Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Visadas doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os quatro proteínas histonas centrais H2A, H2B, H3, H4 e desempenham papéis centrais na compactação, organização e função dos cromossomas eucarióticos. Dois conjuntos de cada uma destas histonas formar o octâmero da histona, um carretel molecular que dirige o invólucro de ~ 147 pares de bases de ADN em torno de si, resultando na formação de um nucleossoma 1. Nucleossomas são agentes activos numa variedade de processos à base de cromossomas, tais como a regulação da transcrição de genes e a formação de eucromatina e heterocromatina entre cromossomas, e, como tal, têm sido o foco de intensa investigação ao longo de várias décadas passadas. Um número de mecanismos têm sido descritos por nucleossomas que podem ser manipulados em formas que podem facilitar a execução dos processos específicos - estes mecanismos de modificação pós-tradução incluem os resíduos de histonas, remodelar nucleossoma dependente de ATP, e reorganização nucleossoma ATP-independentee montagem / desmontagem 2, 3.

A levedura de germinação Saccharomyces cerevisiae é um organismo particularmente poderoso modelo para a compreensão da função da histona em eucariotas. Isto pode ser em grande parte atribuído ao elevado grau de conservação evolutiva das proteínas histona eukarya todo o domínio e a receptividade de levedura para uma variedade de genética e bioquímica experimental aproxima 4. abordagens Reverse-genéticos nas leveduras têm sido amplamente utilizada para estudar os efeitos de mutações específicas de histona sobre vários aspectos da biologia da cromatina. Para estes tipos de experiências é frequentemente preferível a utilização de células em que as histonas mutantes são expressos a partir de loci genómico nativo, como a expressão a partir de plasmídeos autónomos podem levar a níveis anormais intracelular de proteínas histona (devido a diferentes números de plasmídeos em células) e alteração concomitante da cromatina enam-, que em última instância pode confundir a interpretação dos resultados.

Aqui, nós descrevemos uma técnica baseada em PCR que permite a mutagénese direccionada de genes de histonas nas suas localizações genómicas nativas, que não requerem um passo de clonagem e resulta na produção da mutação (ões) desejada, sem sequências de ADN exógeno que sobram no genoma. Esta técnica tira proveito do sistema de recombinação homóloga eficiente em levedura e tem várias características em comum com outras técnicas semelhantes desenvolvidas por outros grupos - mais notavelmente o Delitto Perfetto, genômica mutagénese específica (SSG), e alelo à base de PCR clonagem-livre métodos de reposição de 5, 6, 7. No entanto, a técnica que descrevem tem um aspecto que o torna particularmente adequado para a mutagénese de genes de histonas. Em células de levedura haplóides, cada um dos quatro histonas nucleares é codificada por dois não-Agenes llelic e altamente homólogas: por exemplo, histona H3 é codificado pelos genes HHT1 e HHT2, e as grelhas de leitura abertas (ORFs) dos dois genes são mais de 90% idênticos na sequência. Este elevado grau de homologia pode complicar experiências concebidas para visar especificamente um dos dois genes codificadores de histonas para mutagénese. Considerando que os métodos acima mencionados exigem frequentemente a utilização de, pelo menos, algumas sequências dentro da ORF do gene alvo para dirigir recombinação homóloga, a técnica aqui descrita faz uso das sequências que flanqueiam as ORFs dos genes de histonas (que partilhem menos homologia de sequência) para o passo de recombinação, aumentando assim a probabilidade de sucesso de mutagénese direccionamento ao local desejado. Além disso, as regiões homólogas que impulsionam a recombinação pode ser muito extensa, contribuindo para a eficiente recombinação homóloga alvo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

NOTA: A estratégia experimental para o alvo de mutagénese in situ do gene histona inclui várias etapas (resumidos na Figura 1). Estes passos incluem: (1) A substituição do gene alvo de histona com o gene URA3, (2) Geração e purificação de produtos de PCR correspondentes a dois fragmentos que se sobrepõem parcialmente do gene histona alvo utilizando iniciadores que albergam a mutação desejada (s), (3 ) fusão por PCR de dois fragmentos que se sobrepõem parcialmente de obter produtos de PCR completa tamanho para a integração, (4) co-transformação de produtos de PCR de tamanho completo e plasmídeo de esqueleto, e de selecção para o marcador no plasmídeo, (5) tela para-resistente a 5-FOA transformantes, (6) purificação de colónias resistentes a 5-FOA e perda de plasmídeo de esqueleto, e (7) as análises moleculares para ensaio de integração correcta do alelo mutante.

figura 1
in situ Mutagênese de Genes histona em brotamento levedura. Neste exemplo, o gene alvo é HHT2, mas qualquer outro gene de histona de núcleo também pode ser mutagenizados usando esta estratégia. Células de levedura haplóides (A) abrigar dois genes da histona-codifica H3 (HHT1 e HHT2) e dois genes que codificam para histona H4 (HHF1 e HHF2) dispostos como mostrado na figura (os genes HHT1 e HHF1 estão localizados no cromossoma II e o HHT2 e genes HHF2 estão localizados no cromossoma XIV - em cada caso, as setas apontam na direcção da transcrição). No primeiro passo do processo, a ORF do gene HHT2 é substituído com o gene URA3, dando origem a uma estirpe hht2Δ :: URA3. (B) Na parte 1, uma cópia de tipo selvagem do gene HHT2 a partir de uma amostra de ADN genómico é utilizado como molde para duas reacções de PCR para géneroste os dois fragmentos que se sobrepõem parcialmente do gene. O iniciador inverso para a primeira reacção inclui um ou mais nucleótidos desemparelhados (indicado por um círculo vermelho) que correspondem à mutação (ões) desejada a ser introduzida no genoma. O iniciador directo para a segunda reação tem a incompatibilidade equivalente em uma configuração complementar reversa (também indicado com um círculo vermelho). Os dois produtos de PCR gerados na parte 1 (produtos a e b) são então utilizados como moldes para PCR de fusão utilizando dois iniciadores que se ligam aos produtos a e b na forma mostrados na parte 2. Isto resulta na geração de PCR de tamanho completo produtos (produto C na parte 3) que abrigam a mutação desejada (s). (C) A estirpe hht2Δ :: URA3 é, em seguida, co-transformada com os produtos de PCR de tamanho completo e um plasmídeo de esqueleto (um plasmídeo HIS3- marcado neste exemplo), e as células são seleccionadas quanto à presença do plasmídeo (em meios carentes histidine neste exemplo). Os transformantes são então pesquisadas para 5-FOA resistência - células resistentes são candidatos a ter sido submetido a um acontecimento de recombinação homóloga conduz à integração do produto de PCR e a excisão do gene URA3, como mostrado. subsequente perda do plasmídeo de esqueleto por divisão mitótica da célula leva à histona desejada estirpe mutante final. Encontraram-se que a selecção do plasmídeo de esqueleto seguido por rastreio para resultados de resistência 5-FOA numa frequência muito mais elevada de identificação de eventos de integração correctos em comparação com a selecção directa em placas de 5-FOA, que principalmente identifica células que adquiriram mutações URA3 espontâneas. (Esta figura foi modificado a partir da referência 14). Por favor clique aqui para ver uma versão maior desta figura.

1. A substituição da histona do gene alvo com o gene URA3Gene

  1. Realizar padrão mediada por PCR de uma etapa de disrupção do gene substituindo a ORF do gene da histona-alvo com o gene URA3 de 8, 9.
    NOTA: O uso de células de levedura que transportam o ura3Δ0 é recomendada como esta mutação remove toda a ORF URA3 endógena, evitando assim a integração do produto de PCR para o gene URA3 locus de 8. Alternativamente, o gene de K. lactis URA3 pode ser utilizado eficazmente para a geração da substituição da histona em todo o fundo da URA3 como é funcional em S. cerevisiae, mas tem apenas homologia de sequência parcial com o gene URA3 de S. cerevisiae. A estirpe também deve ser auxotrófica para, pelo menos, um composto que irá permitir a selecção do plasmídeo de esqueleto na experiência de transformação (ver passo 4 deste protocolo). Este passo não é necessário se um alvo de histonas geneΔ :: URA3estirpe já está disponível.

2. Geração e purificação de produtos de PCR correspondentes a dois fragmentos que se sobrepõem parcialmente da histona do gene alvo utilizando iniciadores que albergam a mutação desejada (s)

  1. Gerar produtos de PCR correspondentes a dois fragmentos que se sobrepõem parcialmente de histona do gene alvo.
    1. Prepare a duas reacções de PCR como se segue:
      1. Para gerar produtos de PCR que corresponde à primeira metade do gene (produto A na Figura 1B), definir-se a reacção seguinte: 1 uL de ADN molde, 5 μl10 uM iniciador directo, 5 μl10 uM iniciador inverso, 0,5 ul (1,25 U) termoestável a polimerase de ADN, 10 uL de tampão de polimerase de ADN de 5x, 5 ul de mistura de dNTP (2 mM de cada), e 23,5 jil dH2O
        NOTA: O molde de ADN pode ser ADN genómico derivado de uma estirpe de tipo selvagem para o gene alvo de histona isolado utilizando pró padrãoprocedimentos 10. Para ter em conta as variações na concentração de ADN e nível de impurezas em preparações diferentes genómicas, recomenda-se a optimizar as reacções utilizando um ADN não diluído ou diferentes diluições das preparações genómicas (por exemplo, 1:10 e 1: 100). O iniciador directo deve hibridar com uma região a montante do gene alvo. O iniciador inverso deve emparelhar dentro do ORF, ser ~ 40 nucleotídeos de comprimento, e conter a mutação desejada (s) em algum lugar no meio disso (veja a Figura secção 1B-1 e resultados representativos para exemplos). A utilização de uma polimerase DNA de alta fidelidade é recomendado, a fim de reduzir as taxas de mutações indesejáveis ​​durante a síntese dos produtos de PCR.
      2. Para gerar produtos de PCR que corresponde à segunda metade do gene (b produto na Figura 1B), definir-se uma reacção, como indicado em 2.1.1.1, mas com diferentes iniciadores.
        NOTA: A pri frentemer devem emparelhar dentro do ORF, ser ~ 40 nucleótidos de comprimento, e contêm a mutação desejada (s), no meio do mesmo. Note-se que a mutação (s) neste iniciador é o complemento reverso da mutação (ões) na sequência iniciadora reversa no passo 2.1.1.1. O iniciador inverso deve hibridar com uma região a jusante do gene alvo (ver Figura secção 1B-1 e resultados representativos para exemplos).
    2. Coloque as reacções num termociclador com as seguintes definições: 94 ° C 30 s; 30 ciclos de as seguintes definições: 98 C 10 s, 60 ° C 5 segundos, 72 ° C 1,5 min; e 72 ° C 10 min.
      Nota: Optimização dos parâmetros de PCR pode não ser necessária para conjuntos de iniciadores específicos e alvo do gene da histona.
  2. Executar 20 - 50 ul do material a partir das reacções de PCR sobre um gel de agarose de baixo ponto de fusão a 0,9% em 89 mM de base Tris, ácido bórico 89 mM, 2,5 mM de EDTA (TBE) de tampão.
  3. secções de gel de agarose contendo a cortar PCR PRodutos de gel utilizando um bisturi ou lâmina de barbear limpo e transferir cada um para um tubo de microcentrífuga de 1,5 ml. Armazenar seções de agarose contendo produtos de PCR a -20 ° C até estar pronto para usar.

3. Fusão PCR dos dois fragmentos que se sobrepõem parcialmente obter Full Size produtos de PCR para a Integração

  1. Prepare modelo para reacções de PCR
    1. Derreter secções de gel de agarose do passo 2.3, colocando os tubos de microcentrífuga num conjunto de bloco de calor a 65 ° C durante 5 minutos (ou até totalmente fundido). tubos de vórtice cada 1 - 2 minutos para facilitar o processo de fusão.
    2. Transferir uma quantidade de agarose fundida a partir de cada amostra (por exemplo, 50 ul de cada, para um total de 100 ul) para um único tubo de microcentrífuga e misturar por vortex. Utilizar esta como molde nas reacções de PCR de fusão. Colocar o tubo a -20 ° C até estar pronto para usar.
  2. Amplificar uma grande quantidade de tamanho grande produto de PCR (produto cna Figura 1B)
    1. Defina-se seis reacções de PCR, cada um com os seguintes componentes: ADN molde 2 ul, 10 ul de 10 mM de iniciadores para a frente, 10 ul de 10 mM iniciador de sentido reverso, um ul (2,5 U) de polimerase de ADN termoestável, 20 de tampão de polimerase de ADN ul 5x, 10 ul mistura de dNTP (2 mM de cada), e 47 uL de dH 2 O.
      NOTA: O número de reacções pode ser alterada dependendo da eficiência da PCR. O ADN molde (ver 3.1.2) deve ser aquecido a 65 ° C até derreter, misturado por vórtex, e adicionado por último à mistura de reacção de PCR. Uma vez adicionado, misture delicadamente mas completamente por pipetagem a solução cima e para baixo várias vezes. Para ter em conta as variações na concentração de DNA nas diferentes amostras, recomenda-se a primeira optimizar as reacções usando um molde não diluído ou diferentes diluições do modelo (por exemplo, 1:10 e 1: 100). Os dois iniciadores utilizados devem emparelhar com os dois fragmentos que se sobrepõem parcialmente de o gene alvo como malustrated na Figura 1B-2 e ser concebido de tal modo que os produtos de PCR finais terão pelo menos 40 pares de bases de cada lado homóloga às regiões que flanqueiam o gene URA3 ORF que irá conduzir o passo de recombinação homóloga (ver a secção de resultados representativos para exemplos). A utilização de uma polimerase DNA de alta fidelidade é recomendado, a fim de reduzir as taxas de mutações indesejáveis ​​durante a síntese dos produtos de PCR.
    2. Colocar os tubos em um termociclador com as seguintes definições: 94 ° C 30 s; 30 ciclos de as seguintes definições: 98 C 10 seg, 50 C 15 seg, 72 ° C 1,5 min; e 72 ° C 10 min.
      NOTA: Optimização dos parâmetros de PCR pode não ser necessária para conjuntos de iniciadores específicos do gene alvo e histona.

4. Co-transformação da Full Size produtos de PCR e Backbone plasmídeo e selecção para Marcador no plasmídeo

  1. A concentração dos produtos de PCR
    1. Reúnem-se os sreações ix PCR (600 no total ul) a partir do passo 3.2.2 em um único tubo de microcentrífuga e misturar em vortex.
    2. Dividir a amostra em três 200 mL alíquotas em tubos de microcentrífuga. Precipitar o ADN em cada tubo por adição de 20 ul de acetato de sódio 3M (pH 5,2) e 550 ul de etanol a 100%. Misture a solução cuidadosamente e colocar em gelo durante pelo menos 15 min. Recolha de ADN por centrifugação a 14000 xg durante ~ 10 min, lavar o sedimento com 200 ul de etanol a 70%, e secar ao ar.
    3. Ressuspender cada pelete de ADN em 25 uL de dH2O, e reunir num único tubo (para um total de 75 uL).
  2. Levedura de co-transformação
    1. Prepare 10 ml de cultura durante a noite da estirpe gerado na seção 1 em extrato de levedura peptona dextrose (YPD) líquido do meio 11.
    2. Na manhã seguinte, inocular 400 ml de meio YPD líquido com 8 ml da cultura durante a noite saturado e incubar por agitaçãoa 30 ° C durante 4 - 5 h, para permitir que as células entram na fase logarítmica de crescimento.
    3. Recolher as células por centrifugação a ~ 3220 xg durante 10 min, descartar o meio líquido, e voltar a suspender as células em um volume de Tris-HCl a 10 (pH 8,0), EDTA 1 mM, solução 0,1 M de acetato de lítio (TE / LiAc) .
    4. Recolher as células por centrifugação a 3220 xg durante ~ 10 min, e o descarte de TE / LiAc.
    5. Ressuspender as células em 1 ml de TE / LiAc.
    6. Defina-se o seguinte cocktail de reacção num tubo de microcentrífuga: 800 ul de células a partir do passo 4.2.5, 40 ul de 10 mg de ADN de esperma de fervida / ml de salmão, um total de 12,5 ug de ADN plasmídeo de esqueleto, e 75 ul de produto de PCR concentrada a partir do passo 4.1.3.
      NOTA: ADN de esperma de salmão deve ser fervidas durante 5 minutos e colocada em gelo durante pelo menos 5 minutos antes de utilização na reacção. O volume total de ADN de plasmídeo de esqueleto adicionada deve ser mantido a um mínimo (~ 80 ul ou menos). Consulte a seção de resultados representativos para um exemplo de um plasma de backboneidentidade.
    7. Misture o tubo de cocktail completamente e alíquota de maneira uniforme em oito microtubos (tubos 1-8).
    8. Configurar as duas seguintes tubos de reacção de transformação de controle:
      1. Tubo 9 (sem controle de produto de PCR): 100 ul de células a partir do passo 4.2.5, 5 ul de 10 mg de ADN / ml de esperma de salmão fervido (fervida durante 5 min; ver passo 4.2.6 Nota), um total de 1,56 g de DNA plasmídeo backbone e nenhum produto PCR acrescentou.
      2. Tubo de 10 (sem controle de DNA): 100 ml de células a partir do passo 4.2.5, 5 mL de 10 mg mL DNA fervida / esperma de salmão (veja o passo 4.2.6 Nota), não plasmídeo backbone DNA adicionado, e nenhum produto PCR acrescentou.
      3. Misture os dois tubos suave mas completamente por pipetagem cima e para baixo várias vezes.
    9. Incubar os tubos de dez a 30 ° C durante 30 min.
    10. Para cada tubo, adicionar 1,2 ml de 40% de polietileno glicol (PEG 3350) em TE / LiAc. Misturar bem utilizando uma pipeta P-1000 até a solução ficar homogénea.
    11. Incubar os tubos a 30 dez° C durante 30 min. Misturar suavemente a solução pipetando para cima e para baixo e, em seguida, incubar os tubos a 42 ° C durante 15 min.
    12. Recolher as células por centrifugação dos tubos numa microcentrífuga a 14000 xg durante ~ 30 seg. Descartar o líquido e ressuspender as células em 1 ml de dH 2 O. estéril
    13. Recolher as células por centrifugação dos tubos numa microcentrífuga a 14000 xg durante ~ 30 seg. Descartar o líquido e ressuspender as células em 500 uL de dH 2 O. estéril
    14. tubos Piscina 1-8 juntos (volume total de 4 ml) e misture bem por pipetagem cima e para baixo.
    15. Placa de 200 ul da mistura anterior em cada um de vinte placas de meio completo mínima de evasão 11 (placas 1-20) para a selecção do plasmídeo de esqueleto.
    16. Placa 200 ul da mistura de tubo 9 e 200 mL de mistura de tubo 10 cada em seu próprio prato selecção (placas 21 e 22, respectivamente).
    17. Incubar as placas a 22 30 ° C durante 3 - 5 dias paraseleccionar os transformantes plasmídeo.
    18. Inspeccionar placas de transformação ao fim de 3 - 5 dias de incubação. Aproximadamente 5.000 colónias devem ser visíveis em placas de 1-21 (ver resultados representativos para um exemplo) e não colónias deve estar presente na placa 22.

5. Tela de transformantes resistentes à 5-FOA

  1. Transferência de células a partir de placas de 1 - 20 (e da placa de transformação 21 como um controlo) a 5-fluoroor�ico ácido (5-FOA) placas de 11 por réplica-plaqueamento 12, a fim de avaliar a perda do gene URA3 como um resultado da integração do os produtos de PCR no local desejado.
    1. Remover a tampa de placa e pressionar a placa contendo as colónias em um veludo esterilizado. Transferir as células a partir da placa de veludo com um 5-FOA, pressionando a placa sobre a veludo. Incubar as placas a 30 C durante 2 dias.
  2. Após a 2 dias de incubação, examine cuidadosamente as placas 5-FOA para growth.
    NOTA: Um evento de integração candidato será representada por um pequeno assimétrica de colónias "achatado" numa placa de 5-FOA - Por outro lado, pequenas papilas crescer em placas de 5-FOA são susceptíveis representante de mutações URA3 espontâneas que surgiram durante o crescimento de colónias na placas de transformação, e são, portanto, pouco provável para representar o evento de integração desejado (veja a Figura 3 na seção resultados representativos para posterior elaboração sobre este ponto e para alguns exemplos).

6. Purificação de colónias resistentes a 5-FOA e perda de plasmídeo Backbone

  1. Usando palitos estéreis, escolher as colônias candidatos das placas 5-FOA descritos no passo 5.2 e raia para as colónias individuais em placas de YPD. Incubar durante 2 - 3 dias a 30 ° C.
  2. Após a incubação, réplica - placa cada purificação de placa YPD a uma placa YPD fresco, uma placa de drop-out sem uracilo para verificar se há perdado gene URA3, e uma segunda placa de desistência para monitorizar a presença ou ausência do plasmídeo de esqueleto. Incubar durante 1 - 2 dias a 30 ° C.
  3. Após a incubação, identificar uma colónia de cada amostra candidato que está crescendo sobre a placa de YPD, mas não a crescer em cada placa de abandono (tal colónia é esperado que perderam o gene URA3 através do acontecimento de recombinação e perdido o plasmídeo de esqueleto durante mitótico divisão celular). Restreak tais colônias em placas de YPD frescos. Estas colónias são os candidatos de integração e será analisado ainda na etapa 7.

7. As análises moleculares para testar a integração adequada do Mutant Alelo

  1. Isolar o ADN genómico a partir de amostras candidatos utilizando procedimentos padrão 10.
  2. Amplificar a região genómica que engloba o local alvo.
    1. Configure a seguinte reação de PCR para cada amostra: 0,5 DNA template l, 5 ul10 uM de iniciadores para a frente, 5 ul de 10 mM iniciador inverso, 0,5 ul (2,5 unidades) de Taq ADN polimerase, 5 ul de ADN de Taq 10x tampão de polimerase, mistura de dNTP 5 ul (2 mM de cada), e 29 uL de dH 2 O.
      NOTA: ADN matriz é o DNA genómico derivadas das amostras candidatos. Recomenda-se a incluir também duas reacções de controlo: um utilizando ADN genómico derivados dos geneΔ histona originais :: URA3 estirpe como molde e outro utilizando ADN genómico de uma estirpe de histona de tipo selvagem como molde. Para ter em conta as variações na concentração de ADN e nível de impurezas em preparações diferentes genómicas, recomenda-se a optimizar as reacções utilizando um ADN não diluído ou diferentes diluições das preparações genómicas (por exemplo, 1:10 e 1: 100). É importante ter a certeza de que estes iniciadores emparelham com as sequências de DNA fora da região englobados pelo produto de PCR putativamente integrado - Deste modo, o tamanho dos produtos de PCR nos estes reactions pode ser utilizado como uma ferramenta de diagnóstico para a integração dos produtos no local genómico correcto (ver resultados representativos para um exemplo).
    2. Coloque as reacções num termociclador com as seguintes definições: 94 ° C 3 min; 30 ciclos de as seguintes definições: 94 ° C 45 s, 50 ° C 45 s, 72 ° C 2 min; e 72 ° C 10 min.
      NOTA: Optimização dos parâmetros de PCR pode não ser necessária para conjuntos de iniciadores específicos do gene alvo e histona.
  3. Processamento de produtos de PCR
    1. Executar 20 uL de cada reacção sobre um gel de agarose a 0,8% TBE.
    2. Avaliar o tamanho dos produtos de PCR utilizando padrões de ADN como uma referência para determinar se o gene URA3 foi substituída com sucesso pelo gene histona putativamente mutado (ver resultados representativos para um exemplo).
      NOTA: Em certos casos, a mutação desejada (s) introduzido nos genes da histona criar ou destruir uma restrição sentare. Se este for o caso, a presença da mutação desejada nos produtos de PCR do tamanho indicativo da correcta integração pode ser avaliada sujeitando os produtos de digestão com a enzima de restrição correspondente, seguido por análise de electroforese em gel (ver resultados representativos para um exemplo) .
    3. Os produtos de PCR do tamanho Assunto indicativo de integração correcta para a sequenciação de ADN para confirmar a presença da mutação desejada (s) e para garantir que não há mutações adicionais foram introduzidas no genoma.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Descrevemos a geração de um alelo hht2 expressando uma proteína mutante da histona H3 abrigando uma substituição na posição 53 a partir de uma arginina para um ácido glutâmico (H3-R53E mutante) como um exemplo representativo do alvo na estratégia de mutagénese in situ.

Geramos uma estirpe em que toda a ORF de HHT2 é substituído pelo gene URA3 (veja o passo 1 do protocolo). Esta estirpe, yAAD156, também abriga um alelo his3Δ200, o que faz com que as células a ser auxotrófica para a histidina. Seguindo o procedimento indicado no passo 2 do protocolo, que, em seguida, gerou os dois fragmentos que se sobrepõem parcialmente de HHT2. Os seguintes iniciadores foram utilizados para o primeiro fragmento: Iniciador para a frente (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' e o iniciador inverso (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. A sequência PRIMers foram utilizados para o segundo fragmento: Iniciador para a frente (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' e o iniciador inverso (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Note-se que o iniciador reverso na primeira reação ea Atacante Primer na segunda reação contêm os nucleótidos desejadas mutado (em minúsculas) - estes nucleotídeos mutantes são aninhado entre duas longas extensões de sequências do tipo selvagem, pois isso permite para o recozimento eficiente do iniciador com o molde de ADN, apesar do desfasamento nas posições mutantes. Além disso, note que os nucleótidos mutado na estes dois iniciadores são complementares inversa uns aos outros e causar uma mutação AG para GA na cadeia com sentido, o que resulta em uma mudança AGA GAA codão, que em última análise produzem a mutação R53E na proteína codificada. Os resultados destas reacções de PCR são mostrados na Figura 2A.

Utilizando o procedimento descrito no passo 3, que, em seguida, Gener ciado os produtos de PCR de tamanho completo. Os iniciadores utilizados foram: Iniciador para a frente (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'e iniciador reverso (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Ao conceber estes iniciadores, é importante ter a certeza que a fusão produtos de PCR resultantes incluem, pelo menos, 40 pares de bases em cada termina para conduzir a reacção de recombinação homóloga (quanto mais as regiões de homologia, os mais eficazes e específicos os eventos de recombinação homóloga será estar). Na nossa experiência, os produtos de PCR de tamanho completo continha uma região de 195 pares de bases e 220 pares de base região homóloga às regiões a montante e a jusante do ORF HHT2, respectivamente. Um exemplo destes produtos de PCR foi analisada por electroforese em gel de agarose (Figura 2B).

Os produtos de PCR de tamanho completo foram então co-transformado juntamente com pRS413 plasmídeo (a centromérica, HIS3- marcada plasmídeof "> 13) e os transformantes foram seleccionados em placas sem histidina (SC-suas placas) como descrito no passo 4 do protocolo. colónias His + foram então pesquisados quanto a resistência 5-FOA seguindo os procedimentos descritos no passo 5 do protocolo. a Figura 3 mostra um exemplo de uma placa de transformação (SC-His) e 5-FOA placas seguintes de SC-suas placas-plaqueamento de réplicas. Exemplos de amostras aderentes, bem como amostras pouco provável para representar os eventos de integração desejados também são apresentadas na Figura 3 . em nosso experimento, foram identificados doze amostras de candidatos fora do ~ 90.000 transformantes selecionados. Estes candidatos foram então purificado como descrito no passo 6 do protocolo.

Os doze candidatos foram então submetidos à análise de PCR descrito no passo 7 do protocolo para avaliar se refletido substituições autênticas do gene URA3 com produtos de PCR mutantes. Para os nossos experimenT, foi utilizado um iniciador directo que hibridiza 89 pares de bases a montante do local de integração do produto de PCR e um iniciador reverso que hibridiza 302 pares de bases a jusante do local de integração do produto de PCR. Estes iniciadores gerar produtos de PCR de 1217 pares de bases de tamanho, se o locus HHT2 é ocupada por HHT2 (ou versões mutantes de HHT2 albergando substituições de pares de bases), ou produtos de PCR de 2188 pares de bases de tamanho, se o locus ocupado pelo gene marcador URA3 . A sequência do iniciador utilizado para a frente (OAD476) é: 5 'GAAACTATTGGCACGCCCTA e que de o iniciador inverso utilizado (OAD477) é: 5' CCTGCGAATCAACCGATACT 3 '. Dos doze candidatos tínhamos identificados, quatro apresentaram integração de um produto de PCR no local correto (veja a Figura 4A para um exemplo). Finalmente, uma vez que a mutação de AG GA gera um novo sítio de restrição Eco RI, que submetido produtos de PCR a partir de uma das amostras de integração bem sucedidas para uma Figura 4B). Neste caso particular, não sequenciar os produtos de PCR para assegurar que as mutações indesejadas adicionais não tinha sido incorporado no genoma: no entanto, utilizou-se um procedimento muito semelhante a esta para gerar um grande número de mutações HHT2 num estudo passado 14, e constataram que a maioria dos alelos mutantes integrados realizar nenhum outro do que as desejadas mutações.

Figura 2
Figura 2: Geração de PCR produtos Harboring desejado Mutações para a integração no genoma da levedura. Reacção (a) de PCR para gerar os fragmentos que se sobrepõem parcialmente de HHT2 albergando as mutações desejadas. representação dos desenhos animados t: Topele duas reacções de PCR para a obtenção dos dois fragmentos HHT2 (consulte a Figura 1B-1). círculos vermelhos representam os nucleótidos desemparelhados nos iniciadores utilizados para introduzir a mutação AG para GA na cadeia de sentido do gene. Análise de eletroforese em gel de produtos de PCR a e b (pistas 2 e 3, respectivamente): inferior. Padrões de ADN são mostradas na pista 1. (B) reacção de fusão de PCR para gerar produtos de PCR de tamanho completo para a integração no genoma da levedura (consulte a Figura 1B-2 e 3). Topo: representação dos desenhos animados e a reacção de PCR esperado produto de PCR (produto C). círculos vermelhas representam mutação desejada como descrito em (A) acima. Análise de gel de eletroforese de PCR produtos c (pista 2): inferior. Padrões de DNA são apresentados na pista 1. Por favor clique aqui para ver uma versão maior desta figura.


Figura 3: Os resultados representativos da experiência Co-transformação e tela de 5 FOA. Esquerda: SC-o seu representante placa revestida com células submetidas ao processo de co-transformação, após um período de incubação de 3 dias a 30ºC. Aproximadamente 5000 colónias foram contadas. Médio: Representante placa 5-FOA seguinte replica-plating a partir de uma placa SC-a co-transformação, após um período de incubação de 2 dias a 30 ° C. As amostras 1 e 2 foram considerados candidatos para ter passado por um evento de integração bem sucedida, devido às suas morfologias assimétricas. Isto é porque uma verdadeira substituição do gene URA3 com o alelo hht2 é provável que ocorra antes (ou pouco depois) uma célula transformada é colocada em SC-o prato e, como resultado, a colónia que vai surgir no local conterá principalmente, se não exclusivamente, 5-FOA-resistanAs células T - quando essa colônia é posteriormente a uma placa 5-FOA será esmagado, dando origem a uma mancha assimétrica aparência das células na placa banhada a réplica. Por outro lado, espontânea mutações no gene URA3 que podem surgir durante a formação de colónias são mais susceptíveis de ser confinado dentro de uma pequena região de uma colónia, e assim mais provável de dar origem a papilas quando réplica-plaqueadas a uma placa de 5-FOA. Direita: uma placa representativa diferente de 5-FOA seguinte réplica-chapeamento de uma placa-SC seu co-transformação após uma incubação de 3 dias a 30 ° C. Um candidato adicional (amostra 3), bem como duas pequenas papilas são visíveis nesta placa (amostras 4 e 5) - tais papilas, que são mais claramente visíveis depois de 3 ou mais dias de incubação, são provavelmente para representar mutações URA3 espontâneas e não o evento de integração desejada. por favor clique aqui para visualizaruma versão maior desta figura.

Figura 4
Figura 4: As análises moleculares de amostras Candidato integração. Ensaio (A) por PCR para identificar eventos de integração bem sucedida. Representações dos desenhos animados de as reacções de PCR utilizados para avaliar a integração bem sucedida do alelo mutante hht2 no genoma: superior. Parte inferior: análise de electroforese em gel de reacções de PCR utilizando o DNA genómico derivado de uma estirpe de tipo selvagem HHT2 (utilizado como um controlo, pista 2), a estirpe que alberga o yAAD156 substituição hht2Δ :: URA3 (utilizado como um controlo, pista 3), um candidato amostra de integração (pista 4), e uma amostra papilas resistente a 5-FOA (e, portanto, pouco provável que representam um evento de integração correcta, pista 5). padrões de ADN são mostradas na pista 1. Note-se que os tamanhos dos produtos de PCR para a amostra são integração candidato consiste dont com um evento de integração bem sucedida, enquanto que o tamanho dos produtos de PCR para a amostra papilas é consistente com um locus hht2Δ :: URA3 intacta. (B) digestão com EcoRI para confirmar a presença do alelo mutante. Topo: representação dos desenhos animados de os fragmentos da digestão esperados derivados a partir de uma reacção de digestão de Eco RI de produtos de PCR contendo tanto o gene de tipo selvagem HHT2 ou o alelo mutante hht2. A análise de electroforese em gel de reacções de digestão dos produtos de PCR derivados de uma estirpe de tipo selvagem HHT2 (pista 2; os produtos de PCR aqui utilizados foram derivados a partir da mesma amostra que o utilizado na pista 2 do painel a) e uma amostra de integração candidato (: Parte inferior pista 3, os produtos de PCR aqui utilizados foram derivados a partir da mesma amostra que o utilizado na pista 4 do painel a). padrões de ADN são mostradas na pista 1. Note-se que os padrões de digestão confirmar que o AG a mutação GA foi introduzido com sucesso no genoma do candidatoamostra de integração. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O nível elevado de homologia de sequências entre os dois genes não alélicos que codificam para cada uma das quatro proteínas histona de núcleo em células haplóides de S. cerevisiae pode representar um desafio para os investigadores que desejam atingir especificamente um dos dois genes para a mutagénese. Anteriormente descreveu metodologias de mutagénese de levedura, incluindo a Delitto Perfetto, genómico de mutagénese específica do local (SSG), e métodos de substituição alelo baseada em PCR livre de clonagem 5, 6, 7, bem como técnicas baseadas em CRISPR mais de levedura recente 15, muitas vezes dependem pelo menos em parte, em sequências dentro do ORF de um gene alvo para recrutar a recombinação ou de reparação de máquinas para o local genómico desejado para gerar finalmente o alelo mutante final. Por outro lado, a estratégia que se apresentou aqui faz uso de sequências de ADN que flanqueia o ORF alvo para dirigir o homólogonos evento de recombinação necessário para a integração da mutação, e, como resultado, permite uma segmentação mais específica de um gene sobre o outro, apesar dos dois genes que possuem ORFs altamente homólogas. Esta característica faz com que a nossa estratégia particularmente bem adequada para a mutagénese de histona. No entanto, esta estratégia também pode ser adaptado para a mutagénese de outros genes no genoma da levedura.

As características adicionais da nossa estratégia incluem o facto de os comprimentos das regiões que dirigem a recombinação homóloga dos genes mutantes pode ser concebido para ser muito grande, aumentando assim a eficiência da integração no local genómico alvo, e que, além da mutação desejada (s ) não há sequências de DNA adicionais são introduzidas no genoma. Uma vantagem adicional deste sistema é que uma vez que uma estirpe portadora substituição de um gene específico com histona URA3 foi construído, ele pode ser usado para a geração de qualquer versão mutante desejada desse Hist nomeadamenteum gene. Assim, por exemplo, a estirpe yAAD156, que está disponível para a comunidade de pesquisa a pedido, pode ser usado para fazer qualquer mutação hht2 desejado, sem a necessidade de construção de um novo alelo de hht2Δ :: URA3. Finalmente, utilizando iniciadores de PCR adequadamente desenhadas, esta estratégia pode também ser utilizada para gerar alelos histonas com deleções internas ou com mutações em vários codões, contanto que eles são relativamente perto um do outro (por exemplo, nós geramos um alelo hht2 que codifica um H3-K56R, L61W proteína mutante dupla usando esta estratégia).

A capacidade de visar especificamente um dos dois genes da histona altamente homólogas para mutagénese poderia ser útil num número de diferentes configurações experimentais. Por exemplo, uma vez que os genes HHT1-HHF1 são expressos em diferentes níveis em relação aos genes HHT2 HHF2-16, pode ser de interesse para determinar se um particular, H3 ou H4 mutação di conferefenótipos fferent dependendo do gene que é expresso a partir. Outro exemplo é um cenário em que um investigador pretende gerar células haplóides que expressam um mutante de histona em particular a partir de ambos os genes da histona correspondentes - isto pode ser alcançado por primeiro mutagénese de cada gene de forma independente em duas estirpes diferentes, e, em seguida, a obtenção de células haplóides mutantes duplos por meio de uma cruz e subsequente isolamento dos produtos desejados meióticas. Ainda um outro exemplo refere-se a mutagénese de histonas H2A e H2B: devido ao facto de duas isoformas ligeiramente diferentes de cada uma das proteínas são codificadas pelo correspondente conjunto de genes não alélicos, um investigador pode querer avaliar os efeitos de um H2A específico ou mutação H2B em no contexto de qualquer isoforma. Ao projetar experimentos para induz mutações do HTA1 e loci HTB1 (codificação H2A e H2B, respectivamente), os investigadores devem estar cientes das descobertas recentes mostram que as estirpes transportando um (hta1-htb1) Δ são viável apenas if terem amplificado o locus HTA2-HTB2 (e nas proximidades lócus HHT1-HHF1 bem) através da geração de um pequeno cromossoma circular 17, o que poderia complicar a interpretação dos resultados.

Nós temos utilizado recentemente uma versão desta estratégia de mutagénese para gerar proteínas histona H3 histonas que expressam todas as possíveis substituições de aminoácidos na posição 61, o que é normalmente ocupado por o aminoácido leucina 14. Para os experimentos, em vez de usar o yAAD156 como estirpe de partida para a mutagénese, foi utilizado estirpe yADP106, o qual contém um substituto da ORF HHT2 tanto com o gene URA3 trp1 e marcadores nutricionais (em vez de apenas URA3). A presença de ambos os genes marcadores facilitou a identificação de candidatos para a integração dos produtos de PCR mutante seguintes tela e purificação passo 5-FOA (etapas 5 e 6 do protocolo), como tal candidatES tornou-se fenotipicamente Ura - e Trp -, ao passo que a mutação espontânea URA3 resultou em células com um Ura - fenótipo Trp +. yADP106 também está disponível, mediante pedido, como é a sequência da cassete URA3-TRP1, o qual pode ser amplificado como uma unidade e utilizado para mutagénese de outros genes de histonas utilizando a estratégia aqui descrita.

A incapacidade de obter os mutantes histona desejados utilizando esta estratégia pode ser atribuído a um número de possíveis razões, incluindo a quantidade insuficiente de produtos de PCR de tamanho completo usado para o passo de integração ou um número insuficiente de transformantes após a etapa de co-transformação. O primeiro problema poderia ser resolvido através da partilha de conjuntos juntos maiores de reacções de PCR ou através da concepção de diferentes conjuntos de iniciadores que produzem um maior rendimento de produto, enquanto que este último problema pode ser resolvido usando quantidades mais elevadas de plasmídeo de esqueleto na experiência de co-transformação. althourg, como indicado anteriormente, pode-se usar este procedimento para gerar mutantes de histona que albergam duas ou mais substituições de aminoácidos, os aminoácidos-alvo tem que ser relativamente perto uns dos outros uma vez que os respectivos codões precisam estar localizados dentro da mesma molécula de iniciador. Assim, esta estratégia não pode ser facilmente adaptado para a geração de histonas com múltiplas mutações localizadas distantes um do outro em todo o comprimento das proteínas.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Visadas<em&gt; In Situ</em&gt; mutagénese de histona Genes em brotamento Yeast
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter