Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

målrettet doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De fire kjerne histonproteinene H2A, H2B, H3 og H4 spille sentrale roller i komprimering, organisasjon og funksjon av eukaryote kromosomer. To sett med hvert av disse histoner danner histon octamer, en molekyl spole som styrer innpakning av ~ 147 basepar av DNA rundt seg selv, til slutt resulterer i dannelsen av en nucleosome 1. Nukleosomer er aktive deltakere i en rekke kromosombaserte prosesser, for eksempel regulering av gentranskripsjon og dannelse av eukromatin og heterochromatin tvers kromosomer, og som sådan har vært fokus for intens forskning i løpet av de siste tiårene. Et antall mekanismer har blitt beskrevet av hvilken nukleosomer kan manipuleres på måter som kan lette gjennomføring av spesifikke prosesser - disse mekanismene omfatter posttranslasjonell modifikasjon av histon-rester, ATP-avhengige nucleosome remodellering, og ATP-uavhengig nucleosome reorganiseringog montering / demontering to, tre.

Den spirende gjær Saccharomyces cerevisiae er en spesielt kraftig modellorganisme for forståelsen av histone funksjon i eukaryoter. Dette kan i stor grad tilskrives den høye graden av evolusjonære bevaring av histonproteinene hele domenet eukarya og amenability av gjær til en rekke genetiske og biokjemiske eksperimentelle tilnærminger fire. Omvendt-genetiske tilnærminger i gjær har blitt mye brukt til å studere effekter av spesifikke histone mutasjoner på ulike aspekter av kromatin biologi. For disse typer av forsøk er det ofte foretrukket å anvende celler i hvilke de mutante histoner er uttrykt fra sitt opprinnelige genomiske loci, som uttrykk fra autonome plasmider kan føre til unormale intracellulære nivåer av histonproteinene (på grunn av varierende antall plasmider i celler) og samtidig endring av kromatin novironments, som kan til slutt skamme tolkningen av resultatene.

Her beskriver vi en PCR-basert teknikk som gjør det mulig for målrettet mutagenese av histpngenene ved sine opprinnelige genomiske steder som ikke krever en kloningstrinn og resulterer i dannelsen av den ønskede mutasjon (er) uten tiloversblevne eksogene DNA-sekvenser i genomet. Denne teknikken utnyttet effektivt homolog rekombinasjon system i gjær og har flere fellestrekk med andre lignende teknikker utviklet av andre grupper - først og fremst Delitto Perfetto, stedsspesifikke genomisk (SSG) mutagenese, og kloning frie PCR-basert allelet erstatning metoder 5, 6, 7. Imidlertid teknikken beskriver vi har et aspekt som gjør det spesielt godt egnet for mutagenese av histon gener. I haploide gjærceller, blir hver av de fire kjerne histoner kodet for av to ikke-enllelic og sterkt homologe gener, for eksempel, er histon H3 kodet av de HHT1 og HHT2 gener, og de åpne leserammer (ORF) av de to gener er over 90% identisk i sekvens. Denne høye grad av homologi kan komplisere forsøk utformet for å spesifikt mot en av de to histon-kodende gener for mutagenese. Mens de ovennevnte metoder krever ofte anvendelse av i det minste noen sekvenser innenfor ORF av målgenet for å drive homolog rekombinasjon, teknikken beskrives her gjør bruk av sekvenser som flankerer ORF av histpngenene (som deler mye mindre sekvenshomologi) for rekombinasjon trinnet, og dermed øke sannsynligheten for vellykket målretting av mutagenese til den ønskede locus. Dessuten kan de homologe regionene som driver rekombinasjon være meget omfattende, noe som ytterligere bidrar til en effektiv målrettet homolog rekombinasjon.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

MERK: Den eksperimentelle strategi for målrettet in situ histone genet mutagenese omfatter flere trinn (oppsummert i figur 1). Disse trinnene omfatter: (1) erstatning av målet histon-genet med URA3-genet, (2) Produksjon og rensing av PCR-produkter som tilsvarer to delvis overlappende fragmenter av målet histon-genet ved bruk av primere som bærer den ønskede mutasjon (er), (3- ) Fusion PCR av de to delvis overlappende fragmenter for å oppnå full størrelse PCR-produkter for integrering, (4) Ko-transformasjon av full størrelse av PCR-produkter og ryggrad plasmid, og seleksjon for markør på plasmid, (5) Skjerm for 5-FOA-resistente transformanter, (6) Rensing av 5-FOA-resistente kolonier og tap av ryggraden plasmid, og (7) Molecular analyser for å assay for riktig integrering av det mutante allelet.

Figur 1
in situ mutagenese av histpngenene i Budding gjær. I dette eksemplet er den målrettede genet er HHT2, men hvilken som helst annen kjerne histon-genet kan også bli mutagenisert ved hjelp av denne strategi. (A) Haploid gjærceller huse to histon H3-kodende gener (HHT1 og HHT2) og to histon H4-kodende gener (HHF1 og HHF2) anordnet som vist på figuren (i HHT1 og HHF1 gener er lokalisert på kromosom II og HHT2 og HHF2 gener er lokalisert på kromosom XIV - i hvert tilfelle, pilene peker i retning av transkripsjon). I det første trinnet av fremgangsmåten blir den ORF av HHT2 genet erstattet med URA3-genet, som gir opphav til en hht2Δ :: URA3 belastning. (B) I del 1, er en vill-type kopi av HHT2 genet fra et genomisk DNA-prøve anvendt som templat i to PCR-reaksjoner på generate de to delvis overlappende fragmenter av genet. Den revers primer for den første reaksjonen omfatter en eller flere feilaktige nukleotider (indikert med en rød sirkel) som svarer til den ønskede mutasjon (er) som skal innføres i genomet. Den fremre primer for den andre reaksjons har tilsvarende mismatch i en omvendt komplementær konfigurasjon (også antydet med en rød sirkel). De to PCR produktene ble generert på en del (produktene A og B) blir deretter anvendt som templater for fusjons PCR ved bruk av to primere som glødning til produktene a og b på den måte som er vist i del 2. Dette resulterer i genereringen av full størrelse PCR produkter (produkt c i del 3) som bærer den ønskede mutasjon (er). (C) Et hht2Δ :: URA3-stammen er da ko-transformeres med full størrelse av PCR-produkter og en ryggrad plasmid (a HIS3- markert plasmid i dette eksempel), og celler blir utvalgt for tilstedeværelse av plasmidet (på media som mangler histidine i dette eksempelet). Transformanter blir deretter screenet for 5-FOA motstand --resistente celler er kandidater for å ha gjennomgått en homolog rekombinasjon som fører til integrering av PCR-produktet og fjerning av den URA3-genet, som vist. Påfølgende tap av ryggraden plasmidet ved mitotisk celledeling fører til det endelige ønskede histone mutantstamme. Vi har funnet at valget av ryggraden plasmidet etterfulgt av screening for 5-FOA motstand resulterer i en mye høyere frekvens av identifikasjon av korrekte integrering hendelser sammenlignet med direkte markering på 5-FOA-plater, som for det meste identifiserer celler som har ervervet spontane URA3 mutasjoner. (Dette tallet har blitt modifisert fra referanse 14). Klikk her for å se en større versjon av dette tallet.

1. Utskifting av Target Histone Gene med URA3Gene

  1. Utføre standard PCR-mediert ett-trinns-genet avbrudd å erstatte ORF av target histon-genet med URA3-genet 8, 9.
    MERK: Anvendelse av gjærceller som bærer ura3Δ0 anbefales som denne mutasjonen fjerner hele endogene URA3 ORF, og dermed unngår integrering av PCR-produktet inn i den URA3-locus 8. Alternativt kan den K. lactis URA3-genet bli brukt effektivt for generering av histon erstatning i noen ura3 bakgrunn som det er funksjonelt i S. cerevisiae, men har bare partiell sekvenshomologi med S. cerevisiae URA3-genet. Stammen bør også være auxotrof for minst en forbindelse som vil muliggjøre seleksjon av ryggraden plasmidet i transformasjons forsøket (se trinn 4 i denne protokoll). Dette trinnet er ikke nødvendig hvis en target histone geneΔ :: URA3belastningen er allerede tilgjengelig.

2. generasjon og rensing av PCR-produkter som tilsvarer to delvis overlappende Fragmenter av Target Histone Gene bruker Primere skjuler den ønskede mutasjon (er)

  1. Generere PCR-produkter som tilsvarer to delvis overlappende fragmenter av målet histon-genet.
    1. Forbered to PCR reaksjoner som følger:
      1. For å generere PCR-produkter som tilsvarer den første halvdelen av genet (produktet en i figur 1B), satt opp følgende reaksjon: 1 ul templat-DNA, 5 μl10 mikrometer fremover primer og 5 μl10 mikrometer revers primer, 0,5 mL (1,25 U) termostabile DNA-polymerase, 10 ul 5x DNA-polymerase-buffer, 5 ul dNTP-blanding (2 mM hver), og 23,5 ul dH 2 O.
        MERK: templat-DNA kan være genomisk DNA avledet fra en stamme vill-type for målet histon-genet isoleres ved anvendelse av standard prodyrer 10. Å ta hensyn til variasjoner i DNA-konsentrasjonen og graden av urenheter i forskjellige genomiske preparater, er det anbefalt å optimalisere reaksjonene ved hjelp av enten ufortynnet DNA eller forskjellige fortynninger av de genomiske preparater (f.eks 1:10 og 1: 100). Den fremre primer skulle varmebehandles til en region oppstrøms for målgenet. Den revers primer skulle varmebehandles i ORF, være ~ 40 nukleotider i lengde, og inneholder den ønskede mutasjon (er) et eller annet sted i midten av det (se figur 1B-1 og Representative resultater seksjon for eksempler). Bruken av en high fidelity DNA polymerase er anbefalt for å redusere forekomsten av uønskede mutasjoner under syntesen av PCR-produktene.
      2. For å generere PCR-produkter som tilsvarer den andre halvdel av genet (produkt B i figur 1 B), å sette opp en reaksjon som angitt i 2.1.1.1, men med forskjellige primere.
        MERK: fremover primer skulle varmebehandles i ORF, være ~ 40 nukleotider i lengde, og inneholder den ønskede mutasjon (er) et eller annet sted i midten av den. Legg merke til at mutasjonen (e) i denne primeren er det omvendte komplement av mutasjonen (e) i den reverse primeren i trinn 2.1.1.1. Det motsatte primer skulle varmebehandles til en region nedstrøms av målet genet (se Figur 1B-en og Representative Resultater seksjon for eksempler).
    2. Plasser reaksjoner i en termo med følgende innstillinger: 94 ˚C 30 sekunder; 30 sykluser av følgende innstillinger: 98 ˚C 10 sek, 60 ˚C 5 sek, 72 ˚C 1,5 min; og 72 ˚C 10 min.
      Merk: Optimalisering av PCR-parametre kan være nødvendig for spesifikke primersett og målrette histon genet.
  2. Kjør 20 - 50 pl av materialet fra PCR-reaksjonene på en 0,9% lavt smeltepunkts agarosegel i 89 mM Tris-base, 89 mM borsyre, 2,5 mM EDTA (TBE) buffer.
  3. Skjær agarosegel seksjoner som inneholder PCR products fra gelen ved anvendelse av en ren skalpell eller barberblad og overføre hver til et 1,5 ml mikrosentrifugerør. Oppbevar agarose seksjoner som inneholder PCR produktene ved -20 ˚C til den er klar til bruk.

3. Fusion PCR av de to delvis overlappende fragmenter å oppnå full størrelse PCR produkter for integrering

  1. Forbered mal for PCR reaksjoner
    1. Smelt agarosegel seksjoner fra trinn 2.3 ved å plassere mikrosentrifugerør i en varmeblokk sett ved 65 C i 5 minutter (eller inntil fullstendig smeltet). Vortex-rør hver 1 - 2 minutter for å lette smelteprosessen.
    2. Overføre en bestemt mengde smeltet agarose fra hver prøve (for eksempel 50 ul hver, for en total på 100 ul) i en enkelt mikrosentrifugerør og bland ved virvling. Bruk dette som mal i fusjons PCR reaksjoner. Plasser røret ved -20 ˚C til den er klar til bruk.
  2. Amplifisere en stor mengde av full størrelse PCR-produkt (produkt ci figur 1B)
    1. Satt opp seks PCR-reaksjoner, hver med de følgende komponenter: 2 pl templat-DNA, 10 ul 10 uM forover primer, 10 pl 10 pM revers primer, 1 pl (2,5 U) termostabil DNA-polymerase, 20 ul 5x DNA-polymerase-buffer, 10 ul dNTP-blanding (2 mM hver), og 47 ul dH 2 O.
      MERK: antall reaksjoner kan endres avhengig av PCR effektivitet. Templat-DNA (se 3.1.2) bør være oppvarmet til 65 ° C inntil smeltet, blandet ved virvling, og tilsatt til slutt for å PCR-reaksjonsblandingen. Når lagt, bland forsiktig, men grundig ved pipettering løsningen opp og ned flere ganger. Å ta hensyn til variasjoner i DNA-konsentrasjonen i de forskjellige prøver, anbefales det først å optimalisere reaksjonene ved hjelp av enten ufortynnet mal eller forskjellige fortynninger av malen (f.eks 1:10 og 1: 100). De to primerne som brukes skulle varmebehandles med de to delvis overlappende fragmenter av målgenet som sykustrated i figur 1B-2 og være utformet slik at de endelige PCR-produktene vil ha minst 40 basepar på hver side homologe med regionene som flankerer URA3 ORF som vil drive den homologe rekombinasjon trinnet (se Representative resultater seksjon for eksempler). Bruken av en high fidelity DNA polymerase er anbefalt for å redusere forekomsten av uønskede mutasjoner under syntesen av PCR-produktene.
    2. Plasser rørene i en thermocycler med følgende innstillinger: 94 ˚C 30 sekunder; 30 sykluser av følgende innstillinger: 98 ˚C 10 sek, 50 ˚C 15 sek, 72 ˚C 1,5 min; og 72 ˚C 10 min.
      MERK: Optimalisering av PCR-parametre kan være nødvendig for spesifikke primer sett og målet histone genet.

4. Samtidig transformasjon av Full Size PCR-produkter og Backbone Plasmid, og Utvalg for Marker på Plasmid

  1. Konsentrasjon av PCR-produkter
    1. Pool de six PCR reaksjoner (600 mL totalt) fra trinn 3.2.2 til en enkelt mikrosentrifugerør og bland ved virvling.
    2. Dele prøven i tre 200 pl prøver i mikrosentrifugerør. Utfelling av DNA i hvert rør ved å tilsette 20 ul av 3 M natriumacetat (pH 5,2) og 550 pl 100% etanol. Bland løsningen grundig og legg på is i minst 15 min. Samle-DNA ved sentrifugering ved ~ 14 000 xg i 10 minutter, skyll pellet med 200 ul 70% etanol og lufttørke.
    3. Resuspender hver DNA-pellet i 25 ul av dH 2 O, og basseng inn i et enkelt rør (for en total av 75 ul).
  2. Gjær co-transformasjon
    1. Forbered 10 ml over natten kultur av stammen som genereres i § 1 i gjærekstrakt Pepton Druesukker (YPD) flytende medium 11.
    2. Den følgende morgen, inokuler 400 ml av YPD flytende medium med 8 ml av den mettede natten kultur og inkuberes ved ristingved 30 ° C i 4 - 5 timer for å tillate cellene til å gå inn logaritmisk vekstfase.
    3. Samle cellene ved sentrifugering ved ~ 3220 xg i 10 minutter, kaste det flytende medium, og resuspender cellene i ett volum av 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 M litiumacetat oppløsning (TE / LiAc) .
    4. Samle cellene ved sentrifugering ved ~ 3220 xg i 10 min, og kast TE / LiAc.
    5. Resuspender cellene i 1 ml TE / LiAc.
    6. Sette opp følgende reaksjons cocktail i et mikrosentrifugerør: 800 ul av celler fra trinn 4.2.5, 40 ul kokt 10 mg / ml laksesperm DNA, en total på 12,5 ug av ryggraden plasmid-DNA, og 75 ul av PCR-produktet konsentrert fra trinn 4.1.3.
      MERK: laksesperma-DNA bør kokes i 5 minutter og plassert på is i minst 5 minutter før anvendelse i reaksjonen. Totalt volum av ryggraden plasmid-DNA som tilsettes bør holdes på et minimum (~ 80 mL eller mindre). Se Representant Resultater seksjon for et eksempel på en ryggrad plasmid.
    7. Bland cocktail rør grundig og delmengde jevnt i åtte Mikrosentrifugerør (Rør 1-8).
    8. Sett opp følgende to kontroll transformasjon reaksjonsrørene:
      1. Rør 9 (PCR produkt kontroll): 100 ul celler fra trinn 4.2.5, 5 ul av kokt 10 mg / ml laksesperm DNA (kokt i 5 minutter; se trinn 4.2.6 note), totalt 1,56 ug ryggrad plasmid-DNA, og ikke i noe PCR-produkt ble tilsatt.
      2. Røret 10 (ingen DNA-kontroll): 100 ul celler fra trinn 4.2.5, 5 mL av kokt 10 mg / ml laksesperm DNA (se trinn 4.2.6 note), ingen ryggrad plasmid-DNA tilsatt, og ikke noe PCR-produkt ble tilsatt.
      3. Bland begge rør forsiktig, men grundig ved å pipettere opp og ned flere ganger.
    9. Inkuber rørene ti ved 30 ° C i 30 min.
    10. Til hvert rør, tilsett 1,2 ml 40% polyetylenglykol (PEG 3350) i TE / LiAc. Bland grundig ved anvendelse av en P-1000 pipette inntil oppløsningen er homogen.
    11. Inkuber ti rør ved 30° C i 30 min. Bland forsiktig oppløsningen ved å pipettere opp og ned, og deretter inkuberes rørene ved 42 ° C i 15 min.
    12. Samle cellene ved å spinne rørene i en mikrosentrifuge ved ~ 14 000 xg i 30 sek. Kast væske og resuspender cellene i 1 ml steril dH 2 O.
    13. Samle cellene ved å spinne rørene i en mikrosentrifuge ved ~ 14 000 xg i 30 sek. Kast væske og resuspender cellene i 500 pl sterilt dH 2 O.
    14. Pool rør 1 - 8 sammen (totalt volum på 4 ml) og blandes grundig ved pipettering opp og ned.
    15. Plate 200 ul av den ovennevnte blanding på hver av tyve komp minimal frafall mellomplater 11 (plater 1-20) for valg av ryggraden plasmidet.
    16. Plate 200 pl av blandingen fra røret 9 og 200 pl av blandingen fra undergrunns 10 hver på sitt eget utvalg plate (plater 21 og 22, henholdsvis).
    17. Inkuber platene ved 22 30 ° C i 3 - 5 dager tilVelg for plasmid trans.
    18. Inspiser transformasjon plater etter 3 - 5 dagers inkubasjon. Omtrent 5.000 kolonier skal være synlig på tallerkener 1-21 (se Representative Resultater for et eksempel), og ingen kolonier bør være til stede på plate 22.

5. Screen for 5-FOA-resistente Trans

  1. Overfør cellene fra platene 1 - 20 (og transformasjon plate 21 som en kontroll) for å 5-fluororotinsyre (5-FOA) plater 11 ved replika-plating 12 for å screene for tap av URA3-genet som et resultat av integrering av PCR-produkter på ønsket sted.
    1. Ta av platen lokket og trykk på plate som inneholder kolonier på et sterilt fløyel. Overfør cellene fra fløyel til en 5-FOA plate ved å trykke platen på fløyel. Inkuber platene ved 30 C i 2 dager.
  2. Etter to-dagers inkubasjonstid, nøye inspisere 5-FOA plater for growth.
    MERK: En kandidat integrering arrangementet vil være representert ved en liten asymmetrisk "knust" koloni på en 5-FOA plate - omvendt, små papiller vokser på 5-FOA platene er trolig representativ for spontane URA3 mutasjoner som oppsto under veksten av kolonier på transformasjon plater, og er dermed lite sannsynlig å representere den ønskede integrasjon hendelse (se figur 3 i representant Resultater seksjon for ytterligere utdypning på dette punktet, og for noen eksempler).

6. Rensing av 5-FOA-resistente kolonier og tap av Backbone Plasmid

  1. Ved hjelp av sterile tannpirkere, plukke kandidat kolonier fra de fem-FOA plater som er beskrevet i trinn 5,2 og strek for enkeltkolonier på YPD plater. Inkuber i 2 - 3 dager ved 30 ° C.
  2. Etter inkubering replika - plate hver YPD rensning plate til en ny YPD-plate, en drop-out plate mangler uracil for å kontrollere tapav URA3-genet, og et andre rulle ut plate for å overvåke med hensyn til nærvær eller fravær av ryggraden plasmidet. Inkuber i 1 - 2 dager ved 30 ° C.
  3. Etter inkubasjon identifisere en koloni fra hver kandidat prøve som vokser på YPD plate, men ikke vokser på enten drop-out plate (for eksempel en koloni forventes å ha mistet URA3 genet gjennom rekombinasjon arrangementet og mistet ryggraden plasmid under mitotisk celledeling). Restreak slike kolonier på nye YPD plater. Disse koloniene er integrerings kandidater og skal analyseres videre i trinn 7.

7. Molekylære analyser til analyse for riktig Integrering av Mutant Allele

  1. Isolere genomisk DNA fra kandidat prøver ved hjelp av standardprosedyrer 10.
  2. Forsterke genomisk region som omfatter målstedet.
    1. Sett opp følgende PCR reaksjon for hver prøve: 0,5 mL mal DNA, 5 pl10 uM forover primer, 5 ul 10 uM revers primer, 0,5 pl (2,5 enheter) Taq DNA-polymerase, 5 ul 10X Taq DNA-polymerase-buffer, 5 ul dNTP-blanding (2 mM hver), og 29 ul dH 2 O.
      MERK: Mal DNA er genomisk DNA avledet fra kandidatprøver. Det anbefales å også inkludere to kontroll reaksjoner: en som bruker genomisk DNA som stammer fra de opprinnelige histone geneΔ :: URA3 belastning som mal og en annen ved hjelp av genomisk DNA fra en vill-type histone belastning som mal. Å ta hensyn til variasjoner i DNA-konsentrasjonen og graden av urenheter i forskjellige genomiske preparater, er det anbefalt å optimalisere reaksjonene ved hjelp av enten ufortynnet DNA eller forskjellige fortynninger av de genomiske preparater (f.eks 1:10 og 1: 100). Det er viktig å sørge for at disse primere glødning til DNA-sekvenser utenfor det område som omfattes av putatively integrert PCR-produkt - denne måte størrelsen av PCR-produktene i disse reactions kan brukes som et diagnostisk verktøy for integrering av produktene på den riktige genomisk posisjon (se Representative resultater for et eksempel).
    2. Sett reaksjoner i en termo med følgende innstillinger: 94 ° C 3 min; 30 sykluser av følgende innstillinger: 94 ° C 45 sek, 50 ° C 45 sek, 72 ° C 2 min; 72 ° C og 10 min.
      MERK: Optimalisering av PCR-parametre kan være nødvendig for spesifikke primer sett og målet histone genet.
  3. Behandling av PCR-produkter
    1. Kjør 20 ul fra hver reaksjon på en 0,8% TBE agarosegel.
    2. Vurdere størrelsen av PCR-produkter ved hjelp av DNA-standarder som en referanse for å bestemme om den URA3-genet har blitt erstattet av putatively muterte histon-genet (se Representative resultater for et eksempel).
      MERK: i visse tilfeller den ønskede mutasjon (er) innføres i histpngenene enten opprette eller ødelegger et restriksjons sittee. Dersom dette er tilfelle, kan tilstedeværelsen av den ønskede mutasjon i PCR-produktene fra den størrelse som angir riktig integrasjon vurderes ved å utsette produktene for spalting med det tilsvarende restriksjonsenzym fulgt av gel-elektroforese-analyse (se Representative resultater for et eksempel) .
    3. Lagt PCR-produkter av den størrelse som angir riktig integrasjon til DNA-sekvensering for å bekrefte tilstedeværelsen av den ønskede mutasjon (er) og for å sikre at ingen andre mutasjoner har blitt introdusert i genomet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi beskriver generering av en hht2 allel som uttrykker en histon H3 mutant protein huse et bytte i posisjon 53 fra en arginin til en glutaminsyre (H3-R53E mutant) som et representativt eksempel på målrettet in situ mutagenese strategi.

Vi ga en stamme hvor hele ORF av HHT2 erstattes med URA3-genet (se trinn 1 av protokollen). Denne belastningen, yAAD156, havner også en his3Δ200 allel, som fører til at cellene til å være auxotrofe for histidin. Ved å følge fremgangsmåten som er angitt i trinn 2 i protokollen, vi deretter genereres de to delvis overlappende fragmenter av HHT2. Følgende primere ble brukt for første fragment: Spiss Primer (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' og omvendt Primer (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. Følgende primers ble brukt for den andre fragment: forover primer (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' og revers primer (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Merk at Reverse Primer i den første reaksjonen og Forward Primer i den andre reaksjons inneholder de ønskede muterte nukleotider (i store bokstaver) - disse muterte nukleotider er plassert i mellom to lange strekninger av vill type sekvenser, da dette gir mulighet for effektiv avspenning av primeren til templatet DNA til tross for mistilpasning ved de muterte posisjoner. Merk også at de muterte nukleotider i de to primerne er reverse komplementære til hverandre og føre til en AG å GA mutasjon i senstråden, hvilket resulterer i et AGA GAA til kodonet forandring, som til slutt frembringer den R53E mutasjon i det kodede protein. Resultatene fra disse PCR-reaksjonene er vist i figur 2A.

Ved hjelp av fremgangsmåten i trinn 3, vi så Gener rerte i full størrelse PCR produktene. Primerne som ble brukt var Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'og revers primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Ved utforming av disse primere, er det viktig å sørge for at de resulterende fusjons PCR-produkter inkluderer minst 40 basepar på begge ender for å drive homolog rekombinasjon reaksjonen (jo lenger de homologe regioner, er mer effektive og spesifikke de homologe rekombinasjonshendelser vil være). I vårt eksperiment, i full størrelse PCR-produktene inneholdt et 195 basepar region og 220 basepar region homolog til regionene oppstrøms og nedstrøms for HHT2 ORF, respektivt. En prøve av disse PCR-produkter ble analysert ved agarosegelelektroforese (Figur 2B).

I full størrelse PCR produktene ble deretter co-transformert med plasmidet pRS413 (en centromeric, HIS3- merket plasmidf "> 13) og transformanter ble utvalgt på plater som mangler histidin (SC-His plater) som beskrevet i trinn 4 av protokollen. His + kolonier ble deretter undersøkt med hensyn 5-FOA motstand følge prosedyrene beskrevet i trinn 5 av protokollen. Figur 3 viser et eksempel på en transformasjon plate (SC-his) og 5-FOA-plater følgende replica-utplating fra SC-traff platene. Eksempler på kandidatprøver, samt prøver usannsynlig for å representere de ønskede integrering hendelser er også presentert i figur 3 . i vårt eksperiment, identifiserte vi tolv kandidatprøver av ~ 90.000 trans skjermet. Disse kandidatene ble deretter renset som beskrevet i trinn 6 av protokollen.

De tolv kandidater ble så underkastet PCR-analyse som er beskrevet i trinn 7 av protokollen for å vurdere om de reflekterte autentiske utskiftninger av URA3-genet med mutant-PCR-produkter. For våre experiment, anvendte vi en forover primer som hybridiserer 89 basepar oppstrøms fra integreringssete av PCR-produktet, og en revers primer som hybridiserer 302 basepar nedstrøms fra integreringssete av PCR-produktet. Disse primere generere PCR-produkter av 1217 basepar i størrelse hvis HHT2 locus er okkupert av HHT2 (eller muterte versjoner av HHT2 huser basepar-erstatninger), eller PCR-produkter av 2188 basepar i størrelse hvis locus er okkupert av URA3 markørgenet . Sekvensen av Forward Primer brukes (OAD476) er: 5 'GAAACTATTGGCACGCCCTA og at av Reverse Primer brukes (OAD477) er: 5' CCTGCGAATCAACCGATACT 3 '. Av de tolv kandidatene vi hadde identifisert, fire viste integrering av et PCR-produkt på riktig sted (se figur 4A for et eksempel). Til slutt, siden den AG å GA mutasjon genererer et nytt EcoRI-restriksjonssete, vi kastet PCR-produkter fra en av de vellykkede integrasjons prøvene til en figur 4B). I dette spesielle tilfellet har vi ikke sekvensere PCR-produkter for å sikre at ytterligere uønskede mutasjoner hadde blitt inkorporert i genomet: har vi imidlertid brukt en fremgangsmåte meget lik denne for å generere et stort antall HHT2 mutasjoner i en tidligere studie 14, og fant at flertallet av de integrerte mutante alleler bære ingen andre enn de aktuelle meldingene mutasjoner.

Figur 2
Figur 2: Generering av PCR produkter huse Ønsket Mutasjoner for Integrering i gjær Genome. (A) PCR-reaksjon for å generere de delvis overlappende fragmenter av HHT2 huser de ønskede mutasjoner. Øverst: tegneserie representasjon av than to PCR reaksjoner for å få de to HHT2 fragmenter (se Figur 1B-1). Røde sirklene representerer de umake nukleotider på primerne anvendt for å innføre den AG å GA mutasjon i den forstand tråd av genet. Nederst: gel elektroforese analyse av PCR-produkter A og B (spor 2 og 3, henholdsvis). DNA-standarder er vist i felt 1. (B) Fusion PCR-reaksjon for å generere i full størrelse PCR-produkt som skal integreres i gjærgenomet (se Figur 1B-2 og 3). Øverst: tegneserie representasjon av PCR-reaksjonen og forventede PCR-produkt (produkt C). Røde sirkler representerer ønskede mutasjonen som beskrevet i (A) ovenfor. Nederst: gel elektroforese analyse av PCR-produkter c (kolonne 2). DNA-standarder er vist i kjørefelt 1. Klikk her for å se en større versjon av dette tallet.


Figur 3: Representative Resultater fra Co-transformasjon Experiment og 5-FOA Screen. Venstre: representant SC-hans plate belagt med celler utsatt for co-transformasjon prosedyre etter en 3-dagers inkubasjon ved 30 ° C. Omtrent 5000 kolonier ble tellet. Midten: representant 5-FOA plate følgende replica-plating fra en SC-hans co-transformasjon plate etter en 2-dagers inkubasjon ved 30 ° C. Prøvene 1 og 2 ble ansett som kandidater for å ha gått gjennom en vellykket integrasjon hendelse på grunn av deres asymmetriske morfologi. Dette er fordi en sann erstatning av URA3-genet med hht2 allelet er sannsynlig å oppstå før (eller svært snart etter) en transformert celle blir sådd ut på SC-tallerkenen og, som et resultat av kolonien som vil oppstå på dette stedet vil inneholde det meste, om ikke utelukkende, 5-FOA-resistanT-celler - når en slik koloni er deretter senere replica-overført til en 5-plate FOA det vil bli knust, gir opphav til en asymmetrisk utseende lapp av celler på platen. Omvendt, spontan mutasjoner i URA3-genet som kan oppstå i løpet av kolonidannelse er mer sannsynlig å være begrenset innenfor et lite område av en koloni, og således mer sannsynlig å gi opphav til papiller når replica-overført til en 5-FOA plate. Høyre: en annen representant 5-FOA plate følgende replica-plating fra en SC-hans co-transformasjon plate etter en 3-dagers inkubasjon ved 30 ° C. En ytterligere kandidat (prøve 3) samt to små papiller er synlige på denne plate (prøver 4 og 5) - som for papiller, som er mest tydelig synlig etter 3 eller flere dagers inkubasjon, er egnet til å representere spontane URA3 mutasjoner og ikke ønsket integrasjon hendelsen. Klikk her for å seen større versjon av dette tallet.

Figur 4
Figur 4: Molekylære analyser av Kandidat Integrasjons Samples. (A) PCR-analyse for å identifisere vellykkede integrering hendelser. Top: tegneserie representasjoner av PCR reaksjoner brukes til å vurdere vellykket integrering av hht2 mutant allel i genomet. Nederst: gel elektroforese analyse av PCR-reaksjoner ved bruk av genomisk DNA avledet fra et HHT2 villtypestamme (anvendt som en kontroll, spor 2), husing belastning yAAD156 den hht2Δ :: URA3 erstatning (anvendt som en kontroll, spor 3), en kandidat integrering prøve (felt 4), og en 5-FOA-resistente papiller prøven (og således neppe å representere en riktig integrering hendelse, spor 5). DNA-standarder er vist i kjørefelt 1. Merk at størrelsen på PCR-produkter for kandidaten integrering prøven er consistent med en vellykket integrering arrangement, mens størrelsen av PCR-produktene for papiller prøven er forenlig med en intakt hht2Δ :: URA3 locus. (B) Eco RI fordøyelsen å bekrefte tilstedeværelse av mutant allel. Øverst: tegneserie representasjon av de forventede fordøyelses fragmentene avledet fra en EcoRI-fordøyelse omsetning av PCR-produkter inneholdende enten villtype HHT2 genet eller det mutante allel hht2. Nederst: gel elektroforese analyse av fordøyelses reaksjoner av PCR-produktene avledet fra en vill-type HHT2 stamme (spor 2; PCR-produktene er brukt her var avledet fra den samme prøve som ble brukt i kolonne 2 i panel A) og en kandidat integrering prøve ( spor 3, PCR-produktene er brukt her var avledet fra den samme prøve som ble brukt i spor 4 i panel A). DNA-standarder er vist i felt 1. Merk at fordøyelsen mønstre bekrefter at AG å GA mutasjon har blitt introdusert i genomet til kandidatintegrasjon prøven. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den høye grad av sekvenshomologi mellom de to ikke-alleliske gener som koder for hver av de fire kjerne histonproteinene i haploide S. cerevisiae-celler kan representere en utfordring for forskere som ønsker å spesifikt mot en av de to gener for mutagenese. Tidligere beskrevet gjær mutageneseteknikker metoder, inkludert Delitto Perfetto, setespesifikk genomisk (SSG) mutagenese, og kloning-fri PCR-baserte allelet erstatning metoder 5, 6, 7, så vel som mer nylig gjær CRISPR-baserte teknikker 15, er ofte avhengige i det minste delvis på sekvenser innenfor ORF av et målgen for å rekruttere rekombinasjon eller reparasjon machineries til den ønskede genomiske sete for til slutt å generere den siste mutant allel. På den annen side, den strategi som er presentert her gjør bruk av DNA-sekvenser som flankerer den målrettede ORF for å drive homologooss rekombinasjon som kreves for integrering av mutasjonen, og, som et resultat, gir mulighet for mer spesifikk målretting av et gen over en annen til tross for de to gener har meget homologe ORF. Denne funksjonen gjør vår strategi spesielt godt egnet for histone mutagenese. Imidlertid kan denne strategien også tilpasses for mutagenese av andre gener i gjær genomet.

Ytterligere trekk ved vår strategi omfatter det faktum at lengdene av de regionene som driver homolog rekombinasjon av de mutante gener kan være utformet for å være meget omfattende, og dermed øke effektiviteten av integrering på målet genomisk sted, og at i tillegg til den ønskede mutasjonen (e ) uten ytterligere DNA-sekvenser innføres i genomet. En ytterligere fordel med dette systemet er at når en belastning husing erstatning av et bestemt histon-genet med URA3 er konstruert, kan den brukes for generering av hvilken som helst ønsket mutant versjon av den aktuelle histen genet. Derfor, for eksempel, belastning yAAD156, som er tilgjengelig for forskersamfunnet på forespørsel, kan brukes til å gjøre noen ønsket hht2 mutasjon uten behov for å konstruere en de novo hht2Δ :: URA3 allel. Til slutt, ved hjelp av riktig utformet PCR-primere, denne strategien kan også brukes til å generere histon lene med indre delesjoner eller med mutasjoner ved flere kodoner, så lenge de er forholdsvis nær hverandre (for eksempel, vi har generert et hht2 allelet som koder for et H3-K56R, L61W dobbel mutant protein ved hjelp av denne strategien).

Evnen til å spesifikt mot en av to sterkt homologe histon gener for mutagenese kan være nyttig i en rekke forskjellige eksperimentelle innstillinger. For eksempel, siden de HHT1-HHF1 genene kommer til uttrykk på ulike nivåer i forhold til de HHT2-HHF2 gener 16, kan det være av interesse å finne ut om en bestemt H3 eller H4 mutasjonen medfører different fenotyper avhengig av hvilket gen det blir uttrykt fra. Et annet eksempel er et scenario hvor en undersøker ønsker å generere haploide celler som uttrykker et bestemt histon mutant fra begge korresponderende histpngenene - dette kunne oppnås ved først å mutagenisering hvert gen uavhengig av hverandre i to forskjellige stammer, og deretter å skaffe doble mutante haploide celler gjennom et kryss og etterfølgende isolering av de ønskede meiotisk produkter. Et annet eksempel vedrører mutagenese av histoner H2A og H2B: gitt det faktum at to litt forskjellige isoformer av hvert protein blir kodet av det tilsvarende ikke-allelisk gen set, kan en undersøker ønske å vurdere virkningene av en spesifikk H2A eller H2B mutasjon i sammenheng med enten isoformen. Ved utforming eksperimenter for å mutagenisere den HTA1 og HTB1 loci (koding H2A og H2B, henholdsvis), bør etterforskere være klar over de siste resultatene viser at stammer bærer en (hta1-htb1) Δ er levedyktig bare jegf de har forsterket HTA2-HTB2 locus (og nærliggende HHT1-HHF1 locus i tillegg) gjennom generering av en liten rund kromosom 17, da dette kan komplisere tolkningen av resultatene.

Vi har nylig brukt en versjon av denne histon mutagenese strategi for å generere histon H3-proteiner som uttrykker alle mulige aminosyresubstitusjoner ved posisjon 61, som normalt er opptatt av aminosyren leucin 14. For disse eksperimentene, i stedet for å bruke yAAD156 som utgangs belastning for mutagenese benyttet vi belastning yADP106, som huser en erstatning av HHT2 ORF med både URA3 og TRP1 ernæringsmessige markører (i stedet for bare URA3). Tilstedeværelsen av både markørgener muliggjort identifisering av kandidater for integrering av de mutante PCR-produktene etter den 5-FOA skjerm og rensetrinn (trinn 5 og 6 i protokollen), som sådan candidates ble fenotypisk Ura - og Trp -, mens spontan URA3 mutasjon resulterte i celler med en Ura - Trp + fenotype. yADP106 er også tilgjengelig på forespørsel, som er sekvensen av URA3-TRP1 kassett, som kan bli forsterket som en enhet og anvendt for mutagenese av andre histongenene ved hjelp av strategien som er beskrevet heri.

Manglende evne til å oppnå de ønskede histon mutanter ved hjelp av denne strategi kunne tilskrives en rekke mulige årsaker, inkludert utilstrekkelig mengde av full størrelse av PCR-produkter som benyttes for integrering trinnet eller et utilstrekkelig antall av transformanter etter ko-transformasjonen trinn. Den førstnevnte problemet kunne løses ved å samle sammen større sett av PCR-reaksjoner eller ved å utforme forskjellige primersett som frembringer et høyere utbytte av produkt, mens det sistnevnte problemet kunne løses ved anvendelse av høyere mengder av ryggraden plasmid i den ko-transformasjonen eksperiment. AlthoHuff, som tidligere angitt, kan man bruke denne fremgangsmåten til å generere histon mutanter som bærer to eller flere aminosyresubstitusjoner, målrettede aminosyrer har til å være relativt nær hverandre ettersom de respektive kodoner trenger å være plassert innenfor den samme primer-molekyl. Således, denne strategien kan ikke lett tilpasses for generering av histoner med flere mutasjoner som ligger fjernt fra hverandre over lengden av proteinene.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
målrettet<em&gt; I Situ</em&gt; mutagenese av Histone Gener i Budding Gjær
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter