Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Mirata doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I quattro proteine ​​di base dell'istone H2A, H2B, H3, H4 e giocano un ruolo centrale nella compattazione, l'organizzazione e la funzione dei cromosomi eucariotiche. Due insiemi di ciascuna di tali istoni formano la ottamero istoni, un rocchetto molecolare che dirige l'avvolgimento ~ 147 paia di basi del DNA su se stessa, che si traduce nella formazione di un nucleosoma 1. I nucleosomi sono partecipanti attivi in ​​una varietà di processi cromosomiche-based, come ad esempio la regolazione della trascrizione genica e la formazione di eucromatina e heterochromatin tra cromosomi, e come tali sono stati al centro di un'intensa ricerca nel corso degli ultimi decenni. Un certo numero di meccanismi sono stati descritti da cui nucleosomi può essere manipolato in modi che possono facilitare l'esecuzione di processi specifici - Questi meccanismi comprendono modificazione post-traslazionale di residui degli istoni, rimodellamento nucleosomi ATP-dipendente, e la riorganizzazione nucleosomi ATP-indipendentee montaggio / smontaggio 2, 3.

Il lievito Saccharomyces cerevisiae erba è particolarmente potente organismo modello per la comprensione della funzione istone negli eucarioti. Questo può essere in gran parte attribuito all'elevato grado di conservazione evolutiva delle proteine istone tutto il eucarioti dominio e la riconducibilità di lievito ad una varietà di sperimentale genetico e biochimico approcci 4. approcci Reverse-genetici nel lievito sono stati ampiamente utilizzati per studiare gli effetti di specifiche mutazioni istoni su vari aspetti della biologia della cromatina. Per questi tipi di esperimenti è spesso preferibile utilizzare cellule in cui gli istoni mutanti sono espressi dal loro loci genomici nativa, come espressione da plasmidi autonome può portare a anormali livelli intracellulari di proteine ​​istoni (a causa di un numero variabile di plasmidi in cellule) e alterazione concomitante di cromatina environments, che alla fine possono confondere l'interpretazione dei risultati.

Qui, si descrive una tecnica PCR-based che consente di mutagenesi mirata di geni istone alle loro posizioni nativi genomiche che non richiede una fase di clonazione e risultati nella generazione della mutazione desiderata (s) senza rimanenti sequenze di DNA esogene nel genoma. Questa tecnica sfrutta l'efficiente sistema di ricombinazione omologa nel lievito e ha diverse caratteristiche in comune con altre tecniche simili sviluppati da altri gruppi - in particolare il Delitto Perfetto, genomica mutagenesi sito-specifica (SSG), e la clonazione senza PCR allele-based metodi sostitutivi 5, 6, 7. Tuttavia, la tecnica descriviamo ha un aspetto che lo rende particolarmente adatto per la mutagenesi dei geni istoni. In cellule di lievito aploidi, ciascuno dei quattro istoni nucleo è codificata da due non-ageni llelic e altamente omologhi: per esempio, l'istone H3 vengono codificati dai geni HHT1 e HHT2, e le fasi di lettura aperte (ORF) dei due geni sono oltre il 90% identica in sequenza. Questo elevato grado di omologia può complicare esperimenti progettati per indirizzare specificamente uno dei due geni istone-codifica per la mutagenesi. Considerando che i suddetti metodi richiedono spesso l'uso di almeno alcune sequenze all'interno della ORF del gene bersaglio di guidare ricombinazione omologa, la tecnica descriviamo qui fa uso di sequenze fiancheggianti le ORF dei geni istoni (che condividono molto meno omologia di sequenza) per la fase di ricombinazione, aumentando così la probabilità di successo di targeting mutagenesi al locus desiderata. Inoltre, le regioni omologhe che guidano la ricombinazione possono essere molto ampia, contribuendo ulteriormente alla efficiente ricombinazione omologa mirato.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

NOTA: La strategia sperimentale per mirata in situ mutagenesi gene istone comprende diversi passaggi (riassunti in Figura 1). Questi passaggi includono: (1) Sostituzione del gene bersaglio istone con il gene URA3, (2) Generazione e purificazione dei prodotti di PCR corrispondenti a due frammenti parzialmente sovrapposti del gene istone target usando primers della mutazione desiderata (s), (3 ) fusione PCR dei due frammenti parzialmente sovrapposti per ottenere pieni prodotti dimensione di PCR per l'integrazione, (4) Co-trasformazione dei prodotti di PCR a schermo intero e la spina dorsale plasmide, e la selezione per l'evidenziatore sulle plasmide, (5) dello schermo per 5-FOA-resistente trasformanti, (6) Purificazione di colonie 5-FOA-resistenti e perdita di backbone plasmide, e (7) Molecular analisi del dosaggio per la corretta integrazione del allele mutante.

Figura 1
in situ mutagenesi dei geni istoni in germogliamento lievito. In questo esempio il gene bersaglio è HHT2, ma qualsiasi altro gene nucleo istone può essere mutagenizzata usando questa strategia. (A) cellule di lievito aploidi porto due geni istone H3-encoding (HHT1 e HHT2) e due geni H4-codifica istone (HHF1 e HHF2) disposti come indicato in figura (i geni HHT1 e HHF1 si trovano sul cromosoma II e il HHT2 e geni HHF2 sono localizzati sul cromosoma XIV - in ogni caso, le frecce indicano la direzione di trascrizione). Nella prima fase della procedura, la ORF del gene HHT2 viene sostituito con il gene URA3, dando origine ad un ceppo hht2Δ :: URA3. (B) nella parte 1, una copia wild-type del gene HHT2 da un campione di DNA genomico viene utilizzato come modello per due reazioni PCR per generitE i due frammenti parzialmente sovrapposti del gene. Il primer inverso per la prima reazione comprende uno o più corrispondenti nucleotidi (indicati con un cerchio rosso) che corrispondono alla mutazione desiderata (s) da introdurre nel genoma. Il primer forward per la seconda reazione ha il disadattamento equivalente in una configurazione complementare inverso (anche indicato con un cerchio rosso). I due prodotti PCR generati nella parte 1 (prodotti A e B) vengono poi utilizzati come modelli per fusione PCR utilizzando due primer che ricottura per prodotti A e B nel modo mostrato nella parte 2. Ciò comporta la generazione di full-size PCR prodotti (prodotto C nella parte 3) che ospitano la mutazione desiderata (s). (C) La hht2Δ :: ceppo URA3 è poi co-trasformate con i prodotti di PCR in grandezza e un plasmide dorsale (a HIS3- contrassegnati plasmide in questo esempio), e le cellule vengono selezionate per la presenza del plasmide (su supporti privi histidina in questo esempio). I trasformanti sono poi sottoposti a screening per 5-FOA resistenza - cellule resistenti sono candidati che hanno subito un evento di ricombinazione omologa giungere all'integrazione del prodotto PCR e escissione del gene URA3, come mostrato. perdita successiva del plasmide spina dorsale per divisione cellulare mitotica conduce al istone desiderato ceppo mutante finale. Abbiamo trovato che la selezione del plasmide backbone seguita da screening per risultati di resistenza 5-FOA in una frequenza molto più elevata di identificazione di eventi di integrazione corretti rispetto alla selezione diretta su piastre 5-FOA, che identifica lo più cellule che hanno acquisito mutazioni URA3 spontanee. (Questa cifra è stata modificata dal riferimento 14). Clicca qui per vedere una versione più grande di questa figura.

1. Sostituzione del target istone Gene con la URA3Gene

  1. Eseguire la PCR standard-mediata one-step gene distruzione di sostituire la ORF di gene istone bersaglio con il gene URA3 8, 9.
    NOTA: L'uso di cellule di lievito che trasportano il ura3Δ0 è raccomandato come questa mutazione rimuove l'intero endogena URA3 ORF, evitando così l'integrazione del prodotto della PCR nella URA3 locus 8. In alternativa, il gene URA3 lactis K. può essere efficacemente utilizzato per la generazione di sostituzione istone in qualsiasi sfondo URA3 come è funzionale in S. cerevisiae ma ha solo omologia di sequenza parziale del gene URA3 di S. cerevisiae. Il ceppo deve essere auxotrophic per almeno un composto che permetterà la selezione del plasmide backbone nell'esperimento trasformazione (vedi punto 4 di questo protocollo). Questo passaggio non è necessario se un obiettivo istoni geneΔ :: URA3ceppo è già disponibile.

2. Generazione e purificazione dei prodotti di PCR corrispondente a due frammenti parzialmente sovrapposte del target istone Gene utilizzando primer della mutazione desiderata (s)

  1. Generare prodotti di PCR corrispondenti a due frammenti parzialmente sovrapposte del gene bersaglio istone.
    1. Preparare due reazioni di PCR come segue:
      1. Per generare prodotti di PCR corrispondenti alla prima metà del gene (prodotto a in Figura 1B), impostare la seguente reazione: 1 ml DNA stampo, 5 μl10 micron primer forward, 5 μl10 micron primer reverse, 0,5 ml (1,25 U) termostabile DNA polimerasi, 10 microlitri 5x DNA polimerasi di buffer, 5 ul miscela dNTP (2 mm ciascuno), e 23,5 ml dH 2 O.
        NOTA: Il DNA modello può essere DNA genomico derivato da un ceppo wild-type per il gene bersaglio istone isolato utilizzando pro di serieprocedure 10. Per tenere conto di variazioni della concentrazione di DNA e il livello di impurità in diverse preparazioni genomiche, si raccomanda di ottimizzare le reazioni usando o DNA diluito o diverse diluizioni delle preparazioni genomici (ad esempio, 1:10 a 1: 100). Il primer forward dovrebbe ricottura ad una regione a monte del gene bersaglio. Il primer inverso dovrebbe ricottura all'interno della ORF, essere ~ 40 nucleotidi di lunghezza, e contiene la mutazione (s) desiderato da qualche parte nel mezzo di esso (vedi Figura 1B-1 e Rappresentante dei risultati sezione per gli esempi). L'uso di una DNA polimerasi alta fedeltà è raccomandato per ridurre i tassi di mutazioni indesiderate durante la sintesi dei prodotti di PCR.
      2. Per generare prodotti di PCR corrispondenti alla seconda metà del gene (prodotto b nella Figura 1B), impostare una reazione come indicato in 2.1.1.1 ma con differenti primers.
        NOTA: il PRI in avantimer dovrebbe ricottura all'interno della ORF, essere ~ 40 nucleotidi di lunghezza, e contiene la mutazione desiderata (s) da qualche parte nel mezzo di esso. Si noti che la mutazione (s) in questo primer è il complemento inverso della mutazione (s) in reverse primer nel passaggio 2.1.1.1. Il primer inverso deve ricottura ad una regione a valle del gene bersaglio (vedere Figura 1B-1 e Risultati rappresentativi sezione per gli esempi).
    2. Mettere le reazioni in un termociclatore con le seguenti impostazioni: 94 C 30 sec; 30 cicli delle seguenti impostazioni: 98 C 10 sec, 60 ° C 5 sec, 72 c 1,5 min; e 72 c 10 min.
      Nota: L'ottimizzazione dei parametri di PCR può essere richiesto per i set di primer specifici e bersaglio gene istone.
  2. Eseguire 20 - 50 ml di materiale dalle reazioni di PCR su un gel di fusione basso punto di agarosio 0,9% a 89 mm di base Tris, 89 mM di acido borico, 2,5 mM EDTA (TBE) buffer.
  3. sezioni gel agarosio Tagliare contenenti il ​​pr PCRodotti da gel utilizzando un bisturi o lametta pulito e trasferire ciascuna in una provetta da 1,5 ml microcentrifuga. Conservare sezioni agarosio contenenti prodotti di PCR a -20 ˚C fino al momento dell'uso.

3. Fusion PCR dei due frammenti parzialmente sovrapposte ottenere Full Size prodotti di PCR per l'integrazione

  1. Preparare modello per le reazioni PCR
    1. Sciogliere sezioni gel agarosio dal punto 2.3, ponendo le provette da microcentrifuga in un blocco set di calore a 65 ° C per 5 minuti (o fino a quando completamente sciolto). Tubi vortex ogni 1 - 2 min per facilitare il processo di fusione.
    2. Trasferire una certa quantità di fuso agarosio da ciascun campione (ad esempio, 50 ml ciascuno, per un totale di 100 ml) in un unico provetta e mescolare nel vortex. Utilizzare questo come il modello nelle reazioni PCR di fusione. Posizionare il tubo a -20 ˚C fino al momento dell'uso.
  2. Amplificare una grande quantità di piena prodotto di PCR (prodotto cin figura 1B)
    1. Impostare sei reazioni PCR, ognuno con i seguenti componenti: 2 ml modello di DNA, 10 microlitri 10 micron di primer in avanti, 10 microlitri 10 micron di primer inverso, 1 ml (2,5 U) termostabile DNA polimerasi, 20 l 5x tampone DNA polimerasi, 10 ml miscela dNTP (2 mm ciascuno) e 47 ml dH 2 O.
      NOTA: Il numero di reazioni può essere modificato a seconda dell'efficienza PCR. Il DNA stampo (vedi 3.1.2), dovrebbe essere riscaldato a 65 ° C fino a fuso, mescolate con il vortex, e ha aggiunto infine alla miscela di reazione PCR. Una volta aggiunto, mescolare delicatamente ma accuratamente pipettando la soluzione su e giù parecchie volte. Per tenere conto di variazioni della concentrazione di DNA nei diversi campioni, si raccomanda di ottimizzare prima delle reazioni utilizzando template diluito o differenti diluizioni del modello (ad esempio, 1:10 a 1: 100). I due primer utilizzati dovrebbero temprare ai due frammenti parzialmente sovrapposte del gene bersaglio come malatiustrated in Figura 1B-2 ed essere progettato in modo tale che i prodotti di PCR finali avranno almeno 40 paia di basi su entrambi i lati omologhi alle regioni fiancheggianti il URA3 ORF che guideranno la fase di ricombinazione omologa (vedere la sezione Risultati rappresentativi per gli esempi). L'uso di una DNA polimerasi alta fedeltà è raccomandato per ridurre i tassi di mutazioni indesiderate durante la sintesi dei prodotti di PCR.
    2. Mettere le provette in un termociclatore con le seguenti impostazioni: 94 C 30 sec; 30 cicli delle seguenti impostazioni: 98 C 10 sec, 50 C 15 sec, 72 c 1,5 min; e 72 c 10 min.
      NOTA: può essere richiesta l'ottimizzazione dei parametri di PCR per i set di primer specifici e gene bersaglio istone.

4. Co-trasformazione di Full Size prodotti di PCR e la spina dorsale plasmidi e selezione per Marker su plasmidi

  1. Concentrazione di prodotti di PCR
    1. Si riuniscono gli sReazioni ix PCR (600 ml totali) dal punto 3.2.2 in un unico provetta e mescolare nel vortex.
    2. Suddividere il campione in tre aliquote di 200 microlitri in tubi microcentrifuga. Precipitare il DNA in ciascun tubo aggiungendo 20 ml di sodio acetato 3M (pH 5,2) e 550 ml di etanolo al 100%. Mescolare la soluzione a fondo e mettere in ghiaccio per almeno 15 minuti. Raccogliere DNA per centrifugazione a circa 14000 xg per 10 minuti, lavare il pellet con 200 ml di etanolo al 70%, e aria secca.
    3. Risospendere ogni pellet di DNA in 25 ml di dH 2 O, e concentrare in un unico tubo (per un totale di 75 microlitri).
  2. Lievito co-trasformazione
    1. Preparare 10 ml di cultura durante la notte del ceppo generato nella sezione 1 di estratto di lievito Peptone destrosio (YPD) liquido di mezzo 11.
    2. La mattina seguente, inoculare 400 ml di YPD mezzo liquido con 8 ml di cultura durante la notte saturi e incubare agitandoa 30 ° C per 4 - 5 h per permettere alle cellule di entrare fase logaritmica di crescita.
    3. Raccogliere le cellule per centrifugazione a ~ 3.220 xg per 10 min, scartare il mezzo liquido, e risospendere le cellule in 1 volume di 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 soluzione M di litio acetato (TE / liac) .
    4. Raccogliere le cellule per centrifugazione a ~ 3.220 xg per 10 min, e scartare il TE / LIAC.
    5. Risospendere le cellule in 1 ml TE / LIAC.
    6. Impostare il seguente cocktail di reazione in una provetta: 800 ml di cellule dal punto 4.2.5, 40 ml di bollito / ml salmone DNA dello sperma di 10 mg, per un totale di 12,5 mg di spina dorsale DNA plasmide, e 75 ml di prodotto di PCR concentrato dal punto 4.1.3.
      NOTA: Salmon DNA di sperma deve essere bollita per 5 min e posto in ghiaccio per almeno 5 minuti prima dell'uso nella reazione. Il volume totale di backbone plasmide DNA aggiunto deve essere ridotto al minimo (~ 80 microlitri o meno). Vedere la sezione Risultati Rappresentante per un esempio di un plasma spina dorsaleid.
    7. Mescolare il tubo di cocktail a fondo e in modo uniforme aliquota in otto microprovette (Tubi 1-8).
    8. Impostare i seguenti due provette di reazione di trasformazione di controllo:
      1. Tubo 9 (senza controllo del prodotto PCR): 100 ml di cellule dal punto 4.2.5, 5 ml di bollito / ml sperma di salmone DNA 10 mg (bollite per 5 min; vedere il punto 4.2.6 Nota), per un totale di 1,56 mg di backbone plasmide DNA e nessun prodotto di PCR aggiunte.
      2. Tubo 10 (nessun controllo DNA): 100 ml di cellule dal punto 4.2.5, 5 ml di bollito 10 mg / mL di sperma di salmone DNA (vedi punto 4.2.6 Nota), senza spina dorsale plasmide aggiunto il DNA, e nessun prodotto di PCR aggiunto.
      3. Mescolare entrambi i tubi delicatamente ma accuratamente pipettando su e giù parecchie volte.
    9. Incubare le dieci provette a 30 C per 30 min.
    10. Per ogni tubo, aggiungere 1,2 ml di 40% polietilene glicole (PEG 3350) in TE / LIAC. Mescolare accuratamente con una pipetta P-1000 fino a che la soluzione risulti omogenea.
    11. Incubare le dieci provette a 30° C per 30 min. Mescolare delicatamente la soluzione pipettando su e giù e poi incubare le provette a 42 ° C per 15 min.
    12. Raccogliere le cellule facendo girare i tubi in microcentrifuga a ~ 14000 g per 30 sec. Eliminare il liquido e risospendere le cellule in 1 ml di dH sterile 2 O.
    13. Raccogliere le cellule facendo girare i tubi in microcentrifuga a ~ 14000 g per 30 sec. Eliminare il liquido e risospendere le cellule in 500 ml di dH sterili 2 O.
    14. tubi Pool 1-8 insieme (volume totale di 4 ml) e mescolare bene pipettando su e giù.
    15. Piatto 200 microlitri della miscela di cui sopra su ciascuno dei venti completi minima dropout piastre di terreno 11 (piastre 1-20) per la selezione del plasmide backbone.
    16. Piastra 200 ml di miscela da tubo 9 e 200 ml di miscela dalla fermata della 10 ciascuno sul proprio piatto di selezione (piatti, rispettivamente, 21 e 22,).
    17. Incubare le piastre a 22 30 ° C per 3 - 5 giorni aselezionare per trasformanti plasmidi.
    18. Ispezionare le piastre di trasformazione dopo 3 - 5 giorni di incubazione. Circa 5.000 colonie dovrebbero essere visibili su piastre 1-21 (vedi Rappresentante dei risultati per un esempio) e non colonie dovrebbero essere presenti sulla piastra 22.

5. schermo per trasformanti 5-FOA-resistenti

  1. Trasferire le cellule da lastre 1 - 20 (e la piastra di trasformazione 21 come controllo) a 5-fluoroorotic acido (5-FOA) piastre 11 dalla replica-plating 12 per lo screening per la perdita del gene URA3 come risultato dell'integrazione della prodotti di PCR nella posizione desiderata.
    1. Togliere il coperchio piatto e premere il piatto contenente colonie su un velluto sterile. Trasferire le cellule dal velluto per una piastra 5-FOA premendo la piastra sul velluto. Incubare le piastre a 30 C per 2 giorni.
  2. Dopo l'incubazione di 2 giorni, ispezionare accuratamente le lastre 5-FOA per growth.
    NOTA: Un evento di integrazione candidato sarà rappresentato da un piccolo asimmetrica colonia "schiacciata" su una piastra 5-FOA - converso, piccole papille cresce su piastre 5-FOA probabilmente rappresentativi di mutazioni URA3 spontanee sollevata durante la crescita di colonie sulla piastre di trasformazione, e sono quindi difficilmente riescono a rappresentare l'evento di integrazione desiderato (vedere Figura 3 nella sezione Risultati rappresentativi per ulteriori elaborazioni su questo punto e per alcuni esempi).

6. Purificazione di colonie 5-FOA-resistenti e la perdita di Backbone plasmidi

  1. Utilizzando stuzzicadenti sterile, raccogliere le colonie candidati dalle piastre 5-FOA descritte al punto 5.2 e strisciare per singole colonie su piastre YPD. Incubare per 2 - 3 giorni a 30 ° C.
  2. Dopo l'incubazione, replica - Piastra ogni purificazione piatto YPD per un piatto fresco YPD, una piastra di drop-out manca uracile per verificare la presenza di perditedel gene URA3, ed una seconda piastra drop-out per monitorare la presenza o l'assenza del plasmide backbone. Incubare per 1 - 2 giorni a 30 ° C.
  3. Dopo l'incubazione, identificare una colonia di ciascun campione candidato che cresce sulla piastra YPD ma non cresce su entrambi piatto drop-out (questo tipo di colonie dovrebbe aver perso il gene URA3 attraverso l'evento di ricombinazione e perso il plasmide backbone durante mitotica divisione cellulare). Restreak tali colonie su piastre freschi YPD. Queste colonie sono i candidati di integrazione e saranno analizzati ulteriormente al punto 7.

7. Le analisi molecolari per test per l'integrazione corretta of the Mutant Allele

  1. Isolare il DNA genomico da campioni candidati utilizzando le procedure standard 10.
  2. Amplificare regione genomica che comprende il sito di destinazione.
    1. Impostare la seguente reazione PCR per ciascun campione: 0,5 ml modello di DNA, 5 ml10 micron di primer in avanti, 5 ml 10 micron di primer inverso, 0,5 ml (2,5 unità) Taq DNA polimerasi, 5 ml 10x Taq DNA polimerasi tampone, 5 ul miscela dNTP (2 mm ciascuno) e 29 ml dH 2 O.
      NOTA: Modello del DNA è il DNA genomico derivato dai campioni candidati. Si raccomanda di includere anche due reazioni di controllo: uno utilizzando DNA genomico derivato dalle geneΔ istone originali :: URA3 ceppo come modello e un altro utilizzando DNA genomico da un ceppo selvatico istone come modello. Per tenere conto di variazioni della concentrazione di DNA e il livello di impurità in diverse preparazioni genomiche, si raccomanda di ottimizzare le reazioni usando o DNA diluito o diverse diluizioni delle preparazioni genomici (ad esempio, 1:10 a 1: 100). È importante assicurarsi che questi primer ricottura a sequenze di DNA di fuori della regione abbracciata dal prodotto putativamente integrato PCR - questo modo, la dimensione dei prodotti di PCR in questi reactions possono essere utilizzati come strumento diagnostico per l'integrazione dei prodotti nella posizione genomica corretta (vedi Risultati rappresentativi per esempio).
    2. Mettere le reazioni in un termociclatore con le seguenti impostazioni: 94 ° C 3 min; 30 cicli delle seguenti impostazioni: 94 ° C 45 sec, 50 ° C 45 sec, 72 ° C 2 min; e 72 ° C 10 min.
      NOTA: può essere richiesta l'ottimizzazione dei parametri di PCR per i set di primer specifici e gene bersaglio istone.
  3. Lavorazione dei prodotti di PCR
    1. Eseguire 20 microlitri da ogni reazione su un gel di agarosio 0,8% TBE.
    2. Valutare il formato dei prodotti PCR utilizzando standard DNA come riferimento per determinare se il gene URA3 è stato sostituito con successo dal gene mutato istone putativamente (vedi Risultati rappresentativi per esempio).
      NOTA: In alcuni casi, la mutazione desiderata (s) introdotto nei geni istone creare o distruggere una restrizione sedersie. Se questo è il caso, la presenza della mutazione desiderata nei prodotti di PCR di dimensioni indicative della corretta integrazione può essere valutata sottoponendo i prodotti di digestione con l'enzima di restrizione corrispondente seguita da analisi elettroforesi su gel (vedi Risultati rappresentativi per esempio) .
    3. Oggetto prodotti PCR di dimensioni indicative della corretta integrazione del sequenziamento del DNA per confermare la presenza della mutazione desiderata (s) e di assicurare che nessun ulteriori mutazioni sono state introdotte nel genoma.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Descriviamo la generazione di un allele hht2 esprimere un istone H3 mutante proteina ospitare una sostituzione nella posizione 53 da un arginina ad acido glutammico (H3-R53E mutante) come un esempio rappresentativo della mirata strategia situ mutagenesi.

Abbiamo generato un ceppo in cui l'intera ORF di HHT2 è sostituito dal gene URA3 (vedi punto 1 del protocollo). Questo ceppo, yAAD156, ospita anche un allele his3Δ200, che fa sì che le cellule da auxotrophic per istidina. Seguendo la procedura indicata al punto 2 del protocollo, abbiamo poi generato i due frammenti parzialmente sovrapposti di HHT2. I seguenti primer sono stati utilizzati per il primo frammento: Forward Primer (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' e il Reverse Primer (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. Il seguente prIMers sono stati utilizzati per il secondo frammento: Forward Primer (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' e il Reverse Primer (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Si noti che il Reverse Primer nella prima reazione e la Forward Primer nella seconda reazione contengono i nucleotidi desiderati mutato (in minuscolo) - questi nucleotidi mutati sono immerso tra due lunghi tratti di sequenze wild-type, in quanto ciò permette di ricottura efficiente del primer al DNA stampo nonostante la mancata corrispondenza nelle posizioni mutati. Si noti inoltre che i nucleotidi mutati in queste due primer sono complementari inverso tra loro e causano un AG GA mutazione nel filamento senso, che si traduce in un AGA per GAA cambiamento codone, che alla fine produce la mutazione R53E nella proteina codificata. I risultati di queste reazioni PCR sono mostrati nella Figura 2A.

Utilizzando la procedura al punto 3, abbiamo poi Gener ated i prodotti di PCR full-size. I primer utilizzati sono stati Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'e Reverse Primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Nel progettare questi primer, è importante accertarsi che la fusione PCR prodotti risultanti comprendono almeno 40 coppie di base su entrambi i lati per guidare la reazione di ricombinazione omologa (il più le regioni di omologia, più efficienti e specifici eventi di ricombinazione omologa sarà essere). Nel nostro esperimento, i prodotti di PCR in grandezza contenevano una regione di 195 paia di basi e 220 paia di basi regione omologa alle regioni a monte ea valle del HHT2 ORF rispettivamente. Un campione di questi prodotti di PCR è stato analizzato mediante elettroforesi su gel di agarosio (Figura 2B).

I prodotti di PCR full-size sono stati poi co-trasformato con il plasmide pRS413 (un centromerico, HIS3- segnato plasmidef "> 13) e trasformanti sono stati selezionati su piastre prive di istidina (SC-le sue piastre), come descritto al punto 4 del protocollo. Le sue colonie + sono stati poi sottoposti a screening per la resistenza 5-FOA seguendo le procedure descritte al punto 5 del protocollo. la Figura 3 mostra un esempio di una piastra di trasformazione (SC-his) e 5-FOA piastre seguenti replica-plating da SC-suoi piatti. Esempi di campioni candidati e campioni improbabili per rappresentare gli eventi di integrazione desiderati vengono anche presentati nella figura 3 . nel nostro esperimento, abbiamo identificato dodici campioni candidati di ~ 90.000 trasformanti schermati. Questi candidati sono stati quindi purificati come descritto al punto 6 del protocollo.

I dodici candidati sono stati poi sottoposti ad analisi PCR descritto al punto 7 del protocollo per valutare se riflettono le sostituzioni autentici del gene URA3 con prodotti di PCR mutanti. Per i nostri experiment, abbiamo utilizzato un primer forward che annealing 89 coppie di basi a monte del sito di integrazione del prodotto PCR e un Reverse Primer che annealing 302 coppie di basi a valle del sito di integrazione del prodotto PCR. Questi primer generano prodotti di PCR di 1217 coppie di basi di dimensione se il locus HHT2 è occupato da HHT2 (o versioni mutate di HHT2 ospitano coppie di basi sostituzioni), o prodotti di PCR di 2188 coppie di basi di dimensione se il locus è occupata dal gene marcatore URA3 . La sequenza del Forward Primer utilizzato (OAD476) è: 5 'GAAACTATTGGCACGCCCTA e quella del Reverse Primer utilizzato (OAD477) è: 5' CCTGCGAATCAACCGATACT 3 '. Dei dodici candidati che avevamo individuate, quattro hanno dimostrato l'integrazione di un prodotto di PCR nella posizione corretta (si veda la Figura 4A per un esempio). Infine, poiché l'AG GA mutazione genera un nuovo sito di restrizione Eco RI, abbiamo sottoposto prodotti di PCR di uno dei campioni di integrazione di successo a un Figura 4B). In questo caso particolare, non abbiamo sequenziamento prodotti di PCR per garantire che ulteriori mutazioni indesiderate non erano stati incorporati nel genoma: tuttavia, abbiamo utilizzato una procedura molto simile a questo per generare un gran numero di mutazioni HHT2 in uno studio passati 14, e ha scoperto che la maggior parte degli alleli mutanti integrati portano mutazioni diverse da quelle desiderate.

figura 2
Figura 2: Generazione di prodotti di PCR presentano mutazioni per l'integrazione desiderato nel genoma del lievito. Reazione (A) PCR per generare i frammenti parzialmente sovrapposti di HHT2 harboring mutazioni desiderati. Rappresentazione cartone animato di t: Topha due reazioni PCR per ottenere i due HHT2 frammenti (Figura 1B-1). cerchi rossi rappresentano i nucleotidi corrispondenti sui primers utilizzati per introdurre l'AG GA mutazione nel filamento senso del gene. In basso: gel elettroforesi analisi di PCR prodotti A e B (corsie rispettivamente 2 e 3,). Standard di DNA sono mostrati in corsia 1. (B) reazione Fusion PCR per generare formato del prodotto intero PCR per l'integrazione nel genoma di lievito (fare riferimento alla Figura 1B-2 e 3). Top: Rappresentazione cartone animato della reazione PCR e atteso prodotto di PCR (prodotto C). cerchi rossi rappresentano desiderato mutazione come descritto in (A) di cui sopra. In basso: gel elettroforesi analisi dei prodotti della PCR c (corsia 2). Standard del DNA sono indicati nella corsia 1. Clicca qui per vedere una versione più grande di questa figura.


Figura 3: Risultati Rappresentante dall'esperimento Co-trasformazione e schermo da 5 FOA. A sinistra: rappresentante SC-suo piatto placcato con le cellule sottoposte alla procedura di co-trasformazione dopo una incubazione di 3 giorni a 30 ° C. Circa 5.000 le colonie sono state contate. Medio: rappresentante piatto 5-FOA seguente replica-placcatura da una piastra di SC-suo co-trasformazione dopo una incubazione di 2 giorni a 30 ° C. I campioni 1 e 2 sono stati considerati candidati per aver attraversato un evento di integrazione di successo a causa delle loro morfologie asimmetriche. Questo perché un vero sostituzione del gene URA3 con l'allele hht2 è probabile che si verifichi prima (o subito dopo) una cellula trasformata è placcato sul SC-piatto e, di conseguenza, la colonia che sorgerà in quella posizione conterrà per lo più, se non esclusivamente, 5-FOA-resistancellule t - quando tale colonia è successivamente replica placcato ad una piastra 5-FOA sarà schiacciato, dando luogo ad una patch asimmetrica dall'aspetto delle cellule sulla piastra. Al contrario, spontanea mutazioni nel gene URA3 che possono sorgere durante la formazione di colonie hanno maggiori probabilità di essere confinata in una piccola regione di una colonia, e quindi più probabilità di dare origine a papille quando replica placcato di una piastra 5-FOA. A destra: un rappresentante 5-FOA piastra diversa seguente replica-plating da una piastra SC-suo co-trasformazione dopo una incubazione di 3 giorni a 30 ° C. Un candidato supplementare (campione 3), così come due piccole papille sono visibili su questa piastra (campioni 4 e 5) - come papille, che sono più chiaramente visibili dopo 3 o più giorni di incubazione, sono suscettibili di rappresentare mutazioni URA3 spontanee e non l'evento di integrazione desiderato. Clicca qui per vedereuna versione più grande di questa figura.

Figura 4
Figura 4: Analisi molecolari di campioni di integrazione Candidate. Saggio (A) PCR per identificare eventi di integrazione di successo. Rappresentazioni dei cartoni animati delle reazioni PCR utilizzati per valutare riuscita integrazione della allele mutante hht2 nel genoma: Top. In basso: gel elettroforesi analisi delle reazioni PCR utilizzando DNA genomico derivato da un ceppo selvatico HHT2 (utilizzato come controllo, corsia 2), ceppo yAAD156 ospitare la sostituzione hht2Δ :: URA3 (utilizzato come controllo, corsia 3), un candidato campione integrazione (corsia 4), ed un campione papille 5-FOA-resistenti (e quindi improbabile che rappresenti un evento di integrazione corretta, corsia 5). standard del DNA sono indicati nella corsia 1. Si noti che le dimensioni dei prodotti di PCR per il campione di integrazione candidato sono Consistent con un evento di integrazione riuscita, mentre la dimensione dei prodotti di PCR per il campione papille è coerente con una intatta locus hht2Δ :: URA3. (B) Eco RI digestione per confermare la presenza di allele mutante. Top: Rappresentazione dei cartoni animati dei frammenti di digestione attesi derivanti da una reazione di digestione Eco RI di prodotti di PCR che contengono sia la wild-type HHT2 gene o allele mutante hht2. In basso: gel di analisi elettroforesi delle reazioni digestione dei prodotti di PCR derivati da una wild-type HHT2 ceppo (corsia 2; i prodotti di PCR usati qui sono stati ricavati dallo stesso campione di quello usato in corsia 2 del pannello A) e un campione di integrazione candidato ( corsia 3, i prodotti PCR usati qui sono stati ottenuti dallo stesso campione come quello utilizzato in corsia 4 del pannello a). standard di DNA sono indicati nella corsia 1. Si noti che i modelli di digestione confermano che l'AG GA mutazione è stata introdotta con successo nel genoma del candidatocampione di integrazione. Clicca qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'elevata omologia di sequenza tra due geni non alleliche che codificano ciascuno dei quattro proteine essenziali istoniche delle cellule S. cerevisiae aploidi possa rappresentare sfida per investigatori vogliano indirizzare specificamente uno dei due geni per mutagenesi. In precedenza descritto lievito metodologie di mutagenesi, compreso il Delitto Perfetto, genomica mutagenesi sito-specifica (SSG), e PCR-based metodi pezzi allele-free clonazione 5, 6, 7, così come le tecniche CRISPR basata più recente di lievito 15, spesso si basano almeno in parte su sequenze all'interno della ORF di un gene bersaglio di reclutare i macchinari ricombinazione o riparazione al sito genomico desiderato casualmente per generare l'allele mutante finale. D'altra parte, la strategia che abbiamo qui presentato fa uso di sequenze di DNA che fiancheggiano la ORF mirata a guidare il homologoci evento di ricombinazione necessaria per l'integrazione della mutazione, e, di conseguenza, consente una più specifica destinazione di un gene rispetto ad un altro, nonostante i due geni aventi ORF altamente omologhi. Questa caratteristica rende la nostra strategia particolarmente adatto per istone mutagenesi. Tuttavia, questa strategia può anche essere adattato per mutagenesi di altri geni nel genoma del lievito.

Altre caratteristiche della strategia comprendono i fatti che le lunghezze delle regioni che guidano ricombinazione omologa dei geni mutanti possono essere progettati per essere molto ampia, aumentando così l'efficienza di integrazione nella posizione genomica di destinazione, e che oltre la mutazione desiderata (s ) nessuna sequenze di DNA aggiuntivi vengono introdotti nel genoma. Un ulteriore vantaggio di questo sistema è che una volta che un ceppo ospitare sostituzione di un gene specifico con istone URA3 è stato costruito, esso può essere utilizzato per la generazione di qualsiasi versione mutante desiderato di quel particolare histun gene. Così, ad esempio, ceppo yAAD156, che è disponibile per la comunità di ricerca, su richiesta, può essere usato per fare qualsiasi mutazione hht2 desiderato, senza la necessità di costruire una de novo hht2Δ :: URA3 allele. Infine, utilizzando primer PCR correttamente progettati, questa strategia può anche essere usato per generare alleli istoni con delezioni interne o con mutazioni a più codoni, purché sono relativamente vicine tra loro (per esempio, abbiamo generato un allele hht2 codifica di un H3-K56R, L61W doppio mutante proteina usando questa strategia).

La capacità di indirizzare specificamente uno dei due geni istoni altamente omologhi per mutagenesi può essere utile in diverse impostazioni sperimentali. Ad esempio, dal momento che i geni HHT1-HHF1 sono espressi a livelli diversi rispetto ai geni HHT2-HHF2 16, che potrebbe essere di interesse per determinare se un particolare H3 o H4 mutazione conferisce difenotipi fferent a seconda di quale gene si esprime da. Un altro esempio è uno scenario in cui un investigatore desidera generare cellule aploidi esprimenti un particolare mutante istone da entrambi i corrispondenti geni istoni - ciò potrebbe essere ottenuto prima mutagenizing ciascun gene indipendentemente in due ceppi diversi, e quindi ottenendo doppie cellule aploidi mutanti attraverso una croce e successivo isolamento dei prodotti meiotici desiderati. Ancora un altro esempio si riferisce alla mutagenesi degli istoni H2A e H2B: in considerazione del fatto che due leggermente diverse isoforme di ogni proteina sono codificati dal set gene non-allelica corrispondente, un investigatore può essere utile per valutare gli effetti di un H2A specifico o H2B mutazione in contesto di una isoforma. Durante la progettazione di esperimenti per la mutagenize HTA1 e HTB1 loci (codifica rispettivamente H2A e H2B,), gli investigatori devono essere consapevoli delle recenti scoperte mostrano che i ceppi che trasporta un (hta1-HTB1) Δ sono vitali solo iof hanno amplificato il locus HTA2-HTB2 (e vicinanze locus HHT1-HHF1 pure) attraverso la generazione di un piccolo cromosoma circolare 17, in quanto questo potrebbe complicare l'interpretazione dei risultati.

Abbiamo recentemente utilizzato una versione di questa strategia mutagenesi per generare istone H3 proteine istoni esprimono tutte le possibili sostituzioni ammino acido in posizione 61, che è normalmente occupato dal leucina 14. Per questi esperimenti, invece di usare yAAD156 come il ceppo di inizio del mutagenesi, abbiamo usato ceppo yADP106, che ospita una sostituzione del HHT2 ORF sia con la URA3 e TRP1 marcatori nutrizionali (invece di URA3). La presenza di entrambi i geni marcatori facilitato l'identificazione dei candidati per l'integrazione dei prodotti di PCR mutante seguenti lo schermo e la purificazione fase 5-FOA (punti 5 e 6 del protocollo), in quanto tale candidates divennero fenotipicamente Ura - e Trp -, mentre spontanea URA3 mutazione producevano in cellule con un Ura - fenotipo Trp +. yADP106 è disponibile anche su richiesta, come è la sequenza della cassetta URA3-TRP1, che potrebbe essere amplificato come unità e usato per la mutagenesi di altri geni istone usando la strategia descritta.

Incapacità di ottenere mutanti istone desiderati utilizzando questa strategia potrebbe essere attribuibile ad una serie di possibili motivi, tra cui quantità insufficiente di full-size prodotti di PCR utilizzati per la fase di integrazione o un insufficiente numero di trasformanti dopo la fase di co-trasformazione. Il primo problema potrebbe essere affrontato mettendo in comune insieme grandi gruppi di reazioni di PCR o progettando diversi set di primer che producono una maggiore resa di prodotto, mentre il secondo problema potrebbe essere risolto utilizzando una maggiore quantità di spina dorsale plasmide nell'esperimento co-trasformazione. although, come indicato in precedenza, si può utilizzare questa procedura per generare mutanti istoni ospitano due o più sostituzioni di amminoacidi, gli amminoacidi mirati devono essere relativamente vicini l'uno all'altro in quanto i rispettivi codoni devono essere collocati all'interno della stessa molecola primer. Così, questa strategia non può essere facilmente adattato per la generazione di istoni con mutazioni multiple situate lontano tra loro per tutta la lunghezza delle proteine.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Mirata<em&gt; In Situ</em&gt; mutagenesi dell&#39;istone geni in germogliamento lievito
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter