Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

целевое doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Четыре основных белков гистонов H2A, H2B, H3, H4 и играют центральную роль в уплотнению, организации и функции эукариотических хромосом. Два комплекта каждого из этих гистонов образуют гистонов октамером, молекулярный катушку , которая направляет оборачивание ~ 147 пар оснований ДНК вокруг себя, в конечном счете , приводит к образованию нуклеосом 1. Нуклеосомы являются активными участниками различных процессов хромосом на основе, например, регуляции транскрипции генов и формирования эухроматином и гетерохроматина через хромосом, и как таковые были в центре внимания интенсивных исследований в течение последних нескольких десятилетий. Ряд механизмов, были описаны, с помощью которых нуклеосомы можно манипулировать такими способами, которые могут облегчить выполнение определенных процессов - эти механизмы включают в посттрансляционной модификации гистонов остатков, АТФ-зависимой нуклеосом ремоделирование и АТФ-независимую реорганизацию нуклеосоми монтаж / демонтаж 2, 3.

Многообещающий дрожжей Saccharomyces CEREVISIAE является особенно мощным модельным организмом для понимания функции гистонов в эукариот. Это может быть в значительной степени связано с высокой степенью эволюционного сохранения гистоновых белков во всей области Eukarya и аменабельности дрожжей до разнообразных генетических и биохимических экспериментальных подходов 4. Реверс-генетические подходы у дрожжей широко используется для изучения влияния специфических мутаций гистонов по различным аспектам биологии хроматина. Для этих типов экспериментов часто предпочтительно использовать клетки, в которых мутантный гистоны, экспрессируемые из их родного геномного локуса, как экспрессия из автономных плазмид может привести к ненормальной внутриклеточных уровней белков гистонов (из-за разного количества плазмид в клетках) и сопутствующее изменение хроматина анvironments, которые могут в конечном счете, запутать интерпретацию результатов.

Здесь мы опишем метод ПЦР на основе, которая позволяет направленного мутагенеза генов гистонов на их родных геномных местах, которые не требуют стадии клонирования и приводит к генерации желаемой мутации (ов) без оставшихся последовательностей экзогенной ДНК в геноме. Этот метод использует преимущества эффективной системы гомологичной рекомбинации у дрожжей и имеет ряд общих черт с другими подобными методами , разработанными другими группами - в первую очередь на Delitto Perfetto, сайт-специфической геномной (SSG) мутагенеза и клонированию свободной ПЦР на основе аллель методы замены 5, 6, 7. Тем не менее, этот метод описан имеет аспект, который делает его особенно хорошо подходит для мутагенеза генов гистонов. В гаплоидных клетках дрожжей, каждый из четырех основных гистонов кодируется двумя не-Аllelic и высоко гомологичных генов: например, гистона Н3 , кодируемые генами HHT1 и HHT2, и открытые рамки считывания (ORFs) двух генов более 90% идентична последовательности в определенной последовательности. Такая высокая степень гомологии может осложнить эксперименты, направленные на специально направлены одной из двух гистонов генов, кодирующих для мутагенеза. Принимая во внимание вышеупомянутые методы часто требуют использования, по крайней мере некоторых последовательностей в пределах ORF гена-мишени для привода гомологичной рекомбинации, методика описана здесь использует последовательности, фланкирующие ORFs генов гистонов (в которых намного меньше гомологии последовательностей) для стадия рекомбинации, таким образом, увеличивая вероятность успешного нацеливания мутагенеза до нужного локуса. Кроме того, гомологичные регионы, что диск рекомбинации может быть очень обширным, дополнительно способствуя эффективной целевой гомологичной рекомбинации.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Примечание: Экспериментальная стратегия направлена на месте гена гистона мутагенеза включает в себя несколько этапов (показаны на рисунке 1). Эти шаги включают в себя: (1) замена гена мишени гистона с геном URA3, (2) Производство и очистка продуктов ПЦР , соответствующих двум частично перекрывающихся фрагментов гена гистона - мишени с использованием праймеров , несущих желаемую мутацию (и), (3 ) Fusion ПЦР из двух частично перекрывающихся фрагментов, чтобы получить полный размер PCR продуктов для интеграции, (4) совместное преобразование полного размера продуктов ПЦР и магистральную плазмидой, и выделение для маркера на плазмиде, (5) экран для 5-FOA-резистентный трансформанты, (6) Очистка 5-FOA-устойчивых колоний и потере основной цепи плазмиды, и (7) Молекулярные анализы для анализа для правильной интеграции мутантного аллеля.

Рисунок 1
на месте мутагенеза гистонов генов у почкующихся дрожжей. В этом примере целевой ген HHT2, но и любой другой ген корового гистона также может быть мутагенезу с помощью этой стратегии. (A) гаплоидных клетки дрожжей питают два гистона H3-кодирующие гены (HHT1 и HHT2) и два гистонов генов H4-кодировщика (HHF1 и HHF2) , расположенные , как показано на рисунке (гены HHT1 и HHF1 расположены на хромосоме II и HHT2 и гены HHF2 расположены на хромосоме XIV - в каждом случае, стрелки указывают направление транскрипции). На первом этапе процедуры ORF гена HHT2 заменен геном URA3, что приводит к деформации hht2Δ :: URA3. (В) В части 1 дикого типа копию гена HHT2 из геномной ДНК образца используют в качестве матрицы для двух ПЦР - реакций к родамт.е два частично перекрывающихся фрагментов гена. Обратный праймер для первой реакции включает в себя один или более несовпадающих нуклеотида (помеченные красным кружком), которые соответствуют желаемой мутации (ы), которые будут введены в геном. Прямой праймер для второй реакции имеет эквивалентное несоответствие в обратной дополнительной конфигурации (также обозначенной красным кружком). Два ПЦР - продукты , образующиеся в части 1 (продукции А и Б), затем используются в качестве шаблонов для слитого ПЦР с использованием двух праймеров , которые отжигаются к продуктам а и Ь в моде , показанные в части 2. Это приводит к генерации полноразмерного ПЦР продукты (продукт C в части 3) , несущие требуемую мутацию (и). (C) hht2Δ :: URA3 штамм затем совместно трансформировали полноразмерных продуктов ПЦР и позвоночника плазмиды (а HIS3- отмеченные плазмиды в данном примере), и клетки отбирают на присутствие плазмиды (на средах , не имеющих часistidine в данном примере). Трансформанты затем подвергают скринингу на 5-FOA сопротивления - резистентные клетки являются кандидатами для претерпев гомологичной рекомбинацию , ведущей к интеграции продукта ПЦР и иссечение гена URA3, как показано на рисунке. Последующейпотерей магистральную плазмиды митотического деления клеток приводит к конечной требуемой гистона мутантного штамма. Мы обнаружили , что выбор магистральную плазмиды с последующим скринингом для сопротивления приводит к 5-FOA , в гораздо более высокой частоте выявления правильных событий интеграции , по сравнению с прямого выбора на 5-FOA , скребков, которые в основном определяет клетки, которые приобрели спонтанные URA3 мутации. (Эта цифра была изменена со ссылкой 14). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

1. Замена целевого гена гистона с URA3Ген

  1. Выполните стандартную ПЦР-опосредованного нарушения гена один шаг , заменяющего ORF гена гистона - мишени с геном URA3 8, 9.
    Примечание: Использование дрожжевых клеток , несущих ura3Δ0 рекомендуется как эта мутация удаляет весь эндогенный URA3 ORF, избегая таким образом интеграции продукта ПЦР в URA3 локусе 8. В качестве альтернативы, ген URA3 Lactis К. могут быть эффективно использованы для генерации замены гистона в любом ura3 фоне , как это функциональный в S.cerevisiae , но имеет лишь частичную гомологию последовательности с геном URA3 S.cerevisiae , . Штамм должен также быть ауксотрофная, по крайней мере, одно соединение, которое позволит для выбора основной цепи плазмиды в эксперименте трансформации (этап 4 настоящего Протокола). Этот шаг не является необходимым , если цель гистонов geneΔ :: URA3Штамм уже доступен.

2. Формирование и очистка продуктов ПЦР, соответствующие двум частично перекрывающихся фрагментов из целевых Гистона гена с использованием праймеров, несущих желаемую мутацию (и)

  1. Создание продуктов PCR , соответствующие двум частично перекрывающихся фрагментов гена мишени гистонов.
    1. Приготовьте две реакции ПЦР следующим образом:
      1. Для создания продуктов ПЦР , соответствующие первой половине гена (продукт А на рисунке 1В), установить следующие реакции: 1 мкл матричной ДНК, 5 μl10 мкМ вперед праймера, 5 μl10 мкМ обратного праймера, 0,5 мкл (1,25 U) термостабильный ДНК - полимеразы, 10 мкл 5х буфера ДНК - полимеразы, 5 мкл дНТФ смесь (2 мМ каждого), и 23,5 мкл дН 2 O.
        Примечание: ДНК-матрицы могут быть геномной ДНК, полученный из штамма дикого типа для мишени данного гена гистона изолированы с использованием стандартных продуры 10. Для учета различий в концентрации ДНК и уровень примесей в различных геномных препаратов, рекомендуется , чтобы оптимизировать реакции с использованием либо неразбавленный ДНК или различных разведений геномных препаратов (например, 1:10 и 1: 100). Прямой праймер должен отжечь в области выше по течению от гена-мишени. Обратный праймер должен отжигать в ORF, быть ~ 40 нуклеотидов в длину, и содержит требуемую мутацию () где - то в середине его (см Фигура 1В-1 и репрезентативные результаты раздел примеров). Использование ДНК-полимеразы высокой точности рекомендуется для того, чтобы снизить частоту нежелательных мутаций в процессе синтеза продуктов ПЦР.
      2. Для генерирования ПЦР - продуктов , соответствующих второй половине гена (продукт Б на рисунке 1В), установить реакцию , как указано в 2.1.1.1 , но с различными праймерами.
        Примечание: Передняя ПОИМер должна отжечь в ORF, будет ~ 40 нуклеотидов в длину, и содержат требуемую мутацию (ы) где-то в середине. Следует отметить, что мутации (ов) в этом примере является обратным комплементом мутации (ов) в обратного праймера на этапе 2.1.1.1. Обратный праймер должен отжечь в области ниже по течению гена - мишени (см Фигура 1В-1 и репрезентативные результаты раздел примеров).
    2. Поместите реакции в амплификатор со следующими параметрами: 94 ° С 30 сек; 30 циклов следующих параметров: 98 ° С 10 сек, 60 ° C 5 сек, 72 ° С 1,5 мин; и 72 ° С 10 мин.
      Примечание: Оптимизация параметров ПЦР может потребоваться для определенных наборов праймеров и целевого гена гистона.
  2. Выполнить 20 - 50 мкл материала от ПЦР-реакций, на 0,9% с низкой температурой плавления агарозном геле в 89 мМ Трис-основание, 89 мМ борной кислоты, 2,5 мМ ЭДТА (КЭ) буфера.
  3. Вырезать агарозном секции геля, содержащего пр ПЦРoducts из геля, используя чистую скальпель или лезвие бритвы и передавать друг к 1,5 мл трубки микроцентрифужных. Храните агарозном разделы, содержащие продукты ПЦР при температуре от -20 ° С до готовности к использованию.

3. Fusion ПЦР из двух частично перекрывающихся фрагментов, чтобы получить полный Размер продуктов ПЦР для интеграции

  1. Подготовьте шаблон для ПЦР - реакций
    1. Melt агарозном секции геля из шага 2.3 путем размещения микроцентрифужных труб в блок набора тепла при 65 ° С в течение 5 мин (или до полного расплавления). Вихревые трубки каждые 1 - 2 мин, чтобы облегчить процесс плавления.
    2. Передача определенное количество расплавленную агарозу из каждого образца (например, 50 мкл каждой, в общей сложности на 100 мкл) в одну пробирку микроцентрифужных и перемешать встряхиванием. Используйте это в качестве матрицы в ПЦР-реакций термоядерного синтеза. Поместите трубку при -20 ° С до готовности к использованию.
  2. Amplify большое количество полный размер ПЦР - продукта (продукт сна фиг.1В)
    1. Установить шесть реакции ПЦР, каждый из которых имеет следующие компоненты: 2 мкл матрицы ДНК, 10 мкл 10 мкМ прямого праймера, 10 мкл 10 мкМ обратного праймера, 1 мкл (2,5 U) термостабильной ДНК-полимеразы, 20 мкл 5х буфера ДНК полимеразы, 10 мкл дНТФ смесь (2 мМ каждого), и 47 мкл дН 2 O.
      Примечание: Число реакций могут быть изменены в зависимости от эффективности ПЦР. ДНК-матрицы (см раздел 3.1.2) должен быть нагрет до 65 ° С, пока не расплавится, смешивали при помощи вортекса и добавили в прошлом к ​​реакционной смеси для ПЦР. После добавления, аккуратно перемешать, но тщательно пипеткой решение вверх и вниз несколько раз. Для учета различий в концентрации ДНК в различных образцах, рекомендуется сначала оптимизировать реакции с использованием либо неразбавленный шаблона или различных разведений шаблона (например, 1:10 и 1: 100). Два праймера использовали следует прокалить на двух частично перекрывающихся фрагментов гена-мишени, как больнойustrated на рисунке 1В-2 и должны быть сконструированы таким образом, чтобы конечные продукты ПЦР будут иметь по крайней мере 40 пар оснований , по обе стороны , гомологичных областей , фланкирующих URA3 ORF , который будет управлять стадии гомологичной рекомбинации (см репрезентативные результаты раздел примеров). Использование ДНК-полимеразы высокой точности рекомендуется для того, чтобы снизить частоту нежелательных мутаций в процессе синтеза продуктов ПЦР.
    2. Поместите пробирки в амплификатор со следующими параметрами: 94 ° С 30 сек; 30 циклов следующих параметров: 98 ° С 10 сек, 50 ° С 15 сек, 72 ° С 1,5 мин; и 72 ° С 10 мин.
      Примечание: Оптимизация параметров ПЦР может потребоваться для определенных наборов праймеров и целевой ген гистона.

4. Совместное преобразование Full Size продуктов ПЦР и Backbone плазмиды, и выбор для маркера на плазмиды

  1. Концентрация продуктов ПЦР
    1. Объединяют SРеакции ПЦР IX (600 мкл всего), начиная с шага 3.2.2 в одну пробирку микроцентрифужных и перемешать встряхиванием.
    2. Разделите образец на три 200 мкл аликвоты в микроцентрифужных пробирках. Осадить ДНК в каждую пробирку, добавляя 20 мкл 3 М ацетата натрия (рН 5,2) и 550 мкл 100% -ного этанола. Смешайте раствор тщательно и место на льду в течение не менее 15 мин. Сбор ДНК центрифугированием при ~ 14000 мкг в течение 10 мин, промыть осадок 200 мкл 70% этанола, и воздух сухой.
    3. Ресуспендируют каждый ДНК гранул в 25 мкл дН 2 O, и объединить в одну трубу (в общей сложности 75 мкл).
  2. Дрожжи котрансформации
    1. Приготовьте 10 мл ночной культуры штамма генерируемой в разделе 1 , в дрожжевой экстракт пептон в Декстроза (YPD) жидкая среда 11.
    2. На следующее утро, инокуляции 400 мл YPD жидкой среды с 8 мл насыщенного ночной культуры и инкубировать при встряхиваниипри 30 ° С в течение 4 - 5 ч, чтобы клетки ввести логарифмической фазе роста.
    3. Собирают клетки центрифугированием при ~ 3,220 мкг в течение 10 мин, отбрасывать жидкую среду, и клетки вновь суспендируют в 1 объеме 10 мМ Трис-HCl (рН 8,0), 1 мМ ЭДТА, 0,1 М раствор ацетата лития (ТЭ / LiAc) ,
    4. Собирают клетки центрифугированием при ~ 3,220 мкг в течение 10 мин, и выбросить TE / LiAc.
    5. Ресуспендируют клеток в 1 мл ТЕ / LiAc.
    6. Установить следующие реакции коктейлем в микроцентрифужных трубки: 800 мкл клеток из стадии 4.2.5, 40 мкл кипяченой ДНК спермы / мл лосося 10 мг, в общей сложности 12,5 мкг плазмидной ДНК позвоночника, и 75 мкл концентрированного продукта ПЦР со стадии 4.1.3.
      Примечание: ДНК спермы лосося должна быть кипятили в течение 5 мин и помещали на лед в течение не менее 5 мин перед использованием в реакции. Общий объем магистральная плазмидной ДНК добавленной должна быть сведена к минимуму (~ 80 мкл или меньше). См репрезентативные результаты раздел для примера позвоночника плазмыЯ бы.
    7. Смешайте коктейль трубку тщательно и равномерно аликвоты в восьми микропробирок (трубки 1 - 8).
    8. Настройте следующие две трубки реакции преобразования управления:
      1. Труба 9 (без контроля ПЦР-продукт): 100 мкл клеток от этапа 4.2.5, 5 мкл вареного ДНК / мл спермы лосося 10 мг (кипятили в течение 5 мин; смотри стадию 4.2.6 Примечание), в общей сложности 1,56 мкг магистральная плазмидной ДНК и ПЦР-продукт не добавляют.
      2. Трубка 10 (не контрольную ДНК): 100 мкл клеток от этапа 4.2.5 5 мкл кипяченого ДНК спермы лосося 10 мг / мл (этап 4.2.6 Примечание), без добавления ДНК позвоночник плазмида, и никакой продукт ПЦР не было добавлено.
      3. Смешайте обе трубки мягко, но тщательно пипетированием вверх и вниз несколько раз.
    9. Выдержите десять труб при температуре 30 ° С в течение 30 мин.
    10. В каждую пробирку добавляют 1,2 мл 40% полиэтиленгликоля (ПЭГ 3350) в TE / LiAc. Тщательно перемешать с помощью P-1000 пипеткой до тех пор, пока раствор не станет однородным.
    11. Выдержите десять труб на 30° С в течение 30 мин. Аккуратно перемешать раствор с помощью пипетки вверх и вниз, а затем инкубировать пробирки при температуре 42 ° С в течение 15 мин.
    12. Сбор клеток путем прядения пробирки в микроцентрифуге при ~ 14000 мкг в течение 30 сек. Выбросите жидкость и клетки вновь суспендируют в 1 мл стерильной дН 2 O.
    13. Сбор клеток путем прядения пробирки в микроцентрифуге при ~ 14000 мкг в течение 30 сек. Выбросите жидкость и клетки вновь суспендируют в 500 мкл стерильной дН 2 O.
    14. Бассейн трубки 1 - 8 вместе (общий объем 4 мл) и тщательно перемешать с помощью пипетки вверх и вниз.
    15. Пластина 200 мкл вышеуказанной смеси на каждой из двадцати полных минимальных выбывания средних пластин 11 (плиты 1-20) для выбора основной цепи плазмиды.
    16. Пластина 200 мкл смеси из трубки 9 и 200 мкл смеси из трубки 10 каждый сам по собственному выбору пластины (пластины 21 и 22, соответственно).
    17. Инкубируют 22 пластин при 30 ° С в течение 3 - 5 дней довыберите для плазмиды трансформантов.
    18. Проверьте преобразования пластин через 3 - 5 дней инкубации. Приблизительно 5000 колоний должны быть видны на пластинах 1-21 (см Представитель Результаты для примера) и колонии не должны присутствовать на пластине 22.

5. Экран для 5-FOA устойчивых трансформантов

  1. Передача клетки из пластин 1 - 20 (и трансформация пластины 21 в качестве контроля) до 5-fluoroorotic кислоты (5-FOA) пластины 11 с репликой покрытием 12 для того , чтобы показать на экране для потери гена URA3 в результате интеграции из ПЦР-продукты в нужном месте.
    1. Снимите крышку пластины и нажмите пластину, содержащую колонии на стерильный бархата. Передача клетки из вельвета к пластине 5-FOA, нажав на пластину бархата. Инкубируйте пластин при 30 ° С в течение 2-х дней.
  2. После 2-дневной инкубации, внимательно осмотрите пластины 5-FOA для грowth.
    Примечание: Событие кандидат интеграции будет представлен небольшой асимметричной "раздавленный" колонии на пластине 5-FOA - наоборот, маленькие сосочки , растущие на 5-FOA пластин, вероятно , представитель спонтанных URA3 мутаций , которые возникли в процессе роста колоний на преобразования пластины, и, таким образом , вряд ли будет представлять желаемое событие интеграции (смотри рисунок 3 в разделе репрезентативные результаты для дальнейшей разработки по данному вопросу , а также для некоторых примеров).

6. Очистка 5-FOA устойчивых колоний и потеря Backbone плазмиды

  1. Использование стерильных зубочистки, выбрать кандидатов колонии из пластин 5-FOA, описанных в пункте 5.2 и полоса для отдельных колоний на YPD пластин. Инкубировать в течение 2 - 3 дней при 30 ° C.
  2. После инкубации реплику - пластины каждая YPD очистки пластины на свежую YPD пластину, отсев пластины без урацила для проверки потеригена URA3, и второй раскрывающихся из пластины следить за наличием или отсутствием магистральную плазмиды. Инкубировать в течение 1 - 2 дней при 30 ° C.
  3. После инкубации идентифицировать колонию от каждого кандидата образца , который растет на плите YPD , но не растет на любом выбывания из пластины (например , колония , как ожидается, потеряли ген URA3 через событие рекомбинации и потерял магистральную плазмиды во время митотического деление клеток). Restreak такие колонии на свежих YPD пластин. Эти колонии являются кандидатами интеграции и будут проанализированы далее в шаге 7.

7. Молекулярные анализы для анализа на надлежащей интеграции мутантного аллеля

  1. Изолировать геномной ДНК из проб - кандидатов с использованием стандартных процедур 10.
  2. Amplify геномную область , охватывающую целевой сайт.
    1. Настройка следующей реакции ПЦР для каждого образца: 0,5 мкл матричной ДНК, 5 мкл10 мкМ прямого праймера, 5 мкл 10 мкМ обратного праймера, 0,5 мкл (2,5 единицы) Taq - ДНК - полимеразы, 5 мкл 10х Taq - ДНК - полимеразы буфера, 5 мкл дНТФ смесь (2 мМ каждого), и 29 мкл дН 2 O.
      Примечание: матричную ДНК является геномная ДНК, полученной из образцов-кандидатов. Рекомендуется также включать в себя две реакции управления: один с использованием геномной ДНК , полученной из исходных гистонов geneΔ :: штамм URA3 в качестве матрицы и другой использованием геномной ДНК из штамма гистона дикого типа в качестве матрицы. Для учета различий в концентрации ДНК и уровень примесей в различных геномных препаратов, рекомендуется , чтобы оптимизировать реакции с использованием либо неразбавленный ДНК или различных разведений геномных препаратов (например, 1:10 и 1: 100). Важно , чтобы убедиться , что эти праймеры отжигают с ДНК - последовательностей за пределами области , охваченной предполагаемо интегрированного продукта ПЦР - таким образом, размер продуктов ПЦР в этих гeactions может быть использован в качестве диагностического инструмента для интеграции продуктов в правильном месте генома (см Представитель Результаты для примера).
    2. Поместите реакции в амплификатор со следующими параметрами: 94 ° C 3 мин; 30 циклов следующих параметров: 94 ° C 45 сек, 50 ° C 45 сек, 72 ° С 2 мин; и 72 ° С 10 мин.
      Примечание: Оптимизация параметров ПЦР может потребоваться для определенных наборов праймеров и целевой ген гистона.
  3. Обработка продуктов ПЦР
    1. Выполните по 20 мкл из каждой реакции на 0,8% агарозном геле КЭ.
    2. Оценка размера продуктов ПЦР с использованием ДНК - стандартами в качестве эталона , чтобы определить , является ли ген URA3 , был успешно заменен предполагаемо мутантного гена гистона (см Представитель результаты примера).
      Примечание: В некоторых случаях желательно мутации (ы) введены в гены гистонов либо создать или разрушить ограничение сидетье. Если это так, то наличие желаемой мутации в ПЦР-продукты размера, указывающей правильной интеграции может быть оценена путем воздействия на продукты к перевариванию с соответствующим ферментом рестрикции с последующим анализом гель-электрофореза (см Представитель результаты примера) ,
    3. Предметные ПЦР-продукты размера, указывающей правильной интеграции ДНК-секвенированию, чтобы подтвердить наличие желаемой мутации (ов), а также, чтобы гарантировать, что никакие дополнительные мутации не были введены в геном.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Описана генерация hht2 аллеля , выражающей мутантный белок гистона H3 укрывают замещение в положении 53 из аргинином к глутаминовой кислоты (Н3-R53E мутант) в качестве типичного примера целевой стратегии Situ мутагенеза.

Мы создали штамм , в котором вся ORF из HHT2 заменен геном URA3 (см шаг 1 протокола). Этот штамм, yAAD156, также таит в себе аллель his3Δ200, который заставляет клетки быть ауксотрофная гистидин. Следуя процедуре , указанной в пункте 2 протокола, тогда мы генерировали два частично перекрывающихся фрагментов HHT2. Следующие праймеры использовали для первого фрагмента: Прямой праймер (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' и обратный праймер (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. Следующий примеров были использованы для второго фрагмента: Прямой праймер (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' и обратный праймер (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Обратите внимание, что обратный праймер в первой реакции и прямого праймера во второй реакции содержат искомую мутировали нуклеотиды (в нижнем регистре) - эти мутировавшие нуклеотиды расположен между двумя длинными отрезками последовательностей дикого типа, так как это позволяет эффективно отжиге праймера на матричной ДНК, несмотря на несоответствие в мутировавших позициях. Также отметим, что мутированные нуклеотиды в этих двух праймеров, являются обратными дополняют друг друга и вызывают AG мутации ГА в смысловой цепи, что приводит к AGA к GAA кодон изменения, которые в конечном счете производит мутации R53E в кодируемого белка. Результаты этих реакций ПЦР показаны на фигуре 2А.

Используя процедуру, описанную в шаге 3, мы тогда Gener ованные полноразмерных продуктов ПЦР. Праймеры были использованы Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'и обратный праймер (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. При разработке этих праймеров, важно, чтобы убедиться, что в результате слитые ПЦР-продукты включают в себя по меньшей мере 40 пар оснований на обоих концах, чтобы вести гомологичной реакцию рекомбинации (чем дольше участки гомологии, более эффективные и конкретные гомологичной рекомбинации события быть). В нашем эксперименте Полноразмерный продукты ПЦР содержал область 195 пар оснований и 220 пар оснований , область , гомологичную регионам вверх по течению и ниже по течению от HHT2 ORF, соответственно. Образец этих ПЦР - продуктов анализировали с помощью электрофореза в агарозном геле (Фигура 2В).

Полноразмерная ПЦР - продукты затем совместно трансформируются вместе с плазмидной pRS413 центромерной, HIS3- отмеченные плазмидые "> 13) и трансформанты были отобраны на пластинах , не содержащей гистидина (SC-его пластины) , как описано в пункте 4 протокола. Его + колонии, затем просеивали на 5-FOA сопротивления следующим процедурам , описанным в пункте 5 протокола. на рисунке 3 показан пример преобразования пластины (SC-His) и 5-FOA пластин следующих реплик-покрытие из SC-His пластин. Примеры образцов - кандидатов, а также образцы , которые вряд ли представляют желаемых событий интеграции, также представлены на рисунке 3 . в нашем эксперименте мы определили двенадцать образцов кандидатов из ~ 90000 трансформантов скринингу. Эти кандидаты затем очищали, как описано в пункте 6 протокола.

Затем двенадцать кандидатов были подвергнуты анализу ПЦР , описанной в пункте 7 протокола для оценки , если они отражали подлинные замены гена URA3 с мутантным продуктов ПЦР. Для наших экспериментальт, мы использовали прямой праймер, который гибридизуется 89 пар оснований в обратном направлении от интеграции сайта продукта ПЦР и обратного праймера, который отжигается 302 пар оснований ниже по течению от интеграции сайта продукта ПЦР. Эти праймеры генерируют ПЦР - продукты 1217 пар оснований в размере , если локус HHT2 занимают HHT2 (или мутантных версий HHT2 укрывательство пар оснований замен) или ПЦР - продуктов 2188 пар оснований в размере , если локус занят маркерным геном URA3 , Последовательность прямого праймера используется (OAD476) составляет: 5 'GAAACTATTGGCACGCCCTA и обратного праймера, используемый (OAD477) составляет: 5' CCTGCGAATCAACCGATACT 3 '. Из двенадцати кандидатов мы идентифицированных, четыре показали интеграции продукта ПЦР в правильном месте (см рисунок 4A для примера). Наконец, поскольку AG мутации GA создает новый сайт рестрикции Eco RI, мы подвергали ПЦР - продукты от одного из успешных образцов интеграции Ань рисунок 4B). В данном конкретном случае мы не последовательность ПЦР - продукты , чтобы гарантировать , что дополнительные нежелательные мутации не были включены в геном: Тем не менее, мы использовали процедуру , очень похожее на это , чтобы генерировать большое количество HHT2 мутаций в прошлом исследовании 14, и обнаружили, что большинство интегрированных мутантный аллель не несут, отличных от желаемых из них мутации.

фигура 2
Рисунок 2: Получение продуктов ПЦР укрывательство Желаемая Мутации для интеграции в геном дрожжей. Реакции (А) ПЦР для генерирования частично перекрывающиеся фрагменты HHT2 укрывает желаемых мутаций. Топ: мультфильм представление тон две реакции ПЦР с целью получения двух HHT2 фрагментов (см фигуре 1В-1). Красные круги представляют различающиеся нуклеотиды на праймеров, используемых для введения мутации AG к GA в смысловой цепи гена. Дно: гель анализ электрофорез продуктов ПЦР А и В (полосы 2 и 3, соответственно). Стандарты ДНК показаны на дорожке 1. (В) реакции синтеза ПЦР , чтобы генерировать полный размер ПЦР - продукта для интеграции в геном дрожжей (см Фигура 1В-2 и 3). Top: представление мультфильма реакции ПЦР и ожидаемый ПЦР - продукт (продукт с). Красные кружки обозначают искомой мутации, как описано в пункте (а) выше. Дно: гель - электрофорез анализ продуктов ПЦР с (дорожка 2). Стандарты ДНК показаны в полосе 1. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.


Рисунок 3: Представитель Результаты из эксперимента Co-трансформации и 5-FOA экран. Слева: представитель SC-его пластины с гальваническим покрытием из клеток , подвергнутых процедуре совместного преобразования после 3-дневной инкубации при 30 ° С . Около 5000 колоний подсчитывали. Средний: представитель 5-FOA пластины следующие реплики-обшивки из пластины SC-его со-трансформации после 2-дневной инкубации при 30 ° С. Образцы 1 и 2 были рассмотрены кандидатуры, пройдя успешное мероприятие интеграции в связи с их асимметричных морфологией. Это происходит потому , что истинная замена гена URA3 с hht2 аллель, вероятно, произойдет до того (или очень скоро после того, как ) трансформированная клетка высевают на SC-His пластины и, в результате, в колонии , которые будут возникать в этом месте будет содержать в основном, если не исключительно, к 5-FOA-оМТ-клетки - когда такой колонии затем впоследствии репликой покрытием на пластине 5-FOA будет раздавленный, что приводит к асимметричному выглядящий пластыря клеток на пластине. И наоборот, спонтанная мутации в гене URA3 , которые могут возникнуть во время образования колоний, более вероятно, будут ограничены в пределах небольшого участка колонии, и , таким образом , более вероятно, привести к сосочками при репликой покрытием на пластине 5-FOA. Справа: другой представитель 5-FOA пластины следующие реплики-обшивки из пластины SC-его со-трансформации после 3-дневной инкубации при 30 ° C. Дополнительный кандидат (образец 3), а также два маленьких сосочков видны на этой пластине (образцы 4 и 5) - такие сосочков, которые наиболее отчетливо видны после 3 -х или более дней инкубации, которые , вероятно, представляют собой спонтанные URA3 мутации и не желаемое событие интеграции. Пожалуйста , нажмите сюда , чтобы просмотретьувеличенная версия этой фигуры.

Рисунок 4
Рисунок 4: Молекулярные анализы кандидат интеграции образцов. (А) ПЦР - анализ для выявления успешных событий интеграции. Топ: мультфильм представления ПЦР - реакций , используемых для оценки успешной интеграции hht2 мутантного аллеля в геном. Дно: гель - электрофорез анализ ПЦР - реакций с использованием геномной ДНК , полученную из штамма дикого типа HHT2 (используемой в качестве контроля, дорожка 2), штамм yAAD156 укрывает замену hht2Δ :: URA3 (используемой в качестве контроля, дорожка 3), кандидат интеграции образца (дорожка 4), а также 5-FOA устойчивых образцов сосочки (и, таким образом, вряд ли будет представлять собой правильную интегративный, дорожка 5). Стандарты ДНК показаны на дорожке 1. Следует отметить, что размеры продуктов ПЦР для образца кандидатом интеграции consisteнт с успешным событием интеграции, в то время как размер продуктов ПЦР для образца сосочков согласуется с интактной hht2Δ :: URA3 локуса. (B) , Eco RI переваривания , чтобы подтвердить наличие мутантного аллеля. Вверху: мультфильм представление ожидаемых фрагментов расщепления , полученных из переваривания реакции Eco RI продуктов ПЦР , содержащих либо дикого типа HHT2 ген или мутантный аллель hht2. Дно: гель анализ электрофорез пищеварения реакций ПЦР продуктов , полученных из дикого типа HHT2 штамма (полоса 2; ПЦР - продукты , используемые здесь , были получены из того же образца, что и в полосе 2 панели А) и образец кандидата интеграции ( дорожка 3, ПЦР-продукты, используемые здесь, были получены из того же образца, что и в полосе 4 панели а). Стандарты ДНК показаны на дорожке 1. Следует отметить, что образцы с пищеварением подтверждают, что АГ к мутации GA была успешно введена в геном кандидатаИнтеграция образца. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Высокий уровень гомологии последовательностей между двумя неаллельных генов , которые кодируют для каждого из четырех основных белков гистонов в клетках гаплоидных S.cerevisiae , может представлять собой проблему для исследователей , которые хотят конкретно адресовано одному из двух генов для мутагенеза. Ранее описанные методики дрожжевые мутагенеза, в том числе Delitto Perfetto, сайт-специфической геномной (SSG) мутагенеза и клонированию свободных методов замены аллеля на основе ПЦР 5, 6, 7, а также более методов недавней дрожжевых CRISPR на основе 15, часто полагаются по меньшей мере, частично на последовательностей в ORF гена-мишени, чтобы рекрутировать рекомбинации или ремонта механизмов до желаемой геномного участка, чтобы в конечном счете сформировать окончательный мутантный аллель. С другой стороны, стратегия, которую мы представили здесь использует ДНК-последовательностей, фланкирующих целевую ORF для привода homologoнам рекомбинация событие, необходимое для интеграции мутации, и, в результате, позволяет более специфическое нацеливание гена над другим, несмотря на два гена, имеющие высокую гомологию ORFs. Эта особенность делает нашу стратегию особенно хорошо подходит для гистона мутагенеза. Тем не менее, эта стратегия также может быть адаптирована для мутагенеза других генов в геноме дрожжей.

Дополнительные возможности нашей стратегии включают факты, что длины областей, которые управляют гомологичной рекомбинации мутантных генов может быть разработан, чтобы быть очень обширной, тем самым увеличивая эффективность интеграции в целевом геномного месте, и что, кроме желаемой мутации (s ) никаких дополнительных ДНК-последовательности не будут введены в геном. Дополнительным преимуществом этой системы является то, что как только штамм , замена специфического гена гистона с URA3 был построен, он может быть использован для генерирования любого желаемого мутантного варианта этого конкретного Histодин ген. Так, например, штамм yAAD156, который доступен для научного сообщества по запросу, могут быть использованы для получения любой желаемой мутации hht2 без необходимости построения De Novo hht2Δ :: URA3 аллель. И, наконец, с помощью надлежащим образом разработанных праймеров для ПЦР, эта стратегия может также использоваться для генерации гистонов аллели с внутренними делециями или с мутациями в нескольких кодонов, до тех пор , как они относительно близко друг к другу (например, мы породили hht2 аллель , кодирующую H3-K56R, L61W двойной мутант белка, используя эту стратегию).

Способность конкретно адресовано одному из двух высоко гомологичных генов гистонов для мутагенеза может быть полезным в ряде различных экспериментальных установок. Например, так как гены HHT1-HHF1 выражаются на разных уровнях по сравнению с генами HHT2-HHF2 16, она может представлять интерес для определения того, приносит ли конкретный H3 или H4 мутации диfferent фенотипа в зависимости от того, какой ген она выражается с. Другим примером может служить сценарий, в котором исследователь желает произвести гаплоидные клетки, экспрессирующие определенный гистонов мутант из обоих соответствующих генов гистонов - это может быть достигнуто путем первым мутагенеза каждого гена независимо друг от друга в двух разных штаммов, а затем получения двойных мутантов гаплоидных клеток через поперечное и последующее выделение желаемого мейотических продуктов. Еще один пример относится к мутагенеза гистонов H2A и H2B: учитывая тот факт, что два несколько различных изоформ каждого белка кодируются с помощью соответствующей неаллельных набора генов, исследователь может понадобиться оценить влияние конкретного H2A или мутации Н2В в контекст любой изоформы. При проектировании экспериментов по mutagenize в HTA1 и HTB1 локусов (кодирующий H2A и H2B, соответственно), исследователи должны быть осведомлены о последних данных , показывающих , что штаммы , несущий (hta1-htb1) Д жизнеспособны только яе они усилили HTA2-HTB2 локус (и близлежащие локус HHT1-HHF1, а) через поколение небольшой круговой хромосомы 17, так как это может затруднить интерпретацию результатов.

Недавно мы использовали версию этого гистона стратегии мутагенеза для генерирования гистона H3 белки , выражающих все возможные аминокислотные замены в положении 61, которая , как правило , занимаемого лейцина 14 аминокислот. Для этих экспериментов, вместо того чтобы использовать yAAD156 в качестве исходного штамма для мутагенеза, мы использовали штамм yADP106, который таит замену HHT2 ORF с использованием как URA3 и TRP1 питательных маркеров (а не только URA3). Наличие обоих генов-маркеров способствовали выявлению кандидатов для интеграции мутантных продуктов ПЦР после очистки экрана и стадии 5-FOA (шаги 5 и 6 протокола), в качестве такой кандидатэс стал фенотипически Ura - и Trp -, в то время как в результате спонтанных мутаций URA3 привело к клеткам с Ura - фенотипа Trp +. yADP106 также доступен по запросу, как это имеет место последовательность URA3-TRP1 кассету, которая может быть амплифицированной в качестве единицы и используемой для мутагенеза других генов гистонов с использованием стратегии , описанной в данном документе.

Невозможность получения желаемых мутантов гистонов с помощью этой стратегии может быть обусловлено целым рядом возможных причин, в том числе недостаточное количество полноразмерных продуктов ПЦР, используемых для шага интегрирования или недостаточного количества трансформантов после стадии совместного преобразования. Первая задача может быть решена путем объединения вместе больших наборов ПЦР-реакций или путем разработки различных наборов праймеров, которые производят более высокий выход продукта, в то время как последняя проблема может быть решена за счет использования больших количеств магистральную плазмиды в эксперименте со-трансформации. AlthoУф, как было указано ранее, можно использовать эту процедуру для генерации гистонов мутантов накопят два или более аминокислотных замен, целевой аминокислоты должны быть относительно близко друг к другу, так как должны быть расположены в пределах одной молекулы праймера соответствующие кодоны. Таким образом, эта стратегия может не быть легко адаптирована для генерации гистонов с несколькими мутациями, расположенных удаленно друг от друга по всей длине белков.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
целевое<em&gt; В Ситу</em&gt; мутагенеза гистона Гены в почкующихся дрожжах
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter