Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

लक्षित doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चार मुख्य हिस्टोन प्रोटीन H2A, H2B, H3, H4 और संघनन, संगठन, और यूकेरियोटिक गुणसूत्रों के समारोह में केंद्रीय भूमिका निभाते हैं। इन histones से प्रत्येक के दो सेट हिस्टोन octamer, एक आणविक स्पूल है कि खुद को चारों ओर डीएनए के ~ 147 आधार जोड़े की लपेटकर निर्देशन फार्म, अंततः एक nucleosome 1 के गठन में जिसके परिणामस्वरूप। Nucleosomes ऐसे जीन प्रतिलेखन के विनियमन और euchromatin के गठन और गुणसूत्रों भर हेट्रोक्रोमैटिन के रूप में गुणसूत्र आधारित प्रक्रियाओं की एक किस्म में सक्रिय भागीदारी कर रहे हैं, और इस तरह के रूप में पिछले कई दशकों के पाठ्यक्रम पर गहन अनुसंधान का ध्यान केंद्रित किया गया है। तंत्र के एक नंबर वर्णित किया गया है जिसके द्वारा nucleosomes तरीके है कि विशिष्ट प्रक्रियाओं के निष्पादन की सुविधा कर सकते में हेरफेर किया जा सकता है - इन तंत्रों हिस्टोन अवशेषों की posttranslational संशोधन, एटीपी निर्भर nucleosome remodeling, और एटीपी स्वतंत्र nucleosome पुनर्गठन शामिलऔर विधानसभा / disassembly 2, 3।

नवोदित खमीर eukaryotes में हिस्टोन समारोह को समझने के लिए एक विशेष रूप से शक्तिशाली मॉडल जीव है। यह काफी हद तक डोमेन यूकेरिया भर हिस्टोन प्रोटीन के विकासवादी संरक्षण के उच्च स्तर और आनुवंशिक और जैव रासायनिक प्रयोगात्मक की एक किस्म के लिए खमीर का ज़िम्मा के लिए जिम्मेदार ठहराया जा सकता है 4 दृष्टिकोण। खमीर में रिवर्स आनुवंशिक दृष्टिकोण व्यापक रूप से क्रोमेटिन जीव विज्ञान के विभिन्न पहलुओं पर विशेष हिस्टोन परिवर्तन के प्रभाव का अध्ययन करने के लिए इस्तेमाल किया गया है। प्रयोगों के इन प्रकार के लिए यह असामान्य intracellular हिस्टोन प्रोटीन का स्तर (कारण कोशिकाओं में plasmids की संख्या अलग-अलग करने के लिए) और करने के लिए नेतृत्व कर सकते हैं जो कोशिकाओं में उत्परिवर्ती histones उनके पैतृक जीनोमिक loci से व्यक्त कर रहे हैं, स्वायत्त plasmids से अभिव्यक्ति के रूप में उपयोग करने के लिए अक्सर बेहतर है क्रोमेटिन एन के सहवर्ती परिवर्तनvironments, जो अंततः परिणामों की व्याख्या उलझाना कर सकते हैं।

यहाँ, हम एक पीसीआर आधारित तकनीक है कि उनके पैतृक जीनोमिक स्थानों है कि जीनोम में बचे हुए exogenous डीएनए दृश्यों के बिना एक कदम क्लोनिंग और वांछित उत्परिवर्तन (एस) की पीढ़ी में परिणाम की आवश्यकता नहीं है पर हिस्टोन जीन की लक्षित mutagenesis के लिए अनुमति देता है का वर्णन है। इस तकनीक को खमीर में कुशल मुताबिक़ पुनर्संयोजन प्रणाली का लाभ लेता है और इसी तरह की अन्य तकनीकों के अन्य समूहों द्वारा विकसित के साथ आम में कई विशेषताएं है - सबसे विशेष रूप Delitto Perfetto, साइट विशेष जीनोमिक (एसएसजी) mutagenesis, और क्लोनिंग से मुक्त पीसीआर आधारित एलील प्रतिस्थापन तरीकों 5, 6, 7। हालांकि, तकनीक का वर्णन हम एक पहलू है कि यह विशेष रूप से हिस्टोन जीन की mutagenesis के लिए अच्छी तरह से अनुकूल है। अगुणित खमीर कोशिकाओं में, चार कोर histones से प्रत्येक के द्वारा दो गैर-एक इनकोडिंग हैllelic और अत्यधिक मुताबिक़ जीन: उदाहरण के लिए, हिस्टोन H3 HHT1 और HHT2 जीन द्वारा इनकोडिंग है, और खुला पढ़ने फ्रेम (ORFs) दो जीनों की 90% से अधिक अनुक्रम में समान हैं। समरूपता के इस उच्च डिग्री के लिए विशेष mutagenesis के लिए दो हिस्टोन एन्कोडिंग जीनों में से एक को लक्ष्य बनाया गया प्रयोगों जटिल हो सकता है। जबकि ऊपर उल्लिखित तरीकों अक्सर मुताबिक़ पुनर्संयोजन ड्राइव करने के लिए लक्ष्य जीन की ओआरएफ के भीतर कम से कम कुछ दृश्यों के उपयोग की आवश्यकता, तकनीक हम यहाँ वर्णन के लिए हिस्टोन जीन की ORFs (जो हिस्सा बहुत कम अनुक्रम अनुरूपता) flanking दृश्यों का उपयोग करता है पुनर्संयोजन कदम है, इस प्रकार वांछित ठिकाना को mutagenesis के सफल लक्ष्य-निर्धारण की संभावना बढ़ रही है। इसके अलावा, मुताबिक़ क्षेत्रों है कि पुनर्संयोजन ड्राइव बहुत व्यापक हो सकता है, आगे कुशल लक्षित मुताबिक़ पुनर्संयोजन में योगदान दे।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

नोट: सीटू हिस्टोन जीन mutagenesis में लक्षित के लिए प्रयोगात्मक रणनीति कई कदम (चित्रा 1 में संक्षेप) शामिल हैं। इन चरणों में शामिल हैं: (1) URA3 जीन के साथ लक्ष्य हिस्टोन जीन की रिप्लेसमेंट, (2) पीढ़ी और वांछित उत्परिवर्तन (s), शरण प्राइमरों का उपयोग लक्ष्य हिस्टोन जीन की दो आंशिक रूप से अतिव्यापी टुकड़े करने के लिए इसी पीसीआर उत्पादों की शुद्धि (3 ) दो आंशिक रूप से अतिव्यापी टुकड़े का फ्यूजन पीसीआर एकीकरण के लिए पूर्ण आकार पीसीआर उत्पादों प्राप्त करने के लिए, (4) 5-FOA प्रतिरोधी के लिए पूर्ण आकार पीसीआर उत्पादों और रीढ़ की हड्डी प्लाज्मिड के सह-परिवर्तन, और प्लाज्मिड पर मार्कर के लिए चयन, (5) स्क्रीन transformants, (6) 5-FOA प्रतिरोधी कालोनियों की शुद्धि और रीढ़ की हड्डी प्लाज्मिड की हानि, और (7) आण्विक उत्परिवर्ती एलील के समुचित एकीकरण के लिए परख करने के लिए विश्लेषण करती है।

आकृति 1
सीटू mutagenesis में लक्षित के लिए। इस उदाहरण में लक्षित जीन HHT2 है, लेकिन किसी भी अन्य कोर हिस्टोन जीन भी इस रणनीति का प्रयोग mutagenized जा सकता है। (ए) अगुणित खमीर कोशिकाओं के रूप में चित्र में दिखाया गया दो हिस्टोन H3 एन्कोडिंग जीन (HHT1 और HHT2) और दो हिस्टोन एच 4 एन्कोडिंग जीन (HHF1 और HHF2) की व्यवस्था की बंदरगाह (HHT1 और HHF1 जीन गुणसूत्र द्वितीय और HHT2 पर स्थित हैं और HHF2 जीन गुणसूत्र XIV पर स्थित हैं - प्रत्येक मामले में, तीर प्रतिलेखन की दिशा में बात)। प्रक्रिया के पहले चरण में, HHT2 जीन की ओआरएफ URA3 जीन से बदला है, एक hht2Δ :: URA3 तनाव को जन्म दे रही है। (बी) के भाग 1 में, एक जीनोमिक डीएनए नमूने से HHT2 जीन की एक जंगली प्रकार की नकल पीढ़ी के लिए दो पीसीआर प्रतिक्रियाओं के लिए टेम्पलेट के रूप में प्रयोग किया जाता हैदो जीन की आंशिक रूप से अतिव्यापी टुकड़े ते। पहली प्रतिक्रिया के लिए रिवर्स प्राइमर एक या एक से अधिक बेमेल न्यूक्लियोटाइड (एक लाल वृत्त के साथ संकेत दिया) कि वांछित उत्परिवर्तन (s) जीनोम में पेश किए जाने के अनुरूप भी शामिल है। दूसरी प्रतिक्रिया के लिए आगे प्राइमर एक रिवर्स पूरक विन्यास (यह भी एक लाल वृत्त के साथ संकेत) में बराबर बेमेल है। दो पीसीआर भाग 1 में उत्पन्न उत्पादों (उत्पादों और बी) के रूप में तो संलयन पीसीआर के लिए टेम्पलेट्स दो प्राइमरों कि उत्पादों को एक और फैशन में बी करने के लिए पानी रखना हिस्सा 2 में दिखाया गया यह पूर्ण आकार पीसीआर की पीढ़ी में परिणाम का उपयोग कर इस्तेमाल कर रहे हैं उत्पादों (भाग 3 में उत्पाद ग) वांछित उत्परिवर्तन (ओं) को शरण। (सी) hht2Δ :: URA3 तनाव तो है सह तब्दील कमी मीडिया पर पूर्ण आकार पीसीआर उत्पादों और रीढ़ की हड्डी प्लाज्मिड (एक HIS3- इस उदाहरण में प्लाज्मिड चिह्नित) के साथ, और कोशिकाओं प्लाज्मिड की उपस्थिति के लिए चयन किया जाता है ( जइस उदाहरण में istidine)। Transformants तो 5-FOA प्रतिरोध के लिए जांच कर रहे हैं - प्रतिरोधी कोशिकाओं पीसीआर उत्पाद और URA3 जीन के छांटना के एकीकरण के लिए अग्रणी एक मुताबिक़ पुनर्संयोजन घटना आया होने के रूप में दिखाया लिए उम्मीदवार हैं। mitotic कोशिका विभाजन से रीढ़ की हड्डी प्लाज्मिड के बाद के नुकसान अंतिम वांछित हिस्टोन उत्परिवर्ती तनाव की ओर जाता है। हम 5-FOA प्लेटों पर प्रत्यक्ष चयन है, जो ज्यादातर कोशिकाओं है कि सहज URA3 म्यूटेशन हासिल कर ली है पहचानती की तुलना में सही एकीकरण की घटनाओं की पहचान का एक बहुत उच्च आवृत्ति में 5-FOA प्रतिरोध परिणामों के लिए स्क्रीनिंग के द्वारा पीछा रीढ़ प्लाज्मिड की है कि चयन मिल गया है। (यह आंकड़ा संदर्भ 14 से संशोधित किया गया है)। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

URA3 साथ लक्ष्य Histone जीन की 1. रिप्लेसमेंटजीन

  1. मानक पीसीआर की मध्यस्थता एक कदम जीन व्यवधान URA3 जीन 8, 9 के साथ लक्ष्य हिस्टोन जीन की ओआरएफ की जगह प्रदर्शन करना।
    नोट: ura3Δ0 ले जाने खमीर कोशिकाओं के उपयोग के रूप में इस उत्परिवर्तन पूरे अंतर्जात URA3 ओआरएफ निकालता है, इस प्रकार URA3 ठिकाना 8 में पीसीआर उत्पाद के एकीकरण से बचने की सिफारिश की है। वैकल्पिक रूप से, लालकृष्ण lactis URA3 जीन किसी भी ura3 पृष्ठभूमि में हिस्टोन प्रतिस्थापन की पीढ़ी के लिए प्रभावी ढंग से इस्तेमाल किया जा सकता है क्योंकि यह एस cerevisiae में कार्यात्मक है, लेकिन एस cerevisiae URA3 जीन के साथ ही आंशिक अनुक्रम अनुरूपता है। तनाव भी कम से कम एक यौगिक है कि परिवर्तन प्रयोग (इस प्रोटोकॉल के चरण 4 देखें) में रीढ़ की हड्डी प्लाज्मिड के चयन के लिए अनुमति देगा के लिए auxotrophic होना चाहिए। यह कदम आवश्यक नहीं है अगर एक लक्ष्य हिस्टोन geneΔ :: URA3तनाव पहले से ही उपलब्ध है।

2. जनरेशन और वांछित उत्परिवर्तन शरण प्राइमर का उपयोग कर लक्ष्य Histone जीन की दो आंशिक रूप से अतिव्यापी टुकड़े करने के लिए इसी पीसीआर उत्पादों की शुद्धि (s)

  1. लक्ष्य हिस्टोन जीन की दो आंशिक रूप से अतिव्यापी टुकड़े करने के लिए इसी पीसीआर उत्पादों उत्पन्न करता है।
    1. इस प्रकार के रूप में दो पीसीआर प्रतिक्रियाओं तैयार:
      1. 1 μl टेम्पलेट डीएनए, 5 μl10 माइक्रोन के आगे प्राइमर, 5 μl10 सुक्ष्ममापी रिवर्स प्राइमर, 0.5 μl (1.25 यू) थर्मास्टाइबल: जीन (चित्रा 1 बी में उत्पाद एक) की पहली छमाही, निम्नलिखित प्रतिक्रिया की स्थापना के लिए इसी पीसीआर उत्पादों को उत्पन्न करने के लिए डीएनए पोलीमरेज़, 10 μl 5x डीएनए पोलीमरेज़ बफर, 5 μl dNTP मिश्रण (2 मिमी प्रत्येक), और 23.5 μl DH 2
        नोट: टेम्पलेट डीएनए जीनोमिक डीएनए लक्ष्य हिस्टोन जीन के लिए एक तनाव जंगली प्रकार से प्राप्त किया जा सकता मानक समर्थक का उपयोग कर अलग10 cedures। डीएनए एकाग्रता और विभिन्न जीनोमिक तैयारी में दोष के स्तर में बदलाव के लिए खाते में करने के लिए, यह या तो undiluted डीएनए या जीनोमिक तैयारियों के विभिन्न dilutions का उपयोग करके प्रतिक्रियाओं का अनुकूलन करने की सिफारिश की है (जैसे, 1:10 और 1: 100)। आगे प्राइमर लक्ष्य जीन की नदी के ऊपर एक क्षेत्र के लिए पानी रखना चाहिए। रिवर्स प्राइमर लंबाई में ओआरएफ के भीतर 40 न्यूक्लियोटाइड पानी रखना चाहिए, हो ~, और यह के बीच में वांछित उत्परिवर्तन (एस) होते हैं कहीं (देखें उदाहरण के लिए चित्रा 1 बी -1 और प्रतिनिधि परिणाम अनुभाग)। एक उच्च निष्ठा डीएनए पोलीमरेज़ के उपयोग के आदेश पीसीआर उत्पादों के संश्लेषण के दौरान अवांछित म्यूटेशन की दरों को कम करने की सिफारिश की है।
      2. जीन (चित्रा 1 बी में उत्पाद ख) की दूसरी छमाही के लिए इसी पीसीआर उत्पादों को उत्पन्न करने के लिए, के रूप में 2.1.1.1 में लेकिन अलग प्राइमरों के साथ संकेत दिया एक प्रतिक्रिया की स्थापना की।
        नोट: आगे प्राथमिकमेर लंबाई में 40 न्यूक्लियोटाइड ओआरएफ के भीतर पानी रखना चाहिए, हो ~, और वांछित उत्परिवर्तन (एस) के बीच में कहीं न कहीं होते हैं। ध्यान दें कि उत्परिवर्तन (s) इस किताब में कदम 2.1.1.1 में उत्परिवर्तन (s) रिवर्स प्राइमर में की रिवर्स पूरक है। रिवर्स प्राइमर एक क्षेत्र लक्ष्य जीन के बहाव के लिए पानी रखना चाहिए (देखें उदाहरण के लिए चित्रा 1 बी -1 और प्रतिनिधि परिणाम अनुभाग)।
    2. thermocycler में प्रतिक्रियाओं निम्नलिखित सेटिंग्स के साथ की जगह: 94 सी 30 सेकंड; निम्नलिखित सेटिंग्स के 30 चक्रों: 98 सी 10 सेकंड, 60 ग 5 सेकंड, 72 ग 1.5 मिनट; और 72 सी 10 मिनट।
      नोट: पीसीआर मानकों के अनुकूलन विशिष्ट प्राइमर सेट के लिए आवश्यक हो सकता है और हिस्टोन जीन लक्ष्य।
  2. 89 मिमी Tris आधार, 89 मिमी बोरिक एसिड, 2.5 मिमी EDTA (TBE) बफर में 0.9% कम पिघलने बिंदु agarose जेल पर पीसीआर प्रतिक्रियाओं से सामग्री के 50 μl - 20 रन।
  3. कट agarose जेल पीसीआर जनसंपर्क युक्त वर्गोंजेल से oducts एक साफ छुरी या रेजर ब्लेड का उपयोग और एक 1.5 मिलीलीटर microcentrifuge ट्यूब करने के लिए प्रत्येक हस्तांतरण। -20 सेल्सियस पर पीसीआर उत्पादों युक्त agarose वर्गों की दुकान का उपयोग करने के लिए तैयार है जब तक।

3. दो आंशिक रूप से अतिव्यापी टुकड़े का फ्यूजन पीसीआर एकता के लिए पूर्ण आकार पीसीआर उत्पादों को प्राप्त करने के लिए

  1. पीसीआर प्रतिक्रियाओं के लिए खाका तैयार
    1. 5 मिनट के लिए 65 सी में एक गर्मी ब्लॉक सेट में microcentrifuge ट्यूबों रखकर 2.3 कदम से agarose जेल वर्गों पिघला (या पूरी तरह से पिघल तक)। भंवर ट्यूब हर 1 - 2 मिनट पिघलने की प्रक्रिया को सुविधाजनक बनाने के लिए।
    2. प्रत्येक नमूने से agarose पिघल का एक सेट राशि के हस्तांतरण (जैसे, 50 μl प्रत्येक, 100 μl की कुल के लिए) एक microcentrifuge ट्यूब में और vortexing द्वारा मिश्रण। फ्यूजन पीसीआर प्रतिक्रियाओं में टेम्पलेट के रूप में इस का प्रयोग करें। -20 सेल्सियस पर ट्यूब जगह का उपयोग करने के लिए तैयार है जब तक।
  2. पूर्ण आकार पीसीआर उत्पाद की एक बड़ी मात्रा बढ़ाना (उत्पाद चित्रा 1 बी में)
    1. 2 μl टेम्पलेट डीएनए, 10 μl 10 माइक्रोन के आगे प्राइमर, 10 μl 10 माइक्रोन रिवर्स प्राइमर, 1 μl (2.5 यू) थर्मास्टाइबल डीएनए पोलीमरेज़, 20 μl 5x डीएनए पोलीमरेज़ बफर, 10 μl: छह पीसीआर प्रतिक्रियाओं, निम्नलिखित घटकों के साथ प्रत्येक सेट अप dNTP मिश्रण (2 मिमी प्रत्येक), और 47 μl DH 2
      नोट: प्रतिक्रियाओं की संख्या पीसीआर दक्षता के आधार पर बदला जा सकता है। टेम्पलेट डीएनए (3.1.2 देखें) 65 सेल्सियस तक गर्म किया जाना चाहिए, जब तक पिघल vortexing से मिलाया, और पीसीआर प्रतिक्रिया मिश्रण करने के लिए पिछले जोड़ा। एक बार जब जोड़ा, समाधान ऊपर pipetting द्वारा और कई बार नीचे धीरे लेकिन अच्छी तरह मिला लें। विभिन्न नमूनों में डीएनए एकाग्रता में बदलाव के लिए खाते में करने के लिए, यह पहली बार या तो undiluted टेम्पलेट या टेम्पलेट के विभिन्न dilutions का उपयोग करके प्रतिक्रियाओं का अनुकूलन करने की सिफारिश की है (जैसे, 1:10 और 1: 100)। दो बीमार के रूप में लक्ष्य जीन की आंशिक रूप से अतिव्यापी टुकड़े करने के लिए पानी रखना चाहिए इस्तेमाल किया दो प्राइमरोंचित्रा 1 बी -2 में ustrated और इस तरह डिजाइन किया जाना है कि अंतिम पीसीआर उत्पादों क्षेत्रों URA3 ओआरएफ flanking कि मुताबिक़ पुनर्संयोजन कदम (देखें उदाहरण के लिए प्रतिनिधि परिणाम अनुभाग) ड्राइव करेंगे करने के लिए दोनों ओर के मुताबिक़ पर कम से कम 40 आधार जोड़े होगा। एक उच्च निष्ठा डीएनए पोलीमरेज़ के उपयोग के आदेश पीसीआर उत्पादों के संश्लेषण के दौरान अवांछित म्यूटेशन की दरों को कम करने की सिफारिश की है।
    2. एक thermocycler में ट्यूबों निम्नलिखित सेटिंग्स के साथ की जगह: 94 सी 30 सेकंड; निम्नलिखित सेटिंग्स के 30 चक्रों: 98 सी 10 सेकंड, 50 सी 15 सेकंड, 72 ग 1.5 मिनट; और 72 सी 10 मिनट।
      नोट: पीसीआर मानकों के अनुकूलन विशिष्ट प्राइमर सेट और लक्ष्य हिस्टोन जीन के लिए आवश्यक हो सकता है।

प्लाज्मिड पर पूर्ण आकार पीसीआर उत्पादों और रीढ़ प्लाज्मिड के 4. सह-परिवर्तन, और मार्कर के लिए चयन

  1. पीसीआर उत्पादों की एकाग्रता
    1. पूल रोंनौवीं पीसीआर प्रतिक्रियाओं के लिए एक एकल microcentrifuge ट्यूब में कदम 3.2.2 से (600 μl कुल) और vortexing द्वारा मिश्रण।
    2. microcentrifuge ट्यूब में तीन 200 μl aliquots में नमूना विभाजित। 3M सोडियम एसीटेट के 20 μl (पीएच 5.2) और 100% इथेनॉल के 550 μl जोड़कर प्रत्येक ट्यूब में डीएनए वेग। समाधान अच्छी तरह मिक्स और कम से कम 15 मिनट के लिए बर्फ पर जगह है। 10 मिनट के लिए ~ 14,000 XG पर centrifugation द्वारा डीएनए लीजिए, 200 शुष्क हवा में 70% इथेनॉल के μl, और साथ गोली कुल्ला।
    3. DH 2 हे के 25 μl में प्रत्येक डीएनए गोली Resuspend, और (75 μl की कुल के लिए) एक एकल ट्यूब में पूल।
  2. खमीर सह परिवर्तन
    1. खमीर निकालने Peptone Dextrose (YPD) तरल माध्यम से 11 में धारा 1 में उत्पन्न तनाव की रात संस्कृति की 10 मिलीलीटर की तैयारी।
    2. अगली सुबह, संतृप्त रातोंरात संस्कृति के 8 मिलीलीटर के साथ YPD तरल माध्यम के 400 एमएल टीका लगाना और झटकों से सेते4 के लिए 30 डिग्री सेल्सियस पर - 5 h कोशिकाओं के विकास की लघुगणक चरण में प्रवेश करने की अनुमति है।
    3. 10 मिनट के लिए ~ 3220 XG पर centrifugation द्वारा कोशिकाओं को इकट्ठा तरल माध्यम त्यागें, और 10 मिमी Tris एचसीएल (पीएच 8.0), 1 मिमी EDTA के 1 मात्रा में कोशिकाओं resuspend, 0.1 एम लिथियम एसीटेट समाधान (ते / LiAc) ।
    4. 10 मिनट के लिए ~ 3220 XG पर centrifugation द्वारा कोशिकाओं को ले लीजिए, और ते / LiAc त्यागें।
    5. 1 मिलीलीटर ते / LiAc में कोशिकाओं Resuspend।
    6. एक microcentrifuge ट्यूब में निम्नलिखित प्रतिक्रिया कॉकटेल सेट करें: कदम 4.2.5 से कोशिकाओं के 800 μl, उबला हुआ 10 मिलीग्राम / एमएल सामन शुक्राणु डीएनए के 40 μl, रीढ़ की हड्डी प्लास्मिड डीएनए के 12.5 माइक्रोग्राम की कुल, और केंद्रित पीसीआर उत्पाद के 75 μl कदम 4.1.3 से।
      नोट: सामन शुक्राणु डीएनए 5 मिनट के लिए उबला हुआ और प्रतिक्रिया में उपयोग करने से पहले कम से कम 5 मिनट के लिए बर्फ पर रखा जाना चाहिए। रीढ़ की हड्डी प्लास्मिड डीएनए जोड़ा की कुल मात्रा एक न्यूनतम (~ 80 μl या कम) के लिए रखा जाना चाहिए। रीढ़ की हड्डी प्लाज्म का एक उदाहरण के लिए प्रतिनिधि परिणाम अनुभाग देखेंआईडी।
    7. समान रूप से आठ microcentrifuge ट्यूब (- 8 ट्यूब 1) में कॉकटेल ट्यूब अच्छी तरह से और विभाज्य मिक्स।
    8. निम्नलिखित दो नियंत्रण परिवर्तन प्रतिक्रिया ट्यूबों सेट करें:
      1. ट्यूब 9 (कोई पीसीआर उत्पाद नियंत्रण): कदम 4.2.5 से कोशिकाओं के 100 μl, उबला हुआ 10 मिलीग्राम / एमएल सामन शुक्राणु डीएनए के 5 μl;, 1.56 माइक्रोग्राम की की कुल (5 मिनट के लिए उबला हुआ कदम 4.2.6 नोट देखें) रीढ़ की हड्डी प्लास्मिड डीएनए और कोई पीसीआर उत्पाद जोड़ा।
      2. ट्यूब 10 (कोई डीएनए नियंत्रण): कदम 4.2.5, उबला हुआ 10 मिलीग्राम / एमएल सामन शुक्राणु डीएनए (देखें कदम 4.2.6 नोट) के 5 μL से कोशिकाओं के 100 μl, कोई रीढ़ प्लास्मिड डीएनए जोड़ा है, और कोई पीसीआर उत्पाद जोड़ा।
      3. ऊपर pipetting द्वारा और कई बार नीचे धीरे लेकिन अच्छी तरह से दोनों ट्यूबों मिक्स।
    9. 30 मिनट के लिए 30 सी में दस ट्यूबों सेते हैं।
    10. प्रत्येक ट्यूब, ते / LiAc में (PEG 3350) 40% पॉलीथीन ग्लाइकोल के 1.2 मिलीलीटर जोड़ें। अच्छी तरह से एक पी-1000 pipet का उपयोग जब तक समाधान सजातीय है मिलाएं।
    11. 30 से कम दस ट्यूबों सेते30 मिनट के लिए सें। धीरे ऊपर और नीचे pipetting द्वारा समाधान मिश्रण है और फिर 15 मिनट के लिए 42 डिग्री सेल्सियस पर ट्यूबों सेते हैं।
    12. 30 सेकंड के लिए ~ 14,000 XG पर एक microcentrifuge में ट्यूबों कताई द्वारा कोशिकाओं को ले लीजिए। तरल त्यागें और बाँझ DH 2 ओ के 1 मिलीलीटर में कोशिकाओं resuspend
    13. 30 सेकंड के लिए ~ 14,000 XG पर एक microcentrifuge में ट्यूबों कताई द्वारा कोशिकाओं को ले लीजिए। तरल त्यागें और बाँझ DH 2 ओ के 500 μl में कोशिकाओं resuspend
    14. पूल नलियों 1 - 8 एक साथ (4 मिलीलीटर की कुल मात्रा) और ऊपर और नीचे pipetting द्वारा अच्छी तरह मिला लें।
    15. प्लेट रीढ़ प्लाज्मिड के चयन के लिए बीस पूरा न्यूनतम छोड़ने वालों मध्यम प्लेटों 11 (प्लेटों 1-20) में से प्रत्येक पर उपरोक्त मिश्रण के 200 μl।
    16. प्लेट ट्यूब 9 से मिश्रण के 200 μl और अपने स्वयं के चयन की थाली पर ट्यूब 10 प्रत्येक से मिश्रण के 200 μl (प्लेटें 21 और 22, क्रमशः)।
    17. करने के लिए 5 दिन - 3 के लिए 30 डिग्री सेल्सियस पर 22 प्लेटें सेतेप्लाज्मिड transformants के लिए चयन करें।
    18. ऊष्मायन के 5 दिनों - 3 के बाद परिवर्तन प्लेटों का निरीक्षण किया। लगभग 5000 कॉलोनियों प्लेटों 1-21 (एक उदाहरण के लिए प्रतिनिधि परिणाम देखें) पर दिखाई जानी चाहिए और कोई कालोनियों प्लेट 22 पर मौजूद होना चाहिए।

5. 5 FOA प्रतिरोधी transformants के लिए स्क्रीन

  1. प्लेटों से कोशिकाओं स्थानांतरण 1 - 20 (और एक नियंत्रण के रूप में परिवर्तन थाली 21) 5-fluoroorotic एसिड (5 FOA) प्लेटों से 11 से प्रतिकृति चढ़ाना आदेश के एकीकरण का एक परिणाम के रूप में URA3 जीन के नुकसान के लिए स्क्रीन करने के लिए 12 इच्छित स्थान पर पीसीआर उत्पादों।
    1. थाली ढक्कन निकालें और एक बाँझ मखमल पर कालोनियों युक्त थाली दबाएँ। मखमल पर थाली दबाने से 5 FOA थाली करने के लिए मखमल से कोशिकाओं स्थानांतरण। 2 दिनों के लिए 30 सेल्सियस पर प्लेटें सेते हैं।
  2. 2 दिन ऊष्मायन के बाद, ध्यान से जीआर के लिए 5-FOA प्लेटों का निरीक्षणowth।
    नोट: एक उम्मीदवार एकीकरण घटना 5 FOA प्लेट पर एक छोटी सी विषम "कुचल" कॉलोनी द्वारा प्रतिनिधित्व किया जाएगा - इसके विपरीत, छोटे papillae 5 FOA प्लेटों पर बढ़ रही है उस पर कालोनियों के विकास के दौरान पैदा हुई सहज URA3 म्यूटेशन की संभावना प्रतिनिधि हैं परिवर्तन प्लेटों, और इस तरह वांछित एकीकरण घटना (इस मुद्दे पर आगे विस्तार के लिए प्रतिनिधि परिणाम अनुभाग में और कुछ उदाहरण के लिए चित्रा 3 देखें) का प्रतिनिधित्व करने की संभावना नहीं है।

6. 5 FOA प्रतिरोधी कालोनियों और रीढ़ प्लाज्मिड के झड़ने की शुद्धि

  1. बाँझ toothpicks का उपयोग करना, YPD प्लेटों पर एकल कालोनियों के लिए कदम 5.2 और लकीर में वर्णित 5 FOA प्लेटों से उम्मीदवार कालोनियों उठाओ। 30 डिग्री सेल्सियस पर 3 दिन - 2 के लिए सेते हैं।
  2. ऊष्मायन, प्रतिकृति के बाद - प्लेट एक ताजा YPD थाली करने के लिए प्रत्येक YPD शुद्धि की थाली, एक ड्रॉप आउट प्लेट घटाने के लिए जाँच करने के लिए uracil कमीURA3 जीन, और एक दूसरे ड्रॉप आउट प्लेट की उपस्थिति या रीढ़ की हड्डी प्लाज्मिड की अनुपस्थिति के लिए निगरानी के लिए। 30 डिग्री सेल्सियस पर 2 दिन - 1 के लिए सेते हैं।
  3. ऊष्मायन के बाद, प्रत्येक उम्मीदवार नमूना है कि YPD थाली पर बढ़ रहा है, लेकिन या तो ड्रॉप आउट प्लेट पर नहीं बढ़ रहा से एक कॉलोनी की पहचान (जैसे एक कॉलोनी पुनर्संयोजन घटना के माध्यम से URA3 जीन खो दिया है की उम्मीद है और mitotic के दौरान रीढ़ की हड्डी प्लाज्मिड खो दिया है कोशिका विभाजन)। ताजा YPD प्लेटों पर ऐसी कालोनियों Restreak। इन कालोनियों एकीकरण उम्मीदवार हैं और चरण 7 में आगे विश्लेषण किया जाएगा।

उत्परिवर्ती एलील की समुचित एकीकरण के लिए परख करने के लिए 7. आण्विक विश्लेषण

  1. मानक प्रक्रियाओं का उपयोग कर 10 उम्मीदवार नमूनों से जीनोमिक डीएनए अलग।
  2. जीनोमिक क्षेत्र लक्ष्य साइट को शामिल बढ़ाना।
    1. 0.5 μl टेम्पलेट डीएनए, 5 μl: प्रत्येक नमूना के लिए निम्नलिखित पीसीआर प्रतिक्रिया सेट अप10 माइक्रोन के आगे प्राइमर, 5 μl 10 माइक्रोन रिवर्स प्राइमर, 0.5 μl (2.5 यूनिट) Taq डीएनए पोलीमरेज़, 5 μl 10x Taq डीएनए पोलीमरेज़ बफर, 5 μl dNTP मिश्रण (2 मिमी प्रत्येक), और 29 μl DH 2
      नोट: टेम्पलेट डीएनए जीनोमिक डीएनए के नमूने उम्मीदवार से प्राप्त होता है। यह सिफारिश की है भी दो नियंत्रण प्रतिक्रियाओं शामिल करने के लिए: एक मूल हिस्टोन geneΔ से निकाली गई जीनोमिक डीएनए :: टेम्पलेट के रूप में URA3 तनाव का उपयोग और टेम्पलेट के रूप में एक जंगली प्रकार हिस्टोन तनाव से दूसरे जीनोमिक डीएनए का उपयोग कर। डीएनए एकाग्रता और विभिन्न जीनोमिक तैयारी में दोष के स्तर में बदलाव के लिए खाते में करने के लिए, यह या तो undiluted डीएनए या जीनोमिक तैयारियों के विभिन्न dilutions का उपयोग करके प्रतिक्रियाओं का अनुकूलन करने की सिफारिश की है (जैसे, 1:10 और 1: 100)। यह सुनिश्चित करने के लिए महत्वपूर्ण है कि इस क्षेत्र के कथित एकीकृत पीसीआर उत्पाद से घिरा बाहर डीएनए दृश्यों के लिए इन प्राइमरों पानी रखना - इस तरह से, इन r में पीसीआर उत्पादों का आकार(उदाहरण के लिए प्रतिनिधि परिणाम देखें) eactions सही जीनोमिक स्थान पर उत्पादों के एकीकरण के लिए एक नैदानिक उपकरण के रूप में इस्तेमाल किया जा सकता है।
    2. thermocycler में प्रतिक्रियाओं निम्नलिखित सेटिंग्स के साथ की जगह: 94 डिग्री सेल्सियस 3 मिनट; निम्नलिखित सेटिंग्स के 30 चक्रों: 94 डिग्री सेल्सियस 45 सेकंड, 50 डिग्री सेल्सियस 45 सेकंड, 72 डिग्री सेल्सियस 2 मिनट; और 72 डिग्री सेल्सियस 10 मिनट।
      नोट: पीसीआर मानकों के अनुकूलन विशिष्ट प्राइमर सेट और लक्ष्य हिस्टोन जीन के लिए आवश्यक हो सकता है।
  3. पीसीआर उत्पादों का प्रसंस्करण
    1. एक 0.8% TBE agarose जेल पर प्रत्येक प्रतिक्रिया से 20 μl चलाएँ।
    2. डीएनए मानकों का उपयोग कर एक संदर्भ के रूप में निर्धारित करने के लिए यदि URA3 जीन सफलतापूर्वक कथित उत्परिवर्तित जीन हिस्टोन द्वारा प्रतिस्थापित किया गया पीसीआर उत्पादों के आकार का आकलन (एक उदाहरण के लिए प्रतिनिधि परिणाम देखें)।
      नोट: कुछ मामलों में, वांछित उत्परिवर्तन (s) हिस्टोन जीन में पेश किया तो बना सकते हैं या एक प्रतिबंध को नष्ट कर बैठते हैंई। यदि यह मामला है, आकार सही एकीकरण का संकेत की पीसीआर उत्पादों में वांछित उत्परिवर्तन की उपस्थिति पाचन के लिए इसी प्रतिबंध एंजाइम जेल वैद्युतकणसंचलन विश्लेषण द्वारा पीछा के साथ उत्पादों को subjecting द्वारा मूल्यांकन किया जा सकता है (उदाहरण के लिए प्रतिनिधि परिणाम देखें) ।
    3. आकार डीएनए अनुक्रमण के लिए सही एकीकरण का संकेत के अधीन रहते हुए पीसीआर उत्पादों वांछित उत्परिवर्तन (एस) की उपस्थिति की पुष्टि करने और यह सुनिश्चित करना है कि कोई अतिरिक्त म्यूटेशन जीनोम में पेश किया गया है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हम एक hht2 एलील एक हिस्टोन H3 उत्परिवर्ती प्रोटीन सीटू म्युटाजेनेसिस रणनीति में लक्षित के एक प्रतिनिधि उदाहरण के रूप में एक glutamic एसिड (H3-R53E उत्परिवर्ती) के लिए एक arginine से स्थिति 53 पर एक प्रतिस्थापन शरण व्यक्त की पीढ़ी का वर्णन है।

हम एक तनाव, जिसमें HHT2 की पूरी ओआरएफ URA3 जीन (प्रोटोकॉल के चरण 1 देखें) द्वारा बदल दिया है उत्पन्न। इस तनाव, yAAD156, यह भी एक his3Δ200 एलील है, जो कोशिकाओं का कारण बनता है हिस्टिडीन के लिए auxotrophic होना करने के लिए बंदरगाहों। प्रक्रिया प्रोटोकॉल के चरण 2 में संकेत के बाद, हम तो दो HHT2 के आंशिक रूप से अतिव्यापी टुकड़े उत्पन्न। निम्नलिखित प्राइमरों पहला टुकड़ा के लिए इस्तेमाल किया गया: आगे प्राइमर (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' और रिवर्स प्राइमर (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'। निम्नलिखित जनसंपर्कimers दूसरा टुकड़ा के लिए इस्तेमाल किया गया: आगे प्राइमर (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' और रिवर्स प्राइमर (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'। ध्यान दें कि पहली प्रतिक्रिया में रिवर्स प्राइमर और दूसरी प्रतिक्रिया में आगे प्राइमर होते वांछित उत्परिवर्तित न्यूक्लियोटाइड (कम मामले में) - इन उत्परिवर्तित न्यूक्लियोटाइड जंगली प्रकार के दृश्यों के लिए दोनों के बीच लंबी हिस्सों में बसे हैं, के रूप में यह कुशल annealing के लिए अनुमति देता है उत्परिवर्तित पदों पर बेमेल बावजूद टेम्पलेट डीएनए के लिए प्राइमर की। यह भी ध्यान रखें कि इन दो प्राइमरों में उत्परिवर्तित न्यूक्लियोटाइड एक दूसरे के पूरक हैं रिवर्स और भावना कतरा में जीए उत्परिवर्तन के लिए एक एजी, जो एक आगा में यह परिणाम कोडोन परिवर्तन है, जो अंततः इनकोडिंग प्रोटीन में उत्परिवर्तन R53E का उत्पादन GAA के कारण। इन पीसीआर प्रतिक्रियाओं से परिणाम चित्रा 2A में दिखाया जाता है।

चरण 3 में प्रक्रिया का उपयोग करना, हम तो Gener पूर्ण आकार पीसीआर उत्पादों पैदा। इस्तेमाल किया प्राइमरों थे आगे प्राइमर (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'और रिवर्स प्राइमर (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '। जब इन प्राइमरों डिजाइनिंग, यह सुनिश्चित करने के लिए है कि जिसके परिणामस्वरूप संलयन पीसीआर उत्पादों कम से कम 40 आधार जोड़े में शामिल हैं या तो मुताबिक़ पुनर्संयोजन प्रतिक्रिया (अब अनुरूपता के क्षेत्रों, और अधिक कुशल और विशिष्ट मुताबिक़ पुनर्संयोजन घटनाओं जाएगा ड्राइव करने के लिए समाप्त हो जाती है पर महत्वपूर्ण है हो सकता है)। हमारे प्रयोग में, पूर्ण आकार पीसीआर उत्पादों क्षेत्रों नदी के ऊपर करने के लिए एक 195 आधार जोड़ी क्षेत्र और 220 आधार जोड़ी क्षेत्र मुताबिक़ और HHT2 ओआरएफ के बहाव में क्रमश: निहित। इन पीसीआर उत्पादों का एक नमूना agarose जेल वैद्युतकणसंचलन (चित्रा 2 बी) द्वारा विश्लेषण किया गया था।

पूर्ण आकार पीसीआर उत्पादों तो प्लाज्मिड pRS413 (एक centromeric के साथ सह-बदल रहे थे, HIS3- प्लाज्मिड चिह्नितएफ "> 13) और transformants प्रोटोकॉल के चरण 4 में वर्णित के रूप में हिस्टिडीन (अनुसूचित जाति-उसकी प्लेट) की कमी प्लेटों पर चयन किया गया था। उनका + कालोनियों तो 5-FOA प्रतिरोध प्रक्रियाओं प्रोटोकॉल के चरण 5 में वर्णित निम्न के लिए जांच की गई। चित्रा 3 एक परिवर्तन प्लेट (अनुसूचित जाति-उनकी) और 5 FOA निम्नलिखित प्रतिकृति चढ़ाना अनुसूचित जाति-अपने प्लेटों से। उम्मीदवार के नमूने के उदाहरण के रूप में अच्छी तरह से वांछित के रूप में एकीकरण की घटनाओं का प्रतिनिधित्व करने की संभावना नहीं नमूने प्लेटों का एक उदाहरण दिखाता भी चित्रा 3 में प्रस्तुत कर रहे हैं । हमारे प्रयोग में, हम ~ 90,000 transformants जांच से बाहर बारह उम्मीदवार के नमूनों की पहचान की। इन उम्मीदवारों को तो शुद्ध थे प्रोटोकॉल के चरण 6 में वर्णित है।

बारह उम्मीदवारों तो पीसीआर विश्लेषण प्रोटोकॉल के 7 चरण में वर्णित है कि अगर वे उत्परिवर्ती पीसीआर उत्पादों के साथ URA3 जीन की प्रामाणिक प्रतिस्थापन परिलक्षित का आकलन करने के लिए किए गए थे। हमारे experimen के लिएटी, हम आगे एक प्राइमर कि पीसीआर उत्पाद के एकीकरण साइट और एक रिवर्स प्राइमर कि 302 आधार जोड़े पीसीआर उत्पाद के एकीकरण साइट से नीचे की ओर anneals से 89 आधार जोड़े अपस्ट्रीम anneals इस्तेमाल किया। यदि HHT2 ठिकाना HHT2 (या HHT2 के उत्परिवर्ती संस्करणों आधार जोड़ी प्रतिस्थापन को शरण देने), या आकार में 2188 आधार जोड़े की पीसीआर उत्पादों के कब्जे में है ये प्राइमरों आकार में 1217 आधार जोड़े की पीसीआर उत्पादों को उत्पन्न करता है, तो ठिकाना URA3 मार्कर जीन के कब्जे में है । 5 'GAAACTATTGGCACGCCCTA और रिवर्स प्राइमर की है कि (OAD477) का इस्तेमाल किया है:: 5' CCTGCGAATCAACCGATACT 3 'आगे प्राइमर के अनुक्रम (OAD476) प्रयोग किया जाता है। बारह उम्मीदवारों हम पहचान की थी में से चार को सही स्थान (एक उदाहरण के लिए चित्रा -4 ए देखें) पर एक पीसीआर उत्पाद के एकीकरण दिखाया। अंत में, के बाद से जीए उत्परिवर्तन के एजी एक नई पारिस्थितिकी आरआई प्रतिबंध साइट उत्पन्न करता है, हम पीसीआर उत्पादों सफल एकीकरण के नमूनों में से एक से एक के अधीन चित्र 4 बी)। इस विशेष मामले में हम पीसीआर उत्पादों अनुक्रम में नहीं आया कि यह सुनिश्चित करने के लिए अतिरिक्त अवांछित म्यूटेशन जीनोम में शामिल नहीं किया गया था: हालांकि, हम एक प्रक्रिया का इस्तेमाल किया है बहुत पिछले एक अध्ययन में 14 HHT2 म्यूटेशन की एक बड़ी संख्या उत्पन्न करने के लिए यह करने के लिए समान है, और पाया कि एकीकृत उत्परिवर्ती alleles के बहुमत वांछित लोगों की तुलना में अन्य कोई म्यूटेशन ले।

चित्र 2
चित्रा 2: पीसीआर उत्पादों को शरण देने की पीढ़ी खमीर जीनोम में वांछित एकता के लिए उत्परिवर्तनों। (ए) पीसीआर प्रतिक्रिया वांछित म्यूटेशन को शरण देने HHT2 के आंशिक रूप से अतिव्यापी टुकड़े उत्पन्न करते हैं। शीर्ष: टी के कार्टून प्रतिनिधित्ववह दो टुकड़े HHT2 प्राप्त करने के लिए दो पीसीआर प्रतिक्रियाओं (1 बी -1 चित्रा को देखें)। लाल हलकों जीन की भावना कतरा में एजी जीए को उत्परिवर्तन लागू करने के लिए इस्तेमाल किया प्राइमरों पर बेमेल न्यूक्लियोटाइड प्रतिनिधित्व करते हैं। नीचे: पीसीआर उत्पादों और बी (गलियों 2 और 3, क्रमशः) की जेल वैद्युतकणसंचलन विश्लेषण। डीएनए मानकों खमीर जीनोम में एकीकरण के लिए पूर्ण आकार पीसीआर उत्पाद उत्पन्न करने के लिए लेन 1. (बी) फ्यूजन पीसीआर प्रतिक्रिया में दिखाए जाते हैं (1 बी -2 और संदर्भ लें चित्र 3)। शीर्ष पर: पीसीआर प्रतिक्रिया के कार्टून प्रतिनिधित्व और पीसीआर उत्पाद (उत्पाद ग) की उम्मीद है। लाल हलकों उत्परिवर्तन से ऊपर (ए) में वर्णित के रूप में वांछित प्रतिनिधित्व करते हैं। नीचे: की पीसीआर उत्पादों जेल वैद्युतकणसंचलन विश्लेषण (2 लेन)। डीएनए मानकों लेन 1 में दिखाया जाता है यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।


चित्रा 3: सह-परिवर्तन प्रयोग और 5 FOA स्क्रीन से प्रतिनिधि परिणाम है। वाम: प्रतिनिधि अनुसूचित जाति-अपनी प्लेट 30C पर एक 3 दिन की ऊष्मायन के बाद सह-परिवर्तन प्रक्रिया के अधीन कोशिकाओं के साथ चढ़ाया। लगभग 5000 कॉलोनियों को गिना रहे थे। मध्य: प्रतिनिधि 5 FOA प्लेट 30C पर 2 दिन ऊष्मायन के बाद एक अनुसूचित जाति-अपने सह-परिवर्तन थाली से प्रतिकृति चढ़ाना के बाद। नमूने 1 और 2 उनकी विषम morphologies के कारण एक सफल एकीकरण घटना के माध्यम से चला गया के लिए उम्मीदवारों पर विचार किया गया। यह कॉलोनी है कि उस स्थान पर पैदा होगा क्योंकि hht2 एलील के साथ URA3 जीन के एक सच्चे प्रतिस्थापन (या बहुत जल्द ही बाद) से पहले होने की संभावना एक तब्दील सेल एससी-अपनी प्लेट पर चढ़ाया जाता है और एक परिणाम के रूप में है ज्यादातर, विशेष रूप से यदि नहीं, तो 5-FOA-resistan में शामिल होंगेटी कोशिकाओं - इस तरह के एक कॉलोनी फिर बाद में प्रतिकृति चढ़ाया 5 FOA प्लेट इसे कुचल दिया जाएगा करने के लिए, थाली पर कोशिकाओं के एक असममित दिखने पैच को जन्म दे रही है जब। इसके विपरीत, सहज URA3 जीन है कि कॉलोनी गठन के दौरान पैदा कर सकते हैं में म्यूटेशन अधिक एक कॉलोनी के एक छोटे से क्षेत्र के भीतर ही सीमित किए जाने की संभावना है, और इस प्रकार अधिक 5 FOA थाली करने के लिए जब प्रतिकृति चढ़ाया papillae को जन्म देने की संभावना है। अधिकार: 30 डिग्री सेल्सियस पर एक 3 दिन की ऊष्मायन के बाद एक अनुसूचित जाति-अपने सह-परिवर्तन थाली से प्रतिकृति चढ़ाना के बाद एक अलग प्रतिनिधि 5 FOA थाली। ऐसे papillae है, जो सबसे ऊष्मायन के 3 या अधिक दिनों के बाद स्पष्ट रूप से दिखाई दे रहे हैं, सहज URA3 म्यूटेशन और न प्रतिनिधित्व करने के लिए की संभावना है - एक अतिरिक्त उम्मीदवार (नमूना 3) के साथ-साथ दो छोटे papillae इस प्लेट (नमूने 4 और 5) पर दिखाई दे रहे हैं वांछित एकीकरण घटना। कृपया देखने के लिए यहां क्लिक करेंयह आंकड़ा का एक बड़ा संस्करण।

चित्रा 4
चित्रा 4: उम्मीदवार एकता नमूने की आण्विक विश्लेषण। (ए) पीसीआर परख सफल एकीकरण घटनाओं की पहचान करने के लिए। शीर्ष पर: जीनोम में hht2 उत्परिवर्ती एलील के सफल एकीकरण का आकलन करने के लिए इस्तेमाल पीसीआर प्रतिक्रियाओं के कार्टून अभ्यावेदन। नीचे: जीनोमिक डीएनए एक HHT2 जंगली प्रकार के तनाव से प्राप्त होता है (एक नियंत्रण के रूप में इस्तेमाल किया, 2 लेन), तनाव yAAD156 hht2Δ :: URA3 प्रतिस्थापन (एक नियंत्रण के रूप में इस्तेमाल किया, 3 लेन) को शरण देने का उपयोग करते हुए पीसीआर प्रतिक्रियाओं की जेल वैद्युतकणसंचलन विश्लेषण, एक उम्मीदवार एकीकरण नमूना (4 लेन), और एक 5 FOA प्रतिरोधी papillae नमूना (और इस तरह एक सही एकीकरण घटना का प्रतिनिधित्व करने की संभावना नहीं, लेन 5)। डीएनए मानकों में लेन 1. नोट दिखाए गए हैं कि उम्मीदवार एकीकरण नमूना के लिए पीसीआर उत्पादों के आकार consiste हैंएक सफल एकीकरण घटना के साथ NT, papillae नमूना के लिए पीसीआर उत्पादों के आकार के हैं, जबकि एक अक्षुण्ण hht2Δ :: URA3 लोकस के अनुरूप है। (बी) पारिस्थितिकी आरआई पाचन उत्परिवर्ती एलील की उपस्थिति की पुष्टि करने के लिए। शीर्ष: या तो जंगली प्रकार HHT2 जीन या उत्परिवर्ती hht2 एलील युक्त पीसीआर उत्पादों की एक पारिस्थितिकी आरआई पाचन प्रतिक्रिया से प्राप्त की उम्मीद पाचन टुकड़े के कार्टून प्रतिनिधित्व। नीचे: एक जंगली प्रकार HHT2 तनाव से निकाली गई पीसीआर उत्पादों के पाचन प्रतिक्रियाओं की जेल वैद्युतकणसंचलन विश्लेषण (2 लेन, यहां इस्तेमाल पैनल के 2 लेन में प्रयोग किया जाता है कि जैसे ही नमूना से प्राप्त किए गए पीसीआर उत्पादों) और एक उम्मीदवार एकीकरण नमूना ( 3 लेन, यहां इस्तेमाल के रूप में है कि पैनल की 4 लेन में प्रयोग किया जाता है) एक ही नमूना से प्राप्त किए गए पीसीआर उत्पादों। डीएनए मानकों में लेन 1. नोट दिखाए जाते हैं, पाचन पैटर्न पुष्टि करते हैं कि कि जीए उत्परिवर्तन के एजी सफलतापूर्वक उम्मीदवार के जीनोम में पेश कर दिया गया हैएकीकरण नमूना। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

दो गैर allelic जीन है कि अगुणित एस cerevisiae कोशिकाओं में चार मुख्य हिस्टोन प्रोटीन से प्रत्येक के लिए कोड जांचकर्ताओं जो विशेष रूप से mutagenesis के लिए दो जीनों में से एक लक्षित करना चाहते हैं के लिए एक चुनौती का प्रतिनिधित्व कर सकते हैं के बीच अनुक्रम अनुरूपता का उच्च स्तर है। इससे पहले खमीर mutagenesis के तरीके में वर्णित है, Delitto Perfetto, साइट विशेष जीनोमिक (एसएसजी) mutagenesis, और क्लोनिंग से मुक्त पीसीआर आधारित एलील प्रतिस्थापन तरीकों 5, 6, 7, साथ ही और अधिक हाल ही में खमीर CRISPR आधारित तकनीक 15 सहित, अक्सर भरोसा एक लक्ष्य जीन वांछित जीनोमिक साइट के लिए पुनर्संयोजन या मरम्मत मशीनरी की भर्ती करने की ओआरएफ के भीतर दृश्यों पर भाग में कम से कम अंत में अंतिम उत्परिवर्ती एलील उत्पन्न करते हैं। दूसरी ओर, रणनीति हम यहाँ प्रस्तुत किया है homologo ड्राइव करने के लिए लक्षित ओआरएफ flanking डीएनए दृश्यों का उपयोग करता हैहमें पुनर्संयोजन घटना उत्परिवर्तन के एकीकरण के लिए आवश्यक है, और, एक परिणाम के रूप में, और अधिक विशिष्ट अत्यधिक मुताबिक़ ORFs होने के बावजूद दो जीन एक अन्य पर एक जीन को निशाना बनाने की अनुमति देता है। यह सुविधा विशेष रूप से हमारी रणनीति हिस्टोन mutagenesis के लिए अच्छी तरह से अनुकूल बनाता है। हालांकि, इस रणनीति भी खमीर जीनोम में अन्य जीन की mutagenesis के लिए अनुकूलित किया जा सकता है।

हमारी रणनीति का अतिरिक्त सुविधाओं है कि तथ्यों क्षेत्रों है कि उत्परिवर्ती जीन के मुताबिक़ पुनर्संयोजन ड्राइव बनाया जा सकता है की लंबाई बहुत व्यापक हो सकता है, इस प्रकार लक्ष्य जीनोमिक स्थान पर एकीकरण की क्षमता बढ़ती है, और वांछित उत्परिवर्तन के अलावा है कि (शामिल रों ) कोई अतिरिक्त डीएनए दृश्यों जीनोम में पेश कर रहे हैं। इस प्रणाली का एक अतिरिक्त लाभ यह है कि एक बार एक तनाव URA3 के साथ एक विशेष हिस्टोन जीन के प्रतिस्थापन को शरण देने का निर्माण किया गया है, यह है कि विशेष रूप से इतिहास के किसी भी वांछित उत्परिवर्ती संस्करण की पीढ़ी के लिए इस्तेमाल किया जा सकता हैएक जीन। इस प्रकार, उदाहरण के लिए, तनाव yAAD156, जो अनुरोध पर अनुसंधान समुदाय के लिए उपलब्ध है, एक नए सिरे से hht2Δ :: URA3 एलील के निर्माण की आवश्यकता के बिना किसी भी वांछित hht2 उत्परिवर्तन बनाने के लिए इस्तेमाल किया जा सकता है। अंत में, अच्छी तरह से डिजाइन पीसीआर प्राइमरों का उपयोग करके, इस रणनीति भी आंतरिक विलोपन के साथ या एकाधिक कोडोन में परिवर्तन के साथ हिस्टोन alleles उत्पन्न करने के लिए, के रूप में लंबे समय के रूप में वे अपेक्षाकृत निकट एक दूसरे को (उदाहरण के लिए, हम एक hht2 एलील एक एन्कोडिंग जनरेट किया है इस्तेमाल किया जा सकता H3-K56R, L61W डबल उत्परिवर्ती प्रोटीन इस रणनीति का उपयोग)।

विशेष रूप से mutagenesis के लिए दो उच्च मुताबिक़ हिस्टोन जीनों में से एक लक्षित करने की क्षमता विभिन्न प्रयोगात्मक सेटिंग की संख्या में उपयोगी हो सकता है। उदाहरण के लिए, के बाद से HHT1-HHF1 जीन HHT2-HHF2 जीन 16 की तुलना में विभिन्न स्तरों पर व्यक्त कर रहे हैं, यह ब्याज की निर्धारित करने के लिए हो सकता है एक विशेष H3 या एच 4 उत्परिवर्तन di प्रदान कि क्यानिर्भर करता है fferent phenotypes जो जीन पर से व्यक्त किया जाता है। एक अन्य उदाहरण एक परिदृश्य में एक अन्वेषक दोनों इसी हिस्टोन जीन से एक विशेष हिस्टोन उत्परिवर्ती व्यक्त अगुणित कोशिकाओं को उत्पन्न करने की इच्छा है - यह पहले दो विभिन्न प्रकारों में स्वतंत्र रूप से प्रत्येक जीन mutagenizing, और फिर एक क्रॉस के माध्यम से डबल उत्परिवर्ती अगुणित कोशिकाओं को प्राप्त करने के द्वारा प्राप्त किया जा सकता है और वांछित meiotic उत्पादों के बाद अलगाव। अभी तक एक और उदाहरण histones H2A और H2B के mutagenesis से संबंधित है: तथ्य यह है कि प्रत्येक प्रोटीन की दो अलग isoforms इसी गैर allelic जीन सेट द्वारा इनकोड दिया, एक अन्वेषक एक विशिष्ट H2A या में H2B उत्परिवर्तन के प्रभाव का आकलन करने के लिए चाहते हो सकता है या तो isoform के संदर्भ। जब प्रयोगों को डिजाइन HTA1 और HTB1 लोकी mutagenize करने के लिए (H2A और H2B क्रमश: एन्कोडिंग), जांचकर्ताओं कि उपभेदों एक (hta1-htb1) ले जाने दिखा Δ हाल के निष्कर्षों के बारे में पता होना चाहिए व्यवहार्य हैं केवल मैंएफ वे HTA2-HTB2 ठिकाना (और आसपास के HHT1-HHF1 के रूप में अच्छी तरह ठिकाना) एक छोटे परिपत्र गुणसूत्र 17 की पीढ़ी के माध्यम से परिलक्षित है के रूप में इस परिणामों की व्याख्या उलझा सकता है।

हमने हाल ही में हिस्टोन H3 स्थिति 61 है, जो सामान्य रूप से अमीनो एसिड leucine 14 के कब्जे में है सब संभव एमिनो एसिड प्रतिस्थापन व्यक्त प्रोटीन उत्पन्न करने के लिए इस हिस्टोन म्युटाजेनेसिस रणनीति का एक संस्करण का इस्तेमाल किया है। उन प्रयोगों के लिए, बजाय yAAD156 mutagenesis के लिए शुरू तनाव के रूप में उपयोग कर के, हम तनाव yADP106 है, जो दोनों URA3 और TRP1 पोषण मार्कर (बजाय सिर्फ URA3 के) के साथ HHT2 ओआरएफ की एक स्थानापन्न के बंदरगाहों का इस्तेमाल किया। दोनों मार्कर जीन की उपस्थिति, 5-FOA स्क्रीन और शुद्धि कदम (चरण 5 और प्रोटोकॉल के 6) निम्नलिखित उत्परिवर्ती पीसीआर उत्पादों के एकीकरण के लिए उम्मीदवारों की पहचान में मदद की ऐसी candidat के रूप मेंहै, जबकि सहज URA3 उत्परिवर्तन एक यूरा के साथ कोशिकाओं में हुई - - और टीआरपी - तों phenotypically यूरा बन टीआरपी + फेनोटाइप। के रूप में URA3-TRP1 कैसेट, जो एक इकाई के रूप में परिलक्षित किया जा सकता है और रणनीति के साथ साथ वर्णित का उपयोग अन्य हिस्टोन जीन की mutagenesis के लिए प्रयोग किया जाता का दृश्य है yADP106, यह भी अनुरोध पर उपलब्ध है।

असमर्थता इस रणनीति का प्रयोग पूर्ण आकार पीसीआर एकीकरण कदम या सह-परिवर्तन कदम के बाद transformants की अपर्याप्त संख्या के लिए इस्तेमाल किया उत्पादों की अपर्याप्त राशि सहित संभावित कारणों की एक संख्या के कारण हो सकता है वांछित हिस्टोन म्यूटेंट प्राप्त करने के लिए। पूर्व समस्या, पीसीआर प्रतिक्रियाओं के एक साथ बड़ा सेट पूलिंग द्वारा या अलग प्राइमर सेट है कि उत्पाद के एक उच्च उपज का उत्पादन डिजाइन द्वारा संबोधित किया जा सकता है, जबकि बाद के समस्या के सह-परिवर्तन प्रयोग में रीढ़ की हड्डी प्लाज्मिड की अधिक मात्रा का उपयोग करके हल किया जा सकता है। हालांकिऊ, पहले संकेत के रूप में, एक इस प्रक्रिया के दो या दो से अधिक एमिनो एसिड प्रतिस्थापन को शरण देने हिस्टोन म्यूटेंट उत्पन्न करने के लिए उपयोग कर सकते हैं, लक्षित अमीनो एसिड अपेक्षाकृत के बाद से संबंधित कोडोन ही प्राइमर अणु के भीतर स्थित होने की जरूरत है एक दूसरे के करीब रहना होगा। इस प्रकार, इस रणनीति को आसानी से कई प्रोटीन की लंबाई भर में एक दूसरे से दूर स्थित परिवर्तन के साथ histones की पीढ़ी के लिए अनुकूलित नहीं किया जा सकता।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
लक्षित<em&gt; बगल में</emनवोदित खमीर में&gt; mutagenesis Histone के जीन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter