מוטנטי hht2 לתוך הגנום. תחתונה: ניתוח ג'ל אלקטרופורזה של PCR תגובות באמצעות הדנ"א הגנומי נגזר זן wild-type HHT2 (ששימשו כביקורת, מסלול 2), yAAD156 זן מחסה החלפת hht2Δ :: URA3 (ששימשו כביקורת, מסלול 3), מועמד אינטגרציה מדגמת (מסלול 4) ומוצא מדגם גבשושי 5-פואה עמיד (ובכך סביר לייצג אירוע אינטגרציה נכון, מסלול 5). סטנדרטי DNA מוצגים הערת נתיב 1. כי הגדלים של מוצרי ה- PCR למדגם אינטגרצית המועמדות הם consisteNT עם אירוע שילוב מוצלח, ואילו גודל של מוצרי ה- PCR למדגם גבשושיות עולה בקנה אחד עם מוקד hht2Δ :: URA3 ללא פגע. (ב) עיכול Eco RI לאשר את נוכחותו של אלל מוטנטי. למעלה: ייצוג קריקטורה של שברי העיכול הצפויים נגזרים תגובת עיכול Eco RI של מוצרי ה- PCR המכילים גם את גן wild-type HHT2 או האלל hht2 המוטציה. תחתונה: ניתוח ג'ל אלקטרופורזה של תגובות העיכול של מוצרי ה- PCR שמקורו בזן HHT2 wild-type (מסלול 2; המוצרים PCR משמש כאן נגזרו מאותו מדגם כמו זה המשמש מסלול 2 של פאנל) ו מדגם שילוב מועמד ( מסלול 3; המוצרים PCR משמש כאן נגזרו מאותו מדגם כמו זה המשמש מסלול 4 של פאנל). סטנדרטי DNA מוצגים הערת נתיב 1. שדפוסי העיכול לאשר כי AG מוטצית GA כבר הציגו בהצלחה לתוך הגנום של המועמדמדגם אינטגרציה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הרמה הגבוהה של הומולוגיה ברצף בין שני גנים שאינם אללים שקוד לכל אחד החלבונים היסטון ארבע ליבות בתאים הפלואידים cerevisiae ס יכול לייצג אתגר עבור חוקרים המבקשים למקד ספציפית אחת משני הגנים עבור mutagenesis. שתואר לעיל מתודולוגיות mutagenesis שמרים, כולל Perfetto Delitto, אתר ספציפי גנומי (SSG) mutagenesis, ושיטות החלפת אלל ללא שיבוט מבוסס PCR 5, 6, 7, כמו גם שמרים האחרונים יותר טכניקות מבוססות CRISPR 15, לעתים קרובות מסתמכים לפחות בחלקו על רצפים בתוך ORF של גן המטרה לגייס מנגנונים רקומבינציה או תיקון באתר גנומי הרצוי בסופו של דבר על מנת ליצור את אלל מוטנטי הסופי. מצד השני, את האסטרטגיה שהצגנו כאן עושה שימוש רצפי DNA משני צדי ORF הממוקדים לנהוג homologoאירוע רקומבינציה לנו הנדרשים לשילוב של המוטציה, וכתוצאה מכך, מאפשר לך לבצע מיקוד ספציפי יותר של גן על פני אחר למרות משני הגנים שיש ORFs ההומולוגי מאוד. תכונה זו הופכת את האסטרטגיה שלנו במיוחד מתאים היטב mutagenesis היסטון. עם זאת, אסטרטגיה זו יכולה גם להיות מותאמת עבור mutagenesis של גנים אחרים בגנום שמרים.

תכונות נוספות של האסטרטגיה שלנו כוללות את העובדות כי האורכים של האזורים שמניעים הומולוגיים של גני מוטנטיים יכול להיות מתוכנן להיות נרחבים מאוד, מעלה את רמת היעילות של שילוב במיקום הגנומי היעד, וכי מלבד את המוטציה הרצויה (הים ) לא מוצגים רצפי DNA נוספים לתוך הגנום. יתרון נוסף של מערכת זו הוא שברגע זן מחסה החלפת גן היסטון ספציפי עם URA3 נבנה, זה יכול לשמש עבור הדור של כל גרסת מוטציה רצויה כי ביסט בפרטגן אחד. כך, למשל, זן yAAD156, אשר זמינה לקהילת המחקר על פי דרישה, יכול לשמש להכנה רצויה שום מוטצית hht2 ללא הצורך בבניית אלל דה נובו hht2Δ :: URA3. לבסוף, באמצעות פריימרים PCR מתוכנן כראוי, אסטרטגיה זו יכולה לשמש גם כדי ליצור אללים היסטון עם מחיקות פנימי או עם מוטציות ב- קודונים מרובים, כל עוד הם קרובים יחסית זה לזה (למשל, יצרנו אלל hht2 קידוד H3-K56R, חלבון מוטנטי כפול L61W באמצעות אסטרטגיה זו).

היכולת למקד אחד ספציפי של שני גני היסטון הומולוגיים ביותר עבור mutagenesis יכולה להיות שימושית מספר הגדרות ניסויים שונים. לדוגמה, מאז גנים HHT1-HHF1 באים לידי ביטוי ברמות שונות לעומת הגנים HHT2-HHF2 16, זה יכול להיות עניין כדי לקבוע אם H3 מסוים או מוטציה H4 מקנה diפנוטיפים fferent תלוי איזה גן זה מתבטא מ. דוגמא נוספת היא תרחיש שבו חוקר מבקש לייצר תאים הפלואידים להביע מוטציה היסטון בפרט משני גני היסטון המקבילים - זו יכולה להיות מושגת על ידי mutagenizing הראשון כל גן עצמאי בשני זנים שונים, ולאחר מכן קבלת תאי הפלואידים מוטציה כפול באמצעות צלב והבידוד הבא של מוצרי meiotic הרצויים. דוגמה נוספת מתייחסת mutagenesis של היסטונים H2A ו H2B: בהתחשב בעובדה ששני isoforms שונה במקצת של כל חלבון המקודד על ידי סט גנים שאינם אללים המתאימים, חוקר אולי כדאי להעריך את ההשפעות של H2A ספציפי או מוטציה H2B ב בהקשר של כל אחד איזופורם. בעת תכנון ניסויים כדי mutagenize HTA1 ו לוקוסי HTB1 (קידוד H2A ו H2B, בהתאמה), חוקרים צריכים להיות מודעים הממצאים האחרונים מראים כי זנים נושאים (hta1-htb1) Δ הם קיימא רק אניf הם העצימו את הלוקוס-HTB2 HTA2HHT1-HHF1 מוקד הסמוכים לה) דרך הדור של כרומוזום מעגלי קטן 17, מאחר שהדבר עשוי לסבך את הפרשנות של התוצאות.

השתמשנו לאחרונה גרסה של אסטרטגית mutagenesis היסטון זה כדי ליצור חלבוני היסטון H3 להביע כל החלפות חומצת אמינו האפשריות במיקום 61, אשר כבש בדרך כלל על ידי לאוצין חומצות אמיניות 14. בניסויים אלה, במקום להשתמש yAAD156 כמו המתח מתחיל עבור mutagenesis, השתמשנו זן yADP106, אשר מטפח תחליף של ORF HHT2 הן עם URA3 ו TRP1 סמנים תזונתיים (במקום רק URA3). הנוכחות של שני גני הסמן קל לזיהוי מועמדי אינטגרציה של מוצרי ה- PCR מוטציה בעקבות צעד 5-פואה מסך וטיהור (שלבי 5 ו -6 לפרוטוקול), כמו candidat כזהes הפך phenotypically עורה - ו TRP -, בעוד מוטציה URA3 ספונטנית הביא תאים עם עורה - פנוטיפ TRP +. yADP106 זמין גם על פי דרישה, כמו גם הרצף של קלטת URA3-TRP1, אשר יכול להיות מוגברת כיחידה ושמשה mutagenesis של גני היסטון אחרים באמצעות האסטרטגיה שתוארה לעיל.

חוסר יכולת להשיג את מוטציות היסטון הרצוי באמצעות אסטרטגיה זו יכולה להיות מיוחסת מספר סיבות אפשריות, כולל כמות מספקת של מוצרי ה- PCR בגודל מלא המשמש הצעד אינטגרציה או מספר מספיק של transformants בעקבות צעד טרנספורמציה-שיתוף. הבעיה לשעבר יכול להיות מטופל על ידי איגום יחד קבוצות גדולות יותר של תגובות PCR או על ידי עיצוב סטים פריימר שונים המייצרים תשואה גבוהה יותר של המוצר, ואילו הבעיה האחרונה ניתן לפתור באמצעות כמויות גדולות יותר של פלסמיד עמוד השדרה בניסוי טרנספורמציה-שיתוף. Althoאיכס, כפי שצוין קודם לכן, ניתן להשתמש בהליך זה כדי ליצור מוטציות היסטון מחסה שתיים או יותר החלפות חומצת אמינו, חומצות אמינו הממוקדות צריכות להיות קרוב יחסית זה לזה מאז קודונים בהתאמה צריכים להיות ממוקמים בתוך אותה מולקולת פריימר. לכן, אסטרטגיה זו לא ניתן להתאים בקלות עבור הדור של היסטונים עם מוטציות רבות הממוקמות בריחוק זה מזה על פני האורך של החלבונים.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
ממוקד<em&gt; באתרו</em&gt; גני mutagenesis של היסטון שמרים הנץ
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter