Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

대상 doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

네 개의 핵심 히스톤 단백질 H2A, H2B, H3 및 H4는 진핵 세포 염색체의 압축, 조직 및 기능에 중심 역할을한다. 이러한 히스톤 각각 두 세트의 궁극적 뉴 클레오 (1)의 형성의 결과로, 히스톤 옥타 자체 주변 DNA의 ~ 147 염기쌍의 감쌈 지시 분자의 스풀을 형성한다. 뉴 클레오 솜은 염색체 전체 유전자 전사의 조절과 euchromatin의 형성 및 이질 같은 염색체 기반 프로세스의 다양한 활성 참가자이며, 같은 과거 수십 년에 걸쳐 집중적 연구의 초점이되어왔다. 이러한 메커니즘은 히스톤 잔류의 번역 후 변형, ATP 의존적 인 뉴 클레오 리모델링 및 ATP 독립적 인 뉴 클레오 재구성을 포함 - 메커니즘의 수는있는 뉴 클레오는 특정 프로세스의 실행을 용이하게 할 수있는 방법으로 조작 할 수있는 기술되어있다조립 / 해체 (2, 3).

신진 효모 사카로 마이 세스 세레 비지는 진핵 생물에서 히스톤 함수의 이해에 특히 강력한 모델 생물이다. 이것은 주로 도메인 eukarya 걸쳐 히스톤 단백질의 진화 적 보전의 높은 유전 생화학 실험 다양 효모의 가공성에 기인 할 수있다 (4)에 접근한다. 효모 역방향 유전자 접근법 널리 염색질 생물학의 다양한 양상의 특정 히스톤 돌연변이의 효과를 연구하기 위해 사용되었다. 실험은 이러한 유형의 비정상적인 세포 (인해 세포에서 플라스미드의 수를 가변으로) 히스톤 단백질의 수준을 초래할 수 자율 플라스미드로부터 발현 같은 돌연변이 히스톤은 그 나라의 게놈 유전자좌로부터 발현 된 세포를 사용하는 것이 바람직하다 크로 엔의 수반 변경최종적으로 결과의 해석을 혼동 할 수 많은 환경.

여기서는 게놈 남은 외래 DNA 서열없이, 원하는 돌연변이 (들)의 발생에 클로닝 단계 및 결과를 필요로하지 않고 그 나라의 게놈 위치에서 히스톤 유전자 표적화 돌연변이 유발을 허용하는 PCR 계 기술을 설명한다. 이 기술은 효모에서 효율적인 상동 재조합 시스템을 활용하고 다른 그룹에 의해 개발 된 다른 유사한 기술과 공통점이 몇 가지 기능이있다 - 가장 특히 Delitto PERFETTO, 사이트 별 게놈 (SSG) 돌연변이 유발 및 복제없이 PCR 기반의 대립 유전자를 대체 방법 5, 6, 7. 그러나,이 설명 된 기술은 특히 히스톤 유전자의 돌연변이 유발에 적합하게 한 측면을 갖는다. 반수체 효모 세포에서, 네 개의 코어 히스톤의 각각은 두 개의 비 a로 인코딩llelic 높은 상 동성 유전자는 예를 들어, 히스톤 H3가 HHT1 HHT2 및 유전자에 의해 암호화되고,이 유전자의 오픈 리딩 프레임 (ORF를는) 시퀀스의 90 % 이상 동일하다. 상 동성이 높은 수준은 구체적으로 돌연변이 유발을위한 두 개의 히스톤를 코딩하는 유전자 중 하나를 목표로 설계된 실험을 복잡하게 할 수 있습니다. 상기 방법들은 상동 재조합을 유도하는 표적 유전자의 ORF 내의 적어도 몇몇 시퀀스의 사용을 필요로하는 반면, 우리는 여기서 설명하는 기술에 대한 (더 적은 서열 상 동성을 공유하는) 히스톤 유전자의 ORF를 플 랭킹 서열을 이용한다 재결합 단계, 따라서 원하는 궤적에 돌연변이를 성공적으로 표적의 가능성을 증가시킨다. 또한, 재조합 드라이브 상동 지역이 더 효율적 대상 상동 재조합에 기여하고, 매우 광범위 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

참고 : 현장 히스톤 유전자 돌연변이에 대상에 대한 실험 전략 (그림 1에 요약) 여러 단계를 포함한다. 이러한 단계는 다음을 포함한다 : URA3 유전자 표적 히스톤 유전자 (1)의 교환, (2) 생성 및 원하는 돌연변이 (들)을 보유하는 프라이머를 사용하여 대상 히스톤 유전자의 두 부분 오버랩하는 조각에 해당하는 PCR 산물의 정제 (3 ) 두 부분 오버랩 조각의 융합 PCR은 플라스미드에 마커 (4) 전체 크기의 PCR 제품 및 백본 플라스미드 공동 변환 및 선택 (5) 화면 5-FOA 방지를위한, 통합을위한 전체 크기의 PCR 제품을 얻었다 형질 전환, (6) 5-FOA 내성 콜로니 정제 골격 플라스미드의 손실, 및 (7) 분자는 돌연변이 대립 유전자의 적절한 통합 분석으로 분석한다.

그림 1
현장 돌연변이 유발에 대상에 대한 전략의 개요. 이 예에서, 표적 유전자는 HHT2이지만, 다른 코어 히스톤 유전자의이 전략을 사용하여 돌연변이 될 수있다. 그림과 같이 (A) 반수체 효모 세포 배열이 히스톤 H3를 코딩하는 유전자 (HHT1HHT2)와 두 개의 히스톤 H4를 코딩하는 유전자 (HHF1HHF2를) 항구합니다 (HHT1HHF1 유전자는 염색체 II와 HHT2에 있습니다 및 HHF2 유전자는 염색체 XIV에있다 - 각각의 경우에, 화살표)은 전사의 방향을 지적한다. 절차의 제 1 단계에서, HHT2 유전자의 ORF는 hht2Δ :: URA3 변형을 야기주는 URA3 유전자로 대체된다. 제 1 부 (B)는 게놈 DNA 시료로부터 HHT2 유전자의 야생형 카피 속 두 PCR 반응을위한 주형으로 사용유전자의 두 부분 오버랩 단편 테. 첫 번째 반응에 대한 역방향 프라이머는 게놈에 도입 할 원하는 돌연변이 (들)에 해당합니다 (빨간색 원으로 표시) 하나 이상의 일치하지 않는 뉴클레오티드를 포함한다. 제 2 반응의 정방향 프라이머 (또한 빨간색 원으로 표시) 역 보완적인 구성에서 해당 불일치가 있습니다. 두 PCR 1 부에서 생성 된 제품 (제품 A와 B)을 융합 PCR 템플릿이 방식으로 제품 A와 B에 어닐링이 최대 크기의 PCR 생성 결과 파트 2에 도시 된 두 개의 프라이머를 사용로서 사용 원하는 돌연변이 (들)을 숨겨 제품 (부품 3 제품 다). (C)가 hht2Δ는 :: URA3 균주는 인 공동 형질 부족 미디어 (전체 크기의 PCR 산물과 백본 플라스미드 (a HIS3-이 예에서 플라스미드로 표시)으로하고, 세포가 플라스미드의 존재를 선택 시간이 예에서 istidine). 형질 전환 후 5 FOA성에 대해 스크리닝 - 저항성 세포 같이 URA3 유전자의 PCR 생성물 및 절단 통합 선도 동성 재조합 이벤트를 실시한 후보이다. 유사 분열 세포 분열에 의해 골격 플라스미드이어서 손실은 최종 목적하는 히스톤 변이주로 이끈다. 우리는 주로 자연 URA3 돌연변이를 획득 한 세포를 식별 5 FOA 플레이트상에서 직접 선택에 비해 정확한 통합 이벤트 식별 훨씬 높은 주파수에서 5-FOA 저항 결과를 스크리닝 하였다 백본 플라스미드의 선택을 발견 하였다. (이 수치는 기준 (14)에서 수정되었습니다). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

URA3와 대상 히스톤 유전자의 1. 교체유전자

  1. URA3 유전자 (8, 9)와 타겟 히스톤 유전자의 ORF를 대체 표준 PCR 매개 한 단계 유전자 파괴를 수행한다.
    주 :이 돌연변이 따라서 URA3 궤적 8 내로 PCR 생성물을 통합 회피 전체 내인성 URA3 ORF 제거로 ura3Δ0 운반 효모 세포의 사용이 권장된다. 이 S. cerevisiae의 기능적이지만 S. cerevisiae의 URA3 유전자 부분적인 서열 상 동성을 갖는 한 대안으로, K. 락 티스 URA3 유전자는 URA3 배경 히스톤 여분의 발생을 효과적으로 사용할 수있다. 변형은 또한 변형 실험 (이러한 프로토콜의 단계 4)의 골격 플라스미드 선택할 수 있도록 적어도 하나의 화합물에 대해 영양 요해야한다. 이 단계는 타깃 히스톤 geneΔ 경우 :: URA3 필요하지균주는 이미 사용할 수 있습니다.

2. 생성하고 원하는 돌연변이를 품고 프라이머를 사용하여 대상 히스톤 유전자의 두 부분적으로 겹치는 조각에 해당하는 PCR 제품의 정제 (들)

  1. 대상 히스톤 유전자의 두 부분 오버랩하는 조각에 해당하는 PCR 산물을 생성한다.
    1. 다음과 같이 두 개의 PCR 반응을 준비합니다 :
      1. 내열성 1 μL 템플릿 DNA, 5 μl10 μM 정방향 프라이머, 5 μl10 μM 역방향 프라이머, 0.5 μL (1.25 U) : 다음과 같은 반응을 설정하는 유전자 (그림 1B에서 제품 A)의 첫 번째 절반에 해당하는 PCR 제품을 생성하려면 DNA 폴리머 라 아제 10 μL 배 DNA 중합 효소 완충액을 5 μL의 dNTP 혼합물 (2 mM의 각), 23.5 μL의 DH 2 O.
        참고 : 템플릿 DNA가 대상 히스톤 유전자 변형 야생 형에서 파생 된 게놈 DNA가 될 수는 표준 프로를 사용하여 격리10 cedures. DNA 농도 및 다른 게놈 제제 중의 불순물 레벨의 변동을 고려하기 위해,이 희석 DNA 게놈 또는 다른 제제의 희석액을 사용하여 반응을 최적화하기 위해 추천 (예를 들어 1:10 내지 1 : 100). 정방향 프라이머는 표적 유전자의 업스트림 영역에 어닐링한다. 역방향 프라이머는 (예제 그림 1B-1 대표 결과 섹션 참조) 길이 ~ 수의 ORF에서 40 뉴클레오티드를 어닐링하고, 중간에 어딘가에 원하는 돌연변이 (들)을 포함해야합니다. 높은 충실도의 DNA 중합 효소의 사용은 PCR 산물의 합성 과정에서 바람직하지 않은 변이의 비율을 감소시키기 위하여 권장된다.
      2. 2.1.1.1이 아니라 다른 프라이머로 나타낸 바와 같이 유전자 (도 1b에 제품 b)의 두 번째 반에 대응하는 PCR 산물을 생성하는 반응을 설정한다.
        참고 : 앞으로 PRI메르의 길이는 ~ 할 수는 ORF에서 40 뉴클레오티드를 어닐링하고, 어딘가에 중간에 원하는 돌연변이 (들)을 포함해야합니다. 이 프라이머의 돌연변이 (들) 단계 2.1.1.1의 역방향 프라이머의 돌연변이 (들)의 역 보완합니다. 역방향 프라이머는 표적 유전자의 하류 영역에 어닐링한다 (예는도 1b-1 대표 결과 절 참조).
    2. 다음 설정을 사용하여 열 순환기의 반응을 놓고 94 ℃에서 30 초; 다음 설정 중 30 회 : 98 ˚C 10 초, 60 ℃ 5 초, 72 ˚C 1.5 분; 72 ˚C 10 분.
      PCR 매개 변수의 최적화 특정 프라이머 세트에 필요한 될 수 있으며, 히스톤 유전자를 대상으로 참고.
  2. 89 mM 트리스베이스, 89 mM의 붕산, 2.5 mM의 EDTA (TBE) 버퍼의 0.9 % 저 융점 아가로 오스 겔에 PCR 반응에서 물질의 50 μL - 20를 실행합니다.
  3. 상기 증폭 된 PCR (PR)를 포함하는 아가로 스겔 컷 부깨끗한 메스이나 면도기 블레이드를 사용하여 겔에서 oducts의는 1.5 ml의 microcentrifuge 관에 각각 전송합니다. 사용할 준비가 될 때까지 -20 ℃에서 PCR 제품을 포함하는 아가로 오스 부분을 저장합니다.

'두 부분적으로 겹치는 조각 3. 퓨전 PCR은 통합을위한 전체 크기 PCR 제품을 구하는

  1. PCR 반응에 대한 템플릿을 준비
    1. 5 분 동안 65 ℃에서 가열 블럭 세트의 마이크로 원심 튜브를 배치함으로써 단계 2.3에서 아가 로스 겔 부분 용융 (또는 완전히 용융 될 때까지). 보텍스 튜브마다 1-2 분의 용융 공정을 용이하게한다.
    2. 각 샘플에서 용융 아가 일정한 양의 전송 (예를 들면, 50 ㎕를 각 100 μL의 총)는 단일 마이크로 원심 튜브에 넣고 텍싱하여 혼합한다. 융합 PCR 반응의 템플릿으로 사용합니다. 사용할 준비가 될 때까지 -20 ℃에서 튜브를 놓습니다.
  2. 전체 크기의 PCR 산물의 대량 증폭 (제품 C) 그림 1B에
    1. 2 μL 템플릿 DNA, 10 μl를 10 μM 정방향 프라이머, 10 μl를 10 μM 역방향 프라이머, 1 μL (2.5 U) 내열성 DNA 중합 효소, 20 ㎕의 5 배 DNA 중합 효소 버퍼, 10 μl의 여섯 PCR 반응, 다음과 같은 구성 요소와 각을 설정합니다 의 dNTP 혼합물 (2 mM의 각), 47 μL의 DH 2 O.
      비고 : 반응의 수는 PCR 효율에 따라 변경 될 수있다. 용융 텍싱 혼합하고, PCR 반응 혼합물에 첨가 마지막까지 주형 DNA는 (3.1.2 참조)를 65 ℃로 가열한다. 일단 추가 솔루션을 피펫 팅에 의해 여러 번 아래로 부드럽게 잘 섞는다. 다른 샘플 DNA 농도의 변동을 고려하기 위해, 먼저 희석 템플릿 또는 템플릿의 다양한 희석액을 사용하여 반응을 최적화하기 위해 추천 (예를 들어 1:10 내지 1 : 100). 병 같은 표적 유전자의 두 부분 오버랩 단편 어닐링해야 사용 두 프라이머도 1b-2 ustrated 최종 PCR 제품은 상동 재조합 단계 (예 대표적인 결과 절 참조)를 구동 할 URA3 ORF 측부 영역들 양쪽 상동에 적어도 40 개의 염기쌍을 가질 것이다되도록 설계 될 수있다. 높은 충실도의 DNA 중합 효소의 사용은 PCR 산물의 합성 과정에서 바람직하지 않은 변이의 비율을 감소시키기 위하여 권장된다.
    2. 다음 설정을 사용하여 열 순환기의 튜브를 놓고 94 ℃에서 30 초; 다음 설정 중 30 회 : 98 ˚C 10 초, 50 ℃ 15 초, 72 ˚C 1.5 분; 72 ˚C 10 분.
      주 : PCR 파라미터 최적화 특정 프라이머 세트 및 목표 히스톤 유전자 요구 될 수있다.

플라스미드에 마커 4. 전체 크기 PCR 제품 및 백본 플라스미드 공동 변환 및 선택

  1. PCR 산물의 농도
    1. 의 S 수영장IX PCR 반응 하나의 microcentrifuge 튜브에 단계 3.2.2에서 (600 μL 총)와 텍싱하여 혼합한다.
    2. 마이크로 원심 튜브 세 200 μL 씩에 샘플을 분할합니다. 3M 아세트산 나트륨 20 μL (PH 5.2), 100 % 에탄올 550 μL를 첨가하여 각 튜브의 DNA를 침전. 철저 솔루션을 섞어 적어도 15 분 동안 얼음에 배치합니다. 10 분 ~ 14,000 × g으로 원심 분리하여 DNA를 수집 200 70 % 에탄올 μL, 공기 건조하여 펠렛을 헹군다.
    3. DH 2 O 25 μL로 각 DNA 펠렛을 재현 탁하고 (75 μl의 총) 단일의 튜브로 풀.
  2. 효모 공동 변환
    1. 효모 추출물 펩톤 덱 스트로스 (YPD) 11 매질 액 섹션 1에서 생성 된 균주의 하룻밤 문화 10 ㎖를 준비합니다.
    2. 다음 날 아침, 포화 하룻밤 문화의 8 ㎖로 YPD 액체 배지 400 mL를 접종하고 흔들어 배양4 30 ° C에서 - 5 시간 세포가 성장의 로그 단계를 입력 할 수 있습니다.
    3. 10 분 ~ 3220 XG에서 원심 분리하여 세포를 수집 한 액체 배지를 폐기하고, 10 mM 트리스 -HCl (pH 8.0), 1 mM의 EDTA 1 부피로 세포를 재현 탁 0.1 M 리튬 아세테이트 용액 (TE / LiAc들을) .
    4. 10 분 ~ 3220 XG에 원심 분리하여 세포를 수집하고, TE / LiAc들을 폐기합니다.
    5. 1 ㎖의 TE / LiAc들을 상기 세포를 재현 탁.
    6. 미세 원심 분리 튜브에 다음 반응 칵테일 설정 : 세포를 800 ㎕의 단계 4.2.5에서 비등 10 ㎎ / ㎖ 연어 정자 DNA, 40 μL, 골격 플라스미드 DNA 12.5 μg의 총, 농축 PCR 생성물의 75 μL 단계 4.1.3에서.
      주 : 연어 정자 DNA을 5 분 동안 끓인 반응에 사용하기 전에 적어도 5 분 동안 얼음 상에 배치한다. 추가 백본 플라스미드 DNA의 총 부피는 최소 (~ 80 μL 이하)로 유지한다. 백본 원형질의 예를 들어 대표 결과 섹션을 참조하십시오신분증.
    7. 균등 팔의 microcentrifuge 튜브 (- 8 튜브 1)에 칵테일 철저하게 튜브와 나누어지는을 섞는다.
    8. 다음과 같은 두 개의 제어 변환 반응 튜브를 설정합니다 :
      1. 튜브 9 (아무 PCR 제품 제어) : 단계 4.2.5에서 세포를 100 ㎕, 삶은 10 ㎎ / ㎖ 연어 정자 DNA의 5 μL;의 1.56 μg의 총 (5 분 끓인 단계 4.2.6 주 참조) 백본 플라스미드 DNA없이 PCR 제품 덧붙였다.
      2. 튜브 10 (NO DNA 제어) : 단계 4.2.5, 삶은 10 ㎎ / ㎖ 연어 정자 DNA (단계 4.2.6 참고 참조) 5 μL에서 세포를 100 ㎕, DNA가 추가 더 백본 플라스미드없이 PCR 제품은 추가되지 않습니다.
      3. 최대 피펫 팅에 의해 여러 번 아래로 부드럽게하지만 철저하게 모두 튜브를 혼합한다.
    9. 30 분 동안 30 ℃에서 열 튜브를 품어.
    10. 각 튜브에, TE / LiAc들을 40 %의 폴리에틸렌 글리콜 1.2 ㎖ (PEG 3350)를 추가합니다. 용액이 균질해질 때까지 철저히 P-1000 피펫을 이용하여 혼합한다.
    11. (30)에 열 튜브를 품어30 분 동안 C를 °. 부드럽게 아래로 피펫 팅에 의해 용액을 혼합 한 후 15 분 동안 42 ° C에서 튜브를 품어.
    12. 30 초 ~ 14,000 XG에서의 microcentrifuge에 튜브를 회전시켜 세포를 수집합니다. 액체를 버리고 멸균 DH 2 O. 1 ㎖로 세포를 재현 탁
    13. 30 초 ~ 14,000 XG에서의 microcentrifuge에 튜브를 회전시켜 세포를 수집합니다. 액체를 취소하고 멸균 DH 2 O. 500 μL의 세포를 재현 탁
    14. 풀 튜브 1-8 함께 (총 4 ml의 부피) 및로 pipetting 아래로 잘 섞는다.
    15. 접시 백본 플라스미드 선택 스물 완전한 최소 강하 중간 판 (11) (판 1-20) 각각에서, 상기 혼합물을 200 μL.
    16. 접시 튜브 (9)의 혼합물을 200 ㎕의 자체 선택 플레이트에 튜브 (10) 각각으로부터의 혼합물을 200 μL (플레이트를 각각 21, 22).
    17. 5 일 - 3 30 ° C에서 22 접시를 품어플라스미드 형질 전환을 위해 선택합니다.
    18. 배양 5 일 - 3 후 변환 판을 검사합니다. 약 5,000 식민지 판 1-21 (예를 들어에 대한 대표 결과를 참조)에 표시해야하며, 더 콜로니 판 (22)에 본 제품을 장착 할 수 없습니다.

5-FOA 내성 형질 전환 5. 화면

  1. 플레이트로부터의 세포를 전송 1-20 (및 변환 제어 등의 판 21) 5- 플루오로 오로 아세트산 (5-FOA) 플레이트 (11)에 의해 복제 도금의 통합의 결과로서 URA3 유전자의 손실을 선별하기 위하여 12 원하는 위치 PCR 제품.
    1. 플레이트 뚜껑을 제거하고 멸균 벨벳에 식민지를 포함하는 판을 누릅니다. 벨벳에있는 플레이트를 눌러 5 FOA 판에 벨벳에서 세포를 전송합니다. 2 일간 30 ℃에서 번호판을 품어.
  2. 2 일 배양 후, 조심스럽게 GR에 대한 5-FOA 판을 검사owth.
    참고 : 후보 통합 이벤트가 5 FOA 판에 작은 비대칭 "숙청"식민지로 표시됩니다 - 반대로, 5-FOA 판에 성장하는 작은 용의자는 식민지의 성장 중에 발생한 자연 URA3 돌연변이의 가능성 대표는 변환 플레이트, 원하는 통합 이벤트를 (몇 가지 예이 시점에 더 정교의 대표 결과 섹션과 그림 3 참조) 표현하는 것이 어렵다.

5-FOA 방지 식민지 및 백본 플라스미드의 손실 6. 정화

  1. 멸균 이쑤시개를 사용하여 YPD 플레이트에 하나의 식민지에 대한 단계 5.2 및 행진에 설명 된 5-FOA 판에서 후보 식민지를 선택합니다. 30 ° C 3 일 - 2 품어.
  2. 배양, 복제 다음 - 접시에 신선한 YPD 판에 각 YPD 정화 판, 드롭 아웃 플레이트 손실을 확인 우라실 결여URA3 유전자, 및 두번째 드롭 아웃 플레이트의 골격 플라스미드의 존재 여부를 모니터링한다. 30 ° C에서 2 일 - 1 품어.
  3. 배양를 수행하면은 YPD 판에 성장하지만 중 하나 드롭 아웃 접시에 성장되지 않은 각 후보 샘플에서 식민지를 식별 (예 : 식민지는 재결합 이벤트를 통해 URA3 유전자를 잃은 것으로 기대하고 유사 분열하는 동안 백본 플라스미드를 분실 세포 분열). 신선한 YPD 접시에 이러한 식민지를 Restreak. 이 식민지는 통합 후보 및 7 단계에서 추가로 분석됩니다.

돌연변이 대립 유전자의 적절한 통합을위한 분석 7. 분자 분석

  1. 표준 절차 (10)를 사용하여 후보 샘플로부터 게놈 DNA를 분리.
  2. 대상 사이트를 포괄하는 유전자 영역을 증폭.
    1. 0.5 ㎕를 주형 DNA, 5 ㎕를 각 샘플에 대해 다음 PCR 반응을 설정10 μM 정방향 프라이머, 5 ㎕의 10 μM 역방향 프라이머, 0.5 μL (2.5 부)의 Taq DNA 중합 효소, 5 ㎕의 10 배의 Taq DNA 중합 효소 완충액 5 ㎕의 용의 dNTP 혼합물 (2 mM의 각), 29 μL의 DH 2 O.
      주 : DNA 템플릿이 후보 샘플로부터 유래 된 게놈 DNA이다. 하나 원래 히스톤 geneΔ 유래의 게놈 DNA를 주형으로 :: URA3 균주를 사용하여 주형으로서 야생형 히스톤 균주로부터 게놈 DNA를 사용하여 다른 : 또한, 두 개의 제어 반응을 포함 할 것을 권장한다. DNA 농도 및 다른 게놈 제제 중의 불순물 레벨의 변동을 고려하기 위해,이 희석 DNA 게놈 또는 다른 제제의 희석액을 사용하여 반응을 최적화하기 위해 추천 (예를 들어 1:10 내지 1 : 100). 이 확인 것이 중요하다고 추정되는 집적 PCR 생성물에 의해 둘러싸인 영역 외부의 DNA 서열이 프라이머 어닐링 - 이러한 방식으로,이 연구에서 PCR 산물의 크기eactions 정확한 게놈 위치에있는 제품의 통합을위한 진단 도구로 사용할 수 있습니다 (예를 들어에 대한 대표 결과를 참조).
    2. 다음 설정을 사용하여 열 순환기의 반응을 놓고 : 94 ° C 3 분; 다음 설정 중 30 회 : 94 ° C 45 초, 50 ℃ 45 초, 72 ℃에서 2 분; 72 ° C 10 분.
      주 : PCR 파라미터 최적화 특정 프라이머 세트 및 목표 히스톤 유전자 요구 될 수있다.
  3. PCR 제품 가공
    1. 0.8 % TBE 아가 로스 젤에 각 반응에서 20 μl를 실행합니다.
    2. URA3 유전자가 성공적으로 추정되는 히스톤 돌연변이 유전자로 대체 된 경우를 결정하는 기준으로서 DNA 수준을 사용하여 PCR 산물의 크기를 평가한다 (예를 들어 대표적인 결과를 참조).
      주 : 특정 경우에서 원하는 돌연변이 (들)가 히스톤 유전자 도입하거나 생성하거나 앉아 제한 파괴이자형. 이 경우 정확한 적분을 나타내는 크기의 PCR 산물의 원하는 돌연변이의 존재는 겔 전기 영동 분석 하였다 해당 제한 효소로 소화 생성물을 실시함으로써 평가 될 수있다 (예를 들어 대표적인 결과를 참조) .
    3. DNA 서열에 정확한 적분을 나타내는 크기의 PCR 대상 제품은 원하는 돌연변이 (들)의 존재를 확인하고 추가의 돌연변이가 게놈 내로 도입되지 않았 음을 보장하기 위해.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

우리는 시츄 돌연변이 전략 표적의 대표 예로서 글루탐산 (돌연변이 H3-R53E)에 아르기닌에서 위치 53에서의 치환을 보유하는 히스톤 H3 돌연변이 단백질을 표현한 hht2 대립 형질의 발생을 설명한다.

우리 HHT2 전체 ORF가 URA3 유전자 (프로토콜의 단계 1 참고)로 대체 된 균주를 생성. 이 균주 yAAD156 또한 세포가 히스티딘 영양 요 구성 될시키는 his3Δ200 대립 유전자를 항구. 프로토콜의 단계 2에 나타난 절차에 따라, 우리는 다음 HHT2 두 부분 오버랩하는 단편을 생성. 다음의 프라이머가 제 단편을 사용 하였다 : 정방향 프라이머 (OAD20) : 5 'GCGTTCATTATCGCCCAATGTG 3'역방향 프라이머 (R53Erev) : 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. 다음 홍보imers 번째 단편을 사용 하였다 : 정방향 프라이머 (R53Efor) : 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3'역방향 프라이머 (OAD21) : 5 'GCGCTTGATCAGCAGTTCATCG 3'. 이것은 효과적인 어닐링을 허용, 이러한 돌연변이 뉴클레오타이드는 야생형 서열의 둘 사이의 긴 스트레치에 자리 잡고있다 - 2 차 반응에서 첫 번째 반응에서 역방향 프라이머 정방향 프라이머 (소문자) 돌연변이 원하는 뉴클레오티드를 함유 유의 돌연변이 된 위치에서의 미스 매치에도 불구하고 주형 DNA에 프라이머. 이러한 두 프라이머의 변이 된 뉴클레오타이드가 서로 상보 반전하고 최종적으로 인코딩 된 단백질의 R53E 돌연변이를 생성 코돈 변화를 GAA하는 AGA 초래 센스 가닥의 GA 돌연변이에 AG를 일으킬 참고. 이러한 PCR 반응의 결과는도 2a에 도시되어있다.

단계 3의 과정을 사용하여, 우리는 다음 GENER 전체 크기 PCR 제품을 ated. 사용 된 프라이머는 정방향 프라이머이었다 (OAD479) 5'TATGGCTCGGTGTCAAAACA (3 ') 및 역방향 프라이머 (OAD480) : 5'CATGGTTTCTTGCCGGTTAT 3 '. 이들 프라이머를 설계하는 경우, 그 중 하나가 상 동성 재조합 반응을 (상 동성 영역이 길수록 더 효율적이고 고유 동성 재조합 것 구동 끝의 결과 융합 PCR 제품은 적어도 40 개의 염기쌍을 포함하는지 확인하는 것이 중요 있다). 본 실험에서, 최대 크기의 PCR 산물을 각각 195 염기쌍 영역 220 염기쌍 영역 상동 상류 영역 및 상기 HHT2 ORF 하류를 함유 하였다. 이들 PCR 산물의 샘플을 아가 로스 겔 전기 영동 (도 2B)로 분석 하였다.

풀 사이즈의 PCR 산물이 다음 플라스미드 pRS413 (a 센트로 함께 공동 - 형질 전환 된, HIS3- 플라스미드 표시된프로토콜의 단계 4에 기재된 바와 같이 F "> 13) 형질 전환 히스티딘 (SC-그의 판) 결핍 플레이트상에서 선택 하였다. 그 + 콜로니는 그 프로토콜의 단계 5에 기재된 절차에 따라 5-FOA성에 대해 스크리닝 하였다. 3은도 3에 제시되는 변환 판 (SC-그의) 후보 샘플 복제본 도금 SC-그의 플레이트로부터. 예뿐만 아니라 원하는 통합 이벤트를 나타낼 가능성이 샘플 5-FOA 플레이트의 일례를 도시 프로토콜의 단계 6에서 설명 된 바와 같이. 우리의 실험에서는이 스크린 ~ 90,000 형질로부터 열두 후보 샘플을 확인 하였다. 이러한 후보들은 다음 정제 하였다.

열두 후보자들은 다음 돌연변이 PCR 제품과 URA3 유전자의 확실한 보충을 반영하면 평가 프로토콜의 단계 7에 기술 된 PCR 분석을 실시 하였다. 우리의 experimen에 대한t, 우리는 PCR 산물의 통합 사이트에서 하류 302 염기쌍을 어닐링하는 PCR 산물의 통합 사이트 및 역방향 프라이머 89 염기쌍 상류 어닐링 순방향 프라이머를 사용했다. HHT2 궤적이 HHT2 (또는 HHT2 돌연변이 버전 염기쌍 치환을 보유하는) 또는 크기 2188 염기쌍의 PCR 생성물에 의해 점유되는 경우 궤적이 URA3 마커 유전자에 의해 점유되는 경우 이러한 프라이머의 크기는 1217 염기쌍의 PCR 생성물을 생성 . 5 'GAAACTATTGGCACGCCCTA 및 역방향 프라이머의가 (OAD477)를 사용할 수 있습니다 : : 5'CCTGCGAATCAACCGATACT 3 '앞으로 뇌관의 순서는 (OAD476)입니다을 사용했다. 우리가 확인했던 열두 후보 중 4 명은 정확한 위치 (예는도 4a 참조)에서 PCR 제품의 통합을 보였다. GA 돌연변이에 AG 새로운 에코 RI의 제한 부위를 생성 보낸 마지막으로, 우리는에 성공적인 통합 샘플 중 하나로부터 PCR 제품 실시 (그림 4B 참조). 특히이 경우에 우리는 부가적인 원치 않는 돌연변이는 게놈에 통합되지 않은되도록하여 PCR 제품 시퀀스 않았다 : 그러나, 우리는 이전 연구 14 HHT2 돌연변이 다수 발생이 매우 유사한 절차를 사용하고, 및 통합 돌연변이 대립 유전자의 대부분이 원하는 것 이외의 돌연변이를 가지고 없다는 것을 발견했다.

그림 2
그림 2 : PCR 제품 은닉의 생성은 효모 게놈에 통합을위한 돌연변이를 원하는. (A) PCR 반응은 목적하는 돌연변이를 보유하는 HHT2의 부분 오버랩하는 단편을 생성한다. 탑 : t의 만화 표현그는 두 HHT2 조각을 얻기 위해 두 PCR 반응은 (1B-그림 1 참조). 빨간 원 유전자의 센스 가닥의 AG GA에 돌연변이를 도입하는 데 사용 된 프라이머의 미스 매치 뉴클레오타이드를 나타낸다. 바닥 : PCR 상품 AB (각각 레인 2 및 3)의 전기 영동 분석. DNA 표준은 효모 게놈에 통합을위한 전체 크기의 PCR 제품을 생성하기 위해 차선 1 (B) 퓨전 PCR 반응에 표시됩니다 (1B-2 및 그림 3 참조). 위쪽 : 만화 PCR 반응의 표현은 PCR 생성물 (제품 C)를 예상했다. 상기 (A)에 기재된 바와 같이 빨간 원은 원하는 돌연변이를 나타낸다. 바닥 : PCR 생성물 (C)의 겔 전기 영동 분석 (레인 2). DNA 표준은 레인 1에 나타낸다 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.


그림 3 : 공동 변환 실험 및 5-FOA 화면에서 대표 결과. 왼쪽 : 30 ℃에서 3 일간 배양 한 후, 동시 변환 절차를 실시 세포 도금 대표 SC-그의 접시. 약 5,000 콜로니를 계수 하였다. 중동 : 30C에서 2 일간 배양 한 후 SC-그의 동료 변환 판에서 복제 도금 다음 대표 5 FOA 판. 샘플 1과 2는 그들의 비대칭 모폴로지에 성공적으로 통합 이벤트를 통과 한 후보로 간주되었다. hht2 대립 유전자와 URA3 유전자의 진정한 대체 그 결과, 형질 전환 된 세포는 SC-그의 플레이트 상에 플레이 팅 전에 발생할 수 (또는 곧 후)하고 있기 때문에, 그 위치에서 일어난다 콜로니이며 대부분, 그렇지 않은 경우 독점적으로, 5-FOA - resistan 포함됩니다T 세포 - 이러한 식민지 그때 이후 복제 도금 접시에 세포의 비대칭적인 패치에 상승을 제공,이 숙청 될 것이다 5 FOA 판에있을 때. 반대로, 자연 콜로니 형성시 발생할 수있는 URA3 유전자 변이 콜로니의 작은 영역 내에 국한 될 가능성, 및 5-FOA 판 복제본 도금시 용의자를 야기하는 것이 더 쉽다. 오른쪽 : 30 ° C에서 3 일간 배양 한 후 SC-그의 동료 변환 판에서 복제 도금 다음 다른 대표적인 5-FOA 판. 이러한 유두, 가장 명확하게 볼 배양 3 일 이상 후에있는 자연 URA3 돌연변이와하지를 나타낼 가능성이있다 - 추가 후보 (샘플 3)뿐만 아니라 두 개의 작은 유두이 판 (샘플 4, 5)에서 볼 수 있습니다 원하는 통합 이벤트입니다. 보려면 여기를 클릭하십시오이 그림의 더 큰 버전.

그림 4
그림 4 : 후보 통합 샘플의 분자 분석. (A) PCR 분석은 성공적인 통합 이벤트를 식별한다. 위쪽 : 게놈 내로 hht2 돌연변이 대립 유전자의 성공적인 통합을 평가하기 위해 사용 된 PCR 반응의 만화 표현. 하단 :는 HHT2 야생형 균주 유래의 게놈 DNA (대조군으로 사용 된, 레인 2), 스트레인 yAAD156는 (레인 3 대조군으로서 사용됨) hht2Δ :: URA3 교체 은닉을 사용하여 PCR 반응의 전기 영동 분석, 후보 통합 샘플 (레인 4), 및 5-FOA 내성 용의자 샘플 (정확한 통합 이벤트를 나타낼 가능성 및 이에, 레인 5). DNA 표준 후보 통합 샘플에 대한 PCR 산물의 크기 consiste 것을 레인 1 주에 나타낸다NT 성공적인 통합 이벤트와, 유두 샘플에 대한 PCR 산물의 크기 반면 온전한 hht2Δ :: URA3 궤적과 일치한다. (B) 에코 RI 소화는 돌연변이 대립 유전자의 존재를 확인합니다. 위쪽 : 야생형 HHT2 유전자 또는 돌연변이 hht2 대립 유전자를 포함하는 PCR 산물의 에코 RI 분해 반응에서 유래하는 것으로 소화 단편 만화 표현. 바닥 : 야생형 HHT2 균주로부터 유도 된 PCR 산물의 분해 반응의 전기 영동 분석 (레인 2, 패널 (A)의 레인 2에서 사용 된 것과 동일한 샘플로부터 유래 한 여기에 사용 된 PCR 산물)과 후보 통합 샘플 ( 레인 3, 즉 패널 (A)의 레인 4에서 사용 된) 동일한 샘플로부터 유래 된 PCR 여기서 사용되는 제품. DNA 표준은 소화 패턴 GA 돌연변이에 AG 성공적 후보의 게놈 내로 도입되어 있음을 확인하는 것이 차선 1 주에 나타낸다통합 샘플. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

반수체 S. cerevisiae의 세포에서 4 개의 핵심 히스톤 단백질의 각각에 대한 코드가 구체적으로 돌연변이 유발을위한 두 개의 유전자 중 하나를 타겟팅하려는 연구자에 대한 도전을 나타낼 수있는 두 개의 비 대립 유전자 사이의 서열 상 동성의 높은 수준. 이전에 종종 의존 상기 Delitto PERFETTO, 부위 - 특이 적 유전자 (SSG) 돌연변이 유발, 클로닝없이 PCR 기반 대립 유전자 교환 방법 5, 6, 7,뿐만 아니라 최근 효모 CRISPR 기반 기술 (15)을 포함하여, 효모 돌연변이 유발 방법을 설명 원하는 유전자 재조합 사이트 또는 수리 기계 모집 표적 유전자의 ORF 내의 서열에 적어도 부분적으로 결국 최종 돌연변이 대립 유전자를 생성한다. 한편, 우리는 여기서 제시 한 전략은 homologo를 구동 대상 ORF 플 랭킹 DNA 서열을 이용한다미국 재조합 사건은 돌연변이의 통합을 위해 필요하며, 결과적으로 높은 상 동성을 가지는 ORF를 두 유전자 불구 위에 다른 유전자의 구체적인 타겟팅을 허용한다. 이 기능은 특히 히스톤 돌연변이 유발에 적합 우리의 전략을합니다. 그러나,이 전략은 또한 효모 게놈의 다른 유전자의 돌연변이 유발을 위해 구성 될 수있다.

전략의 부가 기능을 설계 할 수있는 돌연변이 유전자 상동 재조합을 유도하는 영역의 길이를 따라서 (원하는 돌연변이 외에 표적 게놈 위치에서 통합의 효율을 증대하고, 그 매우 방대한 수 있다는 사실을 포함하는 (S) ) 추가 DNA 서열은 게놈에 도입되지 않습니다. 이 시스템의 또 다른 장점은 URA3으로 특정 히스톤 유전자 교체 형질 변형이 구축되고 나면, 그것은 특정 HIST의 임의의 변이체 버전의 생성을 위해 사용될 수있다하나의 유전자. 따라서, 예를 들어, 요청에 따라 연구 단체로 사용할 균주 yAAD156는, 디 노보 hht2Δ :: URA3 대립 유전자를 구성 할 필요없이 원하는 hht2 돌연변이를 확인하기 위해 사용될 수있다. 마지막으로, 적절하게 설계된 PCR 프라이머를 사용하여,이 전략은 또한 그들이 상대적으로 서로 다른 (예를 들어, 우리는를 코딩하는 hht2 대립 유전자를 생성 한 근처와 같이 내부 결실 또는 복수의 코돈에서 돌연변이 히스톤 대립 유전자를 생성 할 수있다 H3-K56R,이 전략을 사용 L61W 이중 돌연변이 단백질).

구체적으로 돌연변이 유발을위한 두 개의 매우 상동 히스톤 유전자 중 하나를 목표로하는 능력은 다른 실험 설정의 숫자에 도움이 될 수 있습니다. HHT1-HHF1 유전자가 HHT2 HHF2-16 유전자와 비교하여 서로 다른 수준으로 발현되기 때문에 특정 H3 또는 H4 돌연변이 디을 부여할지 여부를 예를 들어, 결정하는 데 관심이있을 수있다이로부터 발현되는 유전자에 따라 fferent 표현형. 또 다른 예는 조사자 모두 대응 히스톤 유전자에서 특정 히스톤 변이체를 발현 반수체 세포를 생성하고자하는 시나리오 - 이것은 제 크로스 통해 이중 돌연변이 반수체 세포를 수득 한 다음 두 가지 균주 각각 독립적 유전자 mutagenizing 및 달성 될 수있다 원하는 감수 제품의 후속 격리. 또 다른 예는 히스톤의 H2A와 H2B의 돌연변이에 관한 것이다 : 각각의 단백질이 약간 다른 이성체가 대응하는 비 - 대립 유전자 세트에 의해 코딩되는 사실 주어진 조사자 특정 H2A 또는 H2B 돌연변이에 미치는 영향을 평가할 수도 이성체 중 하나의 컨텍스트. HTA1HTB1의 궤적을 mutagenize하는 실험을 설계 할 때, 연구자는 균주가 (hta1-htb1)를 운반하는 것을 Δ을 보여주는 최근의 연구 결과에주의해야 가능한된다 (각각 H2A와 H2B을 인코딩) 난 단지이 결과의 해석을 복잡하게 할 수로서 F 그들은 작은 원형 염색체 17의 생성을 통해 HTA2-HTB2 궤적 (뿐만 아니라 인근 HHT1-HHF1 궤적)을 증폭 하였다.

최근 일반적으로 아미노산 류신 (14)에 의해 점유되는 위치 (61)에서 모든 가능한 아미노산 치환을 발현 히스톤 H3 단백질 생성이 히스톤 돌연변이 전략의 버전을 사용했다. 그 실험을 위해, 대신 돌연변이의 시작 변형으로 yAAD156를 사용하여, 우리는 URA3TRP1 영양 마커 (대신 URA3의) 모두와 함께 HHT2 ORF의 교체를 품고 변형 yADP106를 사용했다. 두 마커 유전자의 존재는 candidat 같이, 5-FOA 화면 정제 단계 (도 5 및 프로토콜의 6 단계) 다음 돌연변이 PCR 제품의 통합 후보들의 식별을 용이TRP + 표현형 - 자연 URA3 돌연변이가 우라와 세포의 결과 반면, - 그리고 TRP - 에스는 표현형 우라되었다. 단위로 증폭되고 본 명세서에 설명 된 전략을 사용하여 다른 히스톤 유전자의 돌연변이 유발을 위해 사용될 수있는 URA3-TRP1 카세트의 순서대로 yADP106는 요청도 가능하다.

무능력 통합 단계 또는 공동 변환 단계 다음 형질 전환 체의 수가 충분 사용될 최대 크기의 PCR 산물의 부족량을 포함한 가능한 원인의 개수에 기인 할 수있는이 전략을 사용하여 원하는 히스톤 변이체를 얻었다. 후자의 문제를 공동 형질 전환 실험에서 골격 플라스미드를보다 많은 양을 이용하여 해결 될 수있는 반면 이전의 문제는, PCR 반응의 함께 큰 세트를 풀링 또는 생성물의 높은 수율을 생산하고 다른 프라이머 세트를 디자인에 의해 해결 될 수있다. Altho앞서 나타낸 바와 같이, 우, 하나 둘 또는 그 이상의 아미노산 치환을 보유하는 히스톤 변이체를 생성하는 절차를 사용하여 타겟팅 된 아미노산은 각 코돈이 동일한 프라이머 분자 내에 위치 할 필요가 없기 때문에 상대적으로 서로 가까이 있어야한다. 그러므로,이 전략은 쉽게 단백질의 길이에 걸쳐 서로 멀리 위치한 다수의 돌연변이와 함께 히스톤의 생성에 적합 할 수 없다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
대상<em&gt; 현장에서</em신진 효모에서&gt; 돌연변이 유발 히스톤의 유전자
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter