Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Targeted doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las cuatro proteínas histonas H2A, H2B, H3, H4 y juegan un papel central en la compactación, la organización y función de los cromosomas eucarióticos. Dos juegos de cada una de estas histonas forman el octámero de histona, un carrete molecular que dirige la envoltura de ~ 147 pares de bases de ADN en torno a sí mismo, en última instancia, resulta en la formación de un nucleosoma 1. Nucleosomas son participantes activos en una variedad de procesos basados ​​en los cromosomas, tales como la regulación de la transcripción de genes y la formación de eucromatina y heterocromatina en todos los cromosomas, y como tales han sido el foco de intensa investigación en el transcurso de las últimas décadas. Varios mecanismos han sido descritos por el cual los nucleosomas se pueden manipular de manera que puedan facilitar la ejecución de los procesos específicos - Estos mecanismos incluyen la modificación postraduccional de residuos de histonas, nucleosoma remodelación dependiente de ATP, y la reorganización de nucleosomas independiente de ATPy montaje / desmontaje 2, 3.

La levadura de gemación Saccharomyces cerevisiae es un organismo modelo particularmente poderosa para la comprensión de la función de la histona en eucariotas. Esto puede atribuirse en gran parte al alto grado de conservación evolutiva de las proteínas histonas en todo el dominio Eukarya, y la flexibilidad de la levadura a una variedad de genética y bioquímica experimental se acerca 4. enfoques inversa genéticos en levadura se han usado ampliamente para estudiar los efectos de las mutaciones de histona específicas sobre diversos aspectos de la biología de la cromatina. Para estos tipos de experimentos a menudo es preferible usar células en las que las histonas mutantes se expresan a partir de sus loci genómico nativo, como la expresión de plásmidos autónomos puede conducir a niveles anormales intracelulares de proteínas histonas (debido a un número variable de plásmidos en las células) y alteración concomitante de la cromatina environments, que en última instancia pueden confundir la interpretación de los resultados.

A continuación, describimos una técnica basada en PCR que permite la mutagénesis dirigida de los genes de histonas en sus ubicaciones genómicas nativas que no requiere una etapa de clonación y los resultados en la generación de la mutación (s) deseado sin secuencias de ADN exógeno sobrantes en el genoma. Esta técnica se aprovecha del sistema de recombinación homóloga eficiente en la levadura y tiene varias características en común con otras técnicas similares desarrollados por otros grupos - sobre todo la Delitto Perfetto, mutagénesis genómica específica del sitio (SSG), y la clonación de libre alelo basado en la PCR métodos de reemplazo de 5, 6, 7. Sin embargo, la técnica descrita tiene un aspecto que hace que sea especialmente adecuado para la mutagénesis de genes de histonas. En células de levadura haploides, cada una de las cuatro histonas del núcleo está codificada por dos no unagenes llelic y altamente homólogas: por ejemplo, la histona H3 se codifican por los genes HHT1 y HHT2, y los marcos de lectura abierta (ORFs) de los dos genes son más del 90% idénticos en secuencia. Este alto grado de homología puede complicar los experimentos diseñados para dirigirse específicamente a uno de los dos genes de histonas que codifica para la mutagénesis. Considerando que los métodos antes mencionados a menudo requieren el uso de al menos algunas secuencias dentro de la ORF del gen diana para conducir la recombinación homóloga, la técnica que describimos aquí hace uso de secuencias que flanquean el ORF de los genes de histonas (que comparten mucho menos homología de secuencia) para la etapa de recombinación, aumentando así la probabilidad de que la orientación con éxito de mutagénesis para el locus deseado. Por otra parte, las regiones homólogas que dirigen la recombinación puede ser muy extensa, lo que contribuye a la eficiente recombinación homóloga dirigida.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

NOTA: La estrategia experimental para objetivo in situ mutagénesis de genes histona incluye varias etapas (que se resumen en la Figura 1). Estos pasos incluyen: (1) Sustitución del gen de la histona de destino con el gen URA3, (2) Generación y purificación de productos de PCR correspondientes a dos fragmentos que se superponen parcialmente del gen de la histona objetivo usando cebadores que albergan la mutación (s) deseado, (3 ) Fusión de PCR de los dos fragmentos que se superponen parcialmente para obtener productos de PCR de tamaño completo para la integración, (4) Co-transformación de los productos de PCR de tamaño completo y el plásmido columna vertebral, y la selección para el marcador en el plásmido, (5) de pantalla para el 5-FOA resistentes transformantes, (6) purificación de las colonias de 5-FOA-resistentes y la pérdida de plásmido columna vertebral, y (7) los análisis moleculares para el ensayo de integración apropiada del alelo mutante.

Figura 1
in situ Mutagénesis de genes histona levadura en ciernes. En este ejemplo el gen diana es HHT2, pero cualquier otro gen de la histona núcleo también puede ser mutagenizado usando esta estrategia. Células de levadura haploides (A) albergan dos genes de las histonas H3-codificación (HHT1 y HHT2) y dos genes H4 que codifica la histona (HHF1 y HHF2) dispuestos como se muestra en la figura (los genes HHT1 y HHF1 se encuentran en el cromosoma II y la HHT2 y genes HHF2 se encuentran en el cromosoma XIV - en cada caso, las flechas apuntan en la dirección de la transcripción). En la primera etapa del procedimiento, el ORF del gen HHT2 se sustituye con el gen URA3, dando lugar a una cepa hht2Δ :: URA3. (B) En la parte 1, una copia de tipo salvaje del gen HHT2 a partir de una muestra de ADN genómico se utilizó como molde para dos reacciones de PCR a géneroste La dos fragmentos que se superponen parcialmente del gen. El cebador inverso para la primera reacción incluye uno o más nucleótidos no coincidentes (indicadas con un círculo rojo) que se corresponden con la mutación deseada (s) para ser introducido en el genoma. El cebador directo para la segunda reacción tiene la falta de correspondencia equivalente en una configuración complementaria inversa (también se indica con un círculo rojo). Los dos productos de PCR generados en la parte 1 (productos A y B) se utilizan entonces como plantillas para la fusión PCR usando dos cebadores que hibridan con los productos A y B en la forma indicada en la parte 2. Esto se traduce en la generación de PCR de tamaño completo productos producto (c) en la parte 3 que albergan la mutación deseada (s). (C) El hht2Δ :: URA3 cepa es entonces co-transformaron con los productos de PCR de tamaño completo y un plásmido columna vertebral (a HIS3- marcado plásmido en este ejemplo), y las células se seleccionan para la presencia del plásmido (en medios que carecen de maridoistidine en este ejemplo). Los transformantes se seleccionaron a continuación para 5-FOA resistencia - células resistentes son candidatos para haber sufrido un evento de recombinación homóloga que conduce a la integración del producto de PCR y la escisión del gen URA3, como se muestra. pérdida posterior de la columna vertebral plásmido por división celular mitótico conduce a la histona cepa mutante deseada final. Hemos encontrado que la selección del plásmido columna vertebral, seguido de la detección de los resultados de resistencia a 5-FOA en una frecuencia mucho más alta de la identificación de los eventos de integración correctas en comparación con la selección directa en placas de 5-FOA, que en su mayoría identifica las células que han adquirido mutaciones URA3 espontáneas. (Esta figura se ha modificado de referencia 14). Haga clic aquí para ver una versión más grande de esta figura.

1. Sustitución del objetivo de la histona génica con el gen URA3Gene

  1. Realizar mediada por PCR interrupción de genes de un solo paso estándar reemplazando el ORF del gen de la histona de destino con el gen URA3 8, 9.
    NOTA: Se recomienda el uso de células de levadura que portan el ura3Δ0 como esta mutación elimina todo el URA3 endógeno ORF, evitando así la integración del producto PCR en el locus URA3 8. Alternativamente, el gen lactis URA3 K. puede ser utilizado eficazmente para la generación de la sustitución de la histona en cualquier fondo ura3 ya que es funcional en S. cerevisiae, pero sólo tiene una homología de secuencia parcial con el gen URA3 de S. cerevisiae. La cepa también debe ser auxotrófico para al menos un compuesto que permita la selección del plásmido columna vertebral en el experimento de transformación (véase la etapa 4 de este protocolo). Este paso no es necesario si un geneΔ histonas objetivo :: URA3cepa ya está disponible.

2. Generación y purificación de productos de PCR correspondientes a dos fragmentos que se superponen parcialmente del objetivo de la histona de genes usando cebadores portadoras de la mutación deseada (s)

  1. Generar productos de PCR correspondientes a dos fragmentos que se superponen parcialmente del gen de la histona de destino.
    1. Preparar dos reacciones de PCR como sigue:
      1. Para generar productos de PCR correspondientes a la primera mitad del gen (producto A en la Figura 1B), configurar la siguiente reacción: 1 l de ADN plantilla, cebador directo 5 μl10 M, 5 μl10 M cebador inverso, 0,5 l (1,25 U) termoestable ADN polimerasa, 10 l de tampón de ADN polimerasa 5x, 5 l mezcla dNTP (2 mM cada uno), y 23,5 l dH 2 O.
        NOTA: La plantilla de ADN puede ser ADN genómico derivado de una cepa de tipo salvaje para el gen de la histona diana aislado utilizando Pro Estándar10 procedimientos. Para tener en cuenta las variaciones en la concentración de ADN y el nivel de impurezas en diferentes preparaciones genómicas, se recomienda para optimizar las reacciones mediante el uso de cualquiera de ADN sin diluir o diferentes diluciones de las preparaciones genómicas (por ejemplo, 1:10 y 1: 100). El cebador directo debe hibridar con una región aguas arriba del gen diana. El cebador inverso se hibrida dentro de la ORF, ser ~ 40 nucleótidos de longitud, y contiene la mutación deseada (s) en algún lugar en el medio de ella (véase la figura 1B-1 y la sección de resultados representativos para los ejemplos). El uso de una ADN polimerasa de alta fidelidad se recomienda con el fin de reducir las tasas de mutaciones no deseadas durante la síntesis de los productos de PCR.
      2. Para generar productos de PCR correspondientes a la segunda mitad del gen (producto B en la Figura 1B), configure una reacción como se indica en 2.1.1.1, pero con diferentes cebadores.
        NOTA: El PRI hacia adelantemer debe recocer dentro del ORF, ser ~ 40 nucleótidos de longitud, y contiene la mutación (s) deseado en algún lugar en el medio de ella. Tenga en cuenta que la mutación (s) en este cebador es el complemento inverso de la mutación (s) en el cebador inverso en la etapa 2.1.1.1. El cebador inverso debe hibridar con una región aguas abajo del gen diana (véase la Figura sección 1B-1 y resultados representativos para los ejemplos).
    2. Colocar las reacciones en un termociclador con los siguientes ajustes: 94 ° C 30 seg; 30 ciclos de los siguientes valores: 98 ° C 10 seg, 60 ° C 5 seg, 72 ° C 1,5 min; y 72 ° C 10 min.
      Nota: Optimización de los parámetros de PCR puede ser necesaria para los conjuntos de cebadores específicos y el objetivo de genes histona.
  2. Ejecutar 20 - 50 l de la material de las reacciones de PCR en un gel de bajo punto de fusión de agarosa de 0,9% en la base de 89 mM Tris, 89 mM ácido bórico, EDTA mM de tampón (TBE) 2.5.
  3. secciones cortadas en gel de agarosa que contienen el pr PCRoductos de gel utilizando un bisturí o cuchilla de afeitar limpia y transfieren cada una a un tubo de microcentrífuga de 1,5 ml. Almacenar secciones de agarosa que contienen productos de PCR a -20 ° C hasta que esté listo para su uso.

3. La fusión por PCR de los dos fragmentos que se superponen parcialmente por conseguir el pleno tamaño de los productos de PCR para la Integración

  1. Preparar plantilla para reacciones de PCR
    1. Derretir secciones gel de agarosa del paso 2.3 mediante la colocación de los tubos de microcentrífuga en un conjunto de bloque de calor a 65 ° C durante 5 minutos (o hasta que esté completamente derretida). tubos Vortex cada 1 - 2 min para facilitar el proceso de fusión.
    2. Transferir una cantidad fija de agarosa derretida de cada muestra (por ejemplo, 50 l cada uno, para un total de 100 l) en un solo tubo de microcentrífuga y mezclar mediante agitación. Use esto como la plantilla en las reacciones de PCR de fusión. Se coloca el tubo a -20 ° C hasta que esté listo para su uso.
  2. Amplificar una gran cantidad de tamaño completo producto de PCR (producto cen la Figura 1B)
    1. Configurar seis reacciones de PCR, cada uno con los siguientes componentes: 2 l de ADN plantilla, cebador directo 10 l 10 mM, 10 l 10 mM cebador inverso, 1 l (2,5 U) de ADN polimerasa termoestable, 20 l de 5x tampón de ADN polimerasa, 10 l mezcla de dNTP (2 mM cada uno), y 47 l de dH2O
      NOTA: El número de reacciones puede ser alterado en función de la eficiencia de la PCR. La plantilla de ADN (véase 3.1.2) debe ser calentada a 65 ° C hasta que se derrita, mezclado por agitación, y se añade la última a la mezcla de reacción de PCR. Una vez añadido, Mezclar suavemente con la pipeta la solución arriba y abajo varias veces. Para tener en cuenta las variaciones en la concentración de ADN en las diferentes muestras, se recomienda para optimizar primero las reacciones mediante el uso de cualquiera de plantilla sin diluir o diferentes diluciones de la plantilla (por ejemplo, 1:10 y 1: 100). Los dos cebadores utilizados deben hibridar con los dos fragmentos que se superponen parcialmente del gen diana como enfermosustrated en la Figura 1B-2 y ser diseñado de tal manera que los productos de PCR finales tendrán al menos 40 pares de bases a cada lado homóloga a las regiones que flanquean el ORF URA3 que impulsarán la etapa de recombinación homóloga (véase la sección resultados representativos para los ejemplos). El uso de una ADN polimerasa de alta fidelidad se recomienda con el fin de reducir las tasas de mutaciones no deseadas durante la síntesis de los productos de PCR.
    2. Colocar los tubos en un termociclador con los siguientes ajustes: 94 ° C 30 seg; 30 ciclos de los siguientes valores: 98 ° C 10 seg, 50ºC 15 s, 72 ° C 1,5 min; y 72 ° C 10 min.
      NOTA: Optimización de los parámetros de la PCR puede ser necesaria para conjuntos de cebadores específicos y gen de la histona de destino.

4. Co-transformación de los productos de PCR de tamaño completo y esqueleto del plásmido, y selección para el marcador en el plásmido

  1. La concentración de los productos de PCR
    1. Se combinan las six reacciones de PCR (600 en total l) de la etapa 3.2.2 en un solo tubo de microcentrífuga y mezclar mediante agitación.
    2. Dividir la muestra en tres 200 ml de alícuotas en tubos de microcentrífuga. Precipitar el ADN en cada tubo mediante la adición de 20 l de acetato de sodio 3 M (pH 5,2) y 550 l de etanol al 100%. Mezcle bien la solución y colocar en hielo durante al menos 15 minutos. Recoger el ADN por centrifugación a 14.000 ~ g durante 10 min, enjuagar el sedimento con 200 l de etanol al 70%, y secar al aire.
    3. Resuspender cada sedimento de ADN en 25 l de dH2O, y aunar en un solo tubo (para un total de 75 l).
  2. La levadura co-transformación
    1. Preparar 10 ml de cultivo de una noche de la cepa generada en la sección 1 de extracto de levadura peptona dextrosa (YPD) medio líquido 11.
    2. A la mañana siguiente, inocular 400 ml de medio líquido YPD con 8 ml de cultivo de una noche saturado e incubar agitandoa 30 ° C durante 4 - 5 h para permitir que las células entran en fase logarítmica de crecimiento.
    3. Recoger las células por centrifugación a ~ 3.220 xg durante 10 min, descartar el medio líquido, y resuspender las células en 1 volumen de 10 mM Tris-HCl (pH 8,0), EDTA 1 mM, solución 0,1 M de litio acetato (TE / LiAc) .
    4. Recoger las células por centrifugación a ~ 3.220 xg durante 10 minutos, y desechar el TE / AcLi.
    5. Resuspender las células en 1 ml de TE / LiAc.
    6. Configurar el siguiente cóctel de reacción en un tubo de microcentrífuga: 800 l de células de la etapa 4.2.5, 40 l de ADN de esperma / ml de salmón 10 mg hervida, un total de 12,5 g de ADN plásmido columna vertebral, y 75 l de producto de PCR concentrado de la etapa 4.1.3.
      NOTA: DNA de esperma de salmón se debe hervir durante 5 min y se coloca en hielo durante al menos 5 min antes de su uso en la reacción. Volumen total de ADN de plásmido columna vertebral añadido debe mantenerse a un mínimo (~ 80 l o menos). Véase la sección Resultados Representante para un ejemplo de un plasma de columna vertebralcarné de identidad.
    7. Mezclar el tubo de cóctel de fondo y alícuota uniforme en ocho tubos de microcentrífuga (tubos 1 - 8).
    8. Configurar las siguientes dos tubos de reacción de transformación de control:
      1. Tubo 9 (sin control del producto PCR): 100 l de células de la etapa 4.2.5, 5 l de ADN / ml de esperma de salmón 10 mg hervida (hervido durante 5 min; véase la etapa 4.2.6 Nota), un total de 1,56 g de esqueleto del plásmido ADN y ningún producto de PCR añadido.
      2. El tubo 10 (sin control de ADN): 100 l de células de la etapa 4.2.5, 5 l de ADN hervida 10 mg / ml de esperma de salmón (ver paso 4.2.6 Nota), no plásmido columna vertebral del ADN añadido, y ningún producto PCR añaden.
      3. Mezclar ambos tubos suavemente pero a fondo pipeteando arriba y abajo varias veces.
    9. Incubar los diez tubos a 30 ° C durante 30 min.
    10. A cada tubo, añadir 1,2 ml de polietilenglicol 40% (PEG 3350) en TE / LiAc. Mezclar a fondo usando una pipeta P-1000 hasta que la solución es homogénea.
    11. Incubar los tubos a 30 diez° C durante 30 min. Mezclar suavemente la solución de la pipeta hacia arriba y hacia abajo y luego incubar los tubos a 42 ° C durante 15 minutos.
    12. Recoger las células por girar los tubos en una microcentrífuga a ~ 14.000 xg durante 30 seg. Desechar el líquido y resuspender las células en 1 ml de dH 2 O. estéril
    13. Recoger las células por girar los tubos en una microcentrífuga a ~ 14.000 xg durante 30 seg. Desechar el líquido y resuspender las células en 500 l de dH 2 O. estéril
    14. piscina de los tubos 1 - 8 juntos (volumen total de 4 ml) y mezclar bien con la pipeta hacia arriba y abajo.
    15. Placa 200 l de la mezcla anterior en cada uno de veinte placas completas medio mínimo de abandono 11 (placas 1-20) para la selección del plásmido columna vertebral.
    16. Placa de 200 l de la mezcla de tubo 9 y 200 l de mezcla de tubo de 10 cada uno en su propia placa de selección (láminas 21 y 22, respectivamente).
    17. Se incuban las placas 22 a 30 ° C durante 3 - 5 días aseleccionar los transformantes de plásmidos.
    18. Inspeccionar placas de transformación después de 3 - 5 días de incubación. Aproximadamente 5.000 colonias deben ser visibles en las placas de 1-21 (ver resultados representativos para un ejemplo) y no hay colonias deben estar presentes en la placa 22.

5. Pantalla de transformantes 5-FOA-resistentes

  1. La transferencia de células a partir de placas de 1 - 20 (y la placa de transformación 21 como control) a 5-fluoroorótico ácido (5-FOA) placas de 11 por réplica-plating 12 con el fin de la detección de la pérdida del gen URA3 como un resultado de la integración de la productos de la PCR en el lugar deseado.
    1. Retire la tapa del plato y presione la placa que contiene las colonias en un terciopelo estéril. La transferencia de las células del terciopelo a una placa 5-FOA presionando la placa sobre el terciopelo. Incubar las placas a 30ºC durante 2 días.
  2. Después de la incubación de 2 días, es importante verificar las placas 5-FOA para growth.
    NOTA: Un evento de integración candidato estará representado por una pequeña asimétrica colonia "aplastado" en una placa de 5-FOA - a la inversa, papilas pequeñas que crecen en placas de 5-FOA es probable representante de mutaciones URA3 espontáneas que surgieron durante el crecimiento de las colonias en el placas de transformación, y por lo tanto poco probable que represente el evento de integración deseada (véase la Figura 3 en la sección de resultados representativos para la elaboración adicional sobre este punto y para algunos ejemplos).

6. Purificación de Colonias 5-FOA-resistentes y pérdida de la estructura del plásmido

  1. El uso de palillos de dientes estériles, recoger las colonias candidatos de las placas 5-FOA descritos en el paso 5.2 y la racha de colonias individuales en placas de YPD. Incubar durante 2 - 3 días a 30 ° C.
  2. Después de la incubación, réplica - placa de cada placa de purificación de YPD a una placa YPD fresco, una placa de deserción que carece de uracilo para comprobar si hay pérdidasdel gen URA3, y una segunda placa de abandono para controlar la presencia o ausencia del plásmido de cadena principal. Incubar durante 1 - 2 días a 30 ° C.
  3. Después de la incubación, identificar una colonia de cada muestra candidato que está creciendo en la placa de YPD, pero no crece en cualquiera de las placas de deserción (se espera una colonia como haber perdido el gen URA3 a través del proceso de recombinación y perdió el plásmido columna vertebral durante la mitosis división celular). Restreak tales colonias en placas de YPD frescas. Estas colonias son los candidatos de integración y se analizarán nuevamente en el paso 7.

7. Los análisis moleculares para ensayar la integración adecuada del alelo mutante

  1. Aislar el ADN genómico de las muestras candidatos utilizando procedimientos estándar 10.
  2. Amplificar región genómica que abarca el sitio de destino.
    1. Configure la siguiente reacción de PCR para cada muestra: 0,5 l de ADN plantilla, 5 l10 M cebador directo, 5 l 10 mM de cebador inverso, 0,5 l (2,5 unidades) de ADN polimerasa Taq, 5 l de 10x tampón de ADN polimerasa Taq, 5 l mezcla dNTP (2 mM cada uno), y 29 l dH 2 O.
      NOTA: El ADN molde es el DNA genómico derivado de las muestras de candidatos. Se recomienda incluir también dos reacciones de control: uno utilizando ADN genómico derivado de las histonas geneΔ originales :: cepa URA3 como plantilla y otro utilizando DNA genómico de una cepa de la histona de tipo salvaje como molde. Para tener en cuenta las variaciones en la concentración de ADN y el nivel de impurezas en diferentes preparaciones genómicas, se recomienda para optimizar las reacciones mediante el uso de cualquiera de ADN sin diluir o diferentes diluciones de las preparaciones genómicas (por ejemplo, 1:10 y 1: 100). Es importante asegurarse de que estos cebadores hibridan con secuencias de ADN fuera de la región abarcada por el producto de PCR supuestamente integrada - de esta manera, el tamaño de los productos de PCR en estos reactions se pueden utilizar como una herramienta de diagnóstico para la integración de los productos en la localización genómica correcta (ver resultados representativos para un ejemplo).
    2. Coloque las reacciones en un termociclador con los siguientes valores: 94 ° C 3 min; 30 ciclos de los siguientes valores: 94 ° C 45 s, 50ºC 45 s, 72ºC 2 min; y 72 ° C 10 min.
      NOTA: Optimización de los parámetros de la PCR puede ser necesaria para conjuntos de cebadores específicos y gen de la histona de destino.
  3. Transformación de los productos de PCR
    1. Ejecutar 20 l de cada reacción en un gel de agarosa TBE 0,8%.
    2. Evaluar el tamaño de los productos de PCR usando patrones de ADN como una referencia para determinar si el gen URA3 se ha sustituido con éxito por el gen de la histona putativamente mutado (ver resultados representativos para un ejemplo).
      NOTA: En ciertos casos, la mutación (s) deseada introducida en los genes de las histonas o bien crear o destruir una restricción sentarsemi. Si este es el caso, la presencia de la mutación deseada en los productos de PCR del tamaño indicativo de la integración correcta puede ser evaluada sometiendo los productos a la digestión con la enzima de restricción correspondiente seguido por análisis de electroforesis en gel (ver resultados representativos para un ejemplo) .
    3. Asunto productos de PCR del tamaño indicativo de la integración correcta de la secuenciación del ADN para confirmar la presencia de la mutación (s) deseada y para asegurar que no hay mutaciones adicionales se han introducido en el genoma.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Se describe la generación de un alelo HHT2 que expresa una proteína mutante de la histona H3 que alberga una sustitución en la posición 53 de una arginina a un ácido glutámico (H3-R53E mutante) como un ejemplo representativo del objetivo de la estrategia de mutagénesis situ.

Hemos generado una cepa en la que todo el ORF de HHT2 se sustituye por el gen URA3 (véase la etapa 1 del protocolo). Esta cepa, yAAD156, también alberga un alelo his3Δ200, lo que hace que las células sean auxotrófico para la histidina. Siguiendo el procedimiento indicado en el paso 2 del protocolo, se genera entonces los dos fragmentos que se superponen parcialmente de HHT2. Los siguientes cebadores se utilizaron para el primer fragmento: Cebador (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' y el cebador inverso (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. La siguiente prIMERS se utilizaron para el segundo fragmento: Cebador (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' y el cebador inverso (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Tenga en cuenta que el cebador inverso en la primera reacción y el Cebador en la segunda reacción contienen los nucleótidos deseados mutado (en minúsculas) - estos nucleótidos mutados están ubicadas en medio de dos largos tramos de secuencias de tipo salvaje, ya que esto permite la hibridación eficiente del cebador a la plantilla de ADN a pesar de la falta de coincidencia en las posiciones mutadas. Tenga en cuenta también que los nucleótidos mutados en estos dos cebadores son inverso complementarias entre sí y causan una AG para GA mutación en la cadena con sentido, que resulta en una AGA a GAA cambio de codón, que en última instancia produce la mutación R53E en la proteína codificada. Los resultados de estas reacciones de PCR se muestran en la Figura 2A.

Utilizando el procedimiento del paso 3, entonces Gener ated los productos de PCR de tamaño completo. Los cebadores utilizados fueron Cebador (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'y Cebador inverso (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. En el diseño de estos cebadores, es importante asegurarse de que la fusión de productos de PCR resultantes incluyen al menos 40 pares de bases en los extremos, ya sea para conducir la reacción de recombinación homóloga (la más larga de las regiones de homología, los más eficientes y específicas de los eventos de recombinación homóloga ser). En nuestro experimento, los productos de PCR de tamaño completo contenían una región de 195 pares de bases y 220 base de región par homólogo a las regiones aguas arriba y aguas abajo de la HHT2 ORF, respectivamente. Una muestra de estos productos de PCR se analizó por electroforesis en gel de agarosa (Figura 2B).

Los productos de PCR de tamaño completo fueron co-transformaron junto con pRS413 plásmido (un centrómero, HIS3- marcado plásmidof "> 13) y los transformantes se seleccionaron en placas que carecen de histidina (SC-sus placas) como se describe en el paso 4 del protocolo. Sus colonias + fueron entonces examinados para la resistencia a 5-FOA siguiendo los procedimientos descritos en la etapa 5 del protocolo. la figura 3 muestra un ejemplo de una placa de transformación (SC-his) y 5-FOA placas siguientes réplica-plating de SC sus placas. los ejemplos de muestras de candidatos, así como muestras improbables para representar los eventos de integración deseados también se presentan en la Figura 3 . en nuestro experimento, hemos identificado doce muestras candidatos de ~ 90.000 transformantes seleccionados. Estos candidatos fueron entonces purificados como se describe en el paso 6 del protocolo.

Los doce candidatos fueron sometidos a análisis de PCR descrito en la etapa 7 del protocolo para evaluar si reflejaran reemplazos auténticas del gen URA3 con productos de PCR mutantes. Para nuestros experimentalmentet, se utilizó un cebador directo que hibrida 89 pares de bases aguas arriba del sitio de integración del producto PCR y un cebador inverso que se hibrida 302 pares de bases aguas abajo del sitio de integración del producto de PCR. Estos cebadores generan productos de PCR de 1217 pares de bases de tamaño si el locus HHT2 está ocupado por HHT2 (o versiones mutantes de HHT2 que albergan sustituciones de pares de bases), o productos de PCR de 2188 pares de bases de tamaño si el locus está ocupada por el gen marcador URA3 . La secuencia del cebador utilizado Forward (OAD476) es: 5 'GAAACTATTGGCACGCCCTA y que del cebador inverso utilizado (OAD477) es: 5' CCTGCGAATCAACCGATACT 3 '. De los doce candidatos habíamos identificado, cuatro mostraron integración de un producto de PCR en la ubicación correcta (véase la figura 4A para un ejemplo). Por último, ya que el AG a GA mutación genera un nuevo sitio de restricción Eco RI, sometimos productos de PCR a partir de una de las muestras de integración con éxito a una figura 4B). En este caso particular que no secuenciar los productos de la PCR para asegurarse de que las mutaciones no deseados adicionales que no se habían incorporado en el genoma: sin embargo, hemos utilizado un procedimiento muy similar a este para generar un gran número de mutaciones HHT2 en un estudio pasado 14, y se encontró que la mayoría de los alelos mutantes integrados llevar mutaciones distintas de las deseadas.

Figura 2
Figura 2: Generación de productos de PCR que albergan mutaciones que desea para su integración en el genoma de la levadura. De reacción (A) PCR para generar los fragmentos que se superponen parcialmente de HHT2 que albergan las mutaciones deseadas. representación de dibujos animados de t: Topque dos reacciones de PCR para obtener los dos fragmentos HHT2 (consulte la Figura 1B-1). Los círculos rojos representan los nucleótidos no coincidentes en los cebadores usados ​​para introducir la mutación AG de GA en la cadena con sentido del gen. Análisis de electroforesis en gel de productos de PCR A y B (carriles 2 y 3, respectivamente): Parte inferior. Patrones de ADN se muestran en el carril 1. (B) reacción de fusión PCR para generar tamaño completo producto de la PCR para la integración en el genoma de la levadura (véase la Figura 1B-2 y 3). Arriba: representación de dibujos animados de la reacción de PCR y PCR espera que el producto (producto C). círculos rojos representan desea mutación como se describe en (A) anterior. Análisis en gel de electroforesis de productos de PCR c (carril 2): Parte inferior. Patrones de ADN se muestran en la calle 1. Por favor, haga clic aquí para ver una versión más grande de esta figura.


Figura 3: Los resultados representativos del experimento de co-transformación y la pantalla 5-FOA. Izquierda: SC-representante de su plato plateado con células sometidas al procedimiento de co-transformación después de una incubación de 3 días a 30ºC. Se contaron aproximadamente 5000 colonias. Medio: representante de la placa 5-FOA siguiente réplica de galvanoplastia de una placa SC-su co-transformación después de una incubación de 2 días a 30ºC. Las muestras 1 y 2 fueron considerados candidatos por haber pasado por un evento de integración con éxito debido a sus morfologías asimétricas. Esto es porque es probable que ocurra antes (o muy poco después de) una célula transformada se sembró en el SC-su plato una verdadera sustitución del gen URA3 con el alelo HHT2 y, como resultado, la colonia que surgirá en esa ubicación contendrá todo, si no exclusivamente, 5-FOA-resistancélulas T - cuando una colonia de este tipo es, posteriormente, réplica de chapado a una placa de 5-FOA que será aplastada, dando lugar a un parche de aspecto asimétrica de las células en la placa. Por el contrario, espontánea mutaciones en el gen URA3 que puede surgir durante la formación de colonias son más propensos a ser confinada dentro de una pequeña región de una colonia, y por lo tanto más probable que dé lugar a papilas cuando réplica de chapado a una placa 5-FOA. A la derecha: un representante 5-FOA placa diferente después réplica de galvanoplastia de una placa SC-su co-transformación después de una incubación de 3 días a 30 ° C. Un candidato adicional (muestra 3), así como dos pequeñas papilas son visibles en esta placa (muestras 4 y 5) - tales papilas, que son más claramente visibles después de 3 o más días de incubación, es probable que representan mutaciones URA3 espontáneas y no el evento de integración deseado. Haga clic aquí para veruna versión más grande de esta figura.

Figura 4
Figura 4: Los análisis moleculares de muestras Candidato de integración. Ensayo (A) PCR para identificar eventos de integración exitosas. Representaciones de dibujos animados de las reacciones de PCR usados para evaluar la integración exitosa del alelo mutante HHT2 en el genoma: la parte superior. Inferior: análisis de electroforesis en gel de las reacciones de PCR usando ADN genómico derivado de una cepa de tipo salvaje HHT2 (utilizado como control, carril 2), la cepa que alberga el yAAD156 reemplazo hht2Δ :: URA3 (utilizado como control, carril 3), un candidato muestra de integración (carril 4), y una muestra papilas 5-FOA resistentes (y por lo tanto poco probable que represente un evento de integración correcta, carril 5). patrones de ADN se muestran en el carril 1. Obsérvese que los tamaños de los productos de PCR para la muestra de la integración candidato son consiste delnt con un evento de integración con éxito, mientras que el tamaño de los productos de PCR para la muestra papilas es consistente con un locus hht2Δ :: URA3 intacto. (B) la digestión Eco RI para confirmar la presencia del alelo mutante. Top: representación de dibujos animados de los fragmentos de digestión esperados derivados de una reacción de digestión Eco RI de los productos de PCR que contenían el gen de tipo salvaje HHT2 o el alelo mutante HHT2. Análisis de electroforesis en gel de las reacciones de digestión de los productos de PCR derivados de una cepa HHT2 de tipo salvaje (carril 2; los productos de PCR utilizados aquí se derivaron de la misma muestra que la usada en el carril 2 de panel A) y una muestra de la integración candidato (: Bottom carril 3; los productos de PCR utilizados aquí se derivaron de la misma muestra que la utilizada en el carril 4 de panel a). patrones de ADN se muestran en el carril 1. Obsérvese que los patrones de digestión confirman que el AG a GA mutación se ha introducido con éxito en el genoma del candidatomuestra de la integración. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El alto grado de homología de secuencia entre los dos genes no alélicos que codifican para cada una de las cuatro proteínas histonas en células haploides de S. cerevisiae puede representar un reto para los investigadores que desean dirigirse específicamente a uno de los dos genes para la mutagénesis. Anteriormente se ha descrito metodologías de mutagénesis de levadura, incluyendo la Delitto Perfetto, mutagénesis genómica específica del sitio (SSG), y métodos de reemplazo de alelo basados en PCR libre de clonación 5, 6, 7, así como las técnicas basadas en CRISPR más reciente de levadura 15, a menudo se basan al menos en parte en las secuencias dentro de la ORF de un gen diana para reclutar a los de recombinación o reparación de maquinarias al sitio genómico deseada para generar finalmente el alelo mutante final. Por otro lado, la estrategia que hemos presentado aquí hace uso de secuencias de ADN que flanquean el ORF dirigido a impulsar el homólogoevento de recombinación nos requiere para la integración de la mutación, y, como resultado, permite la identificación más específica de un gen sobre otro a pesar de los dos genes que tengan ORFs altamente homólogas. Esta característica hace que nuestra estrategia particularmente bien adaptado para la mutagénesis de histonas. Sin embargo, esta estrategia también se puede adaptar para la mutagénesis de otros genes en el genoma de la levadura.

Las características adicionales de nuestra estrategia incluyen los hechos que las longitudes de las regiones que impulsan la recombinación homóloga de los genes mutantes puede ser diseñado para ser muy extensa, aumentando así la eficiencia de la integración en la localización genómica de destino, y que además de la mutación deseada (s ) no hay secuencias de ADN adicionales se introducen en el genoma. Una ventaja adicional de este sistema es que una vez que una cepa que alberga el reemplazo de un gen de la histona específica con URA3 se ha construido, que puede ser utilizado para la generación de cualquier versión mutante deseado de que hist particular,un gen. Así, por ejemplo, la cepa yAAD156, que está disponible para la comunidad de investigación a petición, se puede usar para hacer cualquier mutación HHT2 deseado sin la necesidad de la construcción de un alelo de novo hht2Δ :: URA3. Por último, mediante el uso de cebadores de PCR diseñados adecuadamente, esta estrategia también se puede utilizar para generar alelos de histonas con deleciones internas o con mutaciones en múltiples codones, siempre y cuando que son relativamente cerca unos de otros (por ejemplo, hemos generado un alelo HHT2 que codifica una H3-K56R, L61W proteína mutante doble uso de esta estrategia).

La capacidad para dirigirse específicamente a uno de los dos genes de histonas altamente homólogas para la mutagénesis podría ser útil en un número de diferentes parámetros experimentales. Por ejemplo, ya que los genes HHT1-HHF1 se expresan en diferentes niveles en comparación con los genes HHT2-HHF2 16, podría ser de interés para determinar si un H3 en particular o mutación H4 confiere difenotipos ferentes dependiendo de qué gen se expresa a partir de. Otro ejemplo es un escenario en el que un investigador desea para generar células haploides que expresan un mutante de histona particular, de ambos genes de las histonas correspondientes - esto podría lograrse por mutagénesis primero cada gen de forma independiente en dos cepas diferentes, y a continuación, la obtención de células haploides dobles mutantes a través de una cruz y el aislamiento posterior de los productos meióticos deseados. Sin embargo, otro ejemplo se refiere a la mutagénesis de las histonas H2A y H2B: teniendo en cuenta el hecho de que dos isoformas ligeramente diferentes de cada proteína son codificadas por el conjunto de genes no alélica correspondiente, un investigador puede querer evaluar los efectos de un H2A específica o mutación H2B en el contexto de cualquiera de isoforma. En el diseño de experimentos para mutar el HTA1 y loci HTB1 (que codifica H2A y H2B, respectivamente), los investigadores deben ser conscientes de los hallazgos recientes que muestran que las cepas que lleva una (HTA1-HTB1) Δ son viables sólo if que han amplificado el locus HTA2-HTB2 (y cerca de locus HHT1-HHF1 también) a través de la generación de un pequeño cromosoma circular 17, ya que esto podría complicar la interpretación de los resultados.

Hemos utilizado recientemente una versión de esta estrategia de mutagénesis de la histona para generar proteínas histona H3 que expresan todas las posibles sustituciones de aminoácidos en la posición 61, que normalmente está ocupada por el aminoácido leucina 14. Para los experimentos, en lugar de utilizar yAAD156 como la cepa de partida para la mutagénesis, se utilizó la cepa yADP106, que alberga una sustitución de la HHT2 ORF tanto con el URA3 y TRP1 marcadores nutricionales (en lugar de sólo URA3). La presencia de ambos genes marcadores facilitó la identificación de candidatos para la integración de los productos de PCR mutantes siguientes la pantalla y purificación paso 5-FOA (pasos 5 y 6 del Protocolo), como tal candidates fenotípicamente se convirtieron en Ura - y Trp -, mientras que la mutación espontánea URA3 dado lugar a células con un Ura - fenotipo Trp +. yADP106 también está disponible a petición, como es la secuencia de la casete URA3-TRP1, que podría ser amplificado como una unidad y se utiliza para la mutagénesis de otros genes de histona utilizando la estrategia descrita en el presente documento.

La incapacidad para obtener los mutantes de histonas deseados usando esta estrategia podría ser atribuible a un número de posibles razones, incluyendo la cantidad insuficiente de los productos de PCR de tamaño completo se utilizan para el paso de integración o un número insuficiente de transformantes después de la etapa de co-transformación. El anterior problema podría resolverse mediante la agrupación de los conjuntos juntos más grandes de las reacciones de PCR o mediante el diseño de diferentes conjuntos de cebadores que producen un mayor rendimiento de producto, mientras que el último problema podría resolverse mediante el uso de mayores cantidades de plásmido columna vertebral en el experimento de co-transformación. Althouf, como se indicó anteriormente, se puede utilizar este procedimiento para generar mutantes de histonas que albergan dos o más sustituciones de aminoácidos, los aminoácidos específicos tienen que estar relativamente cerca uno del otro ya que los codones respectivos necesitan ser situado dentro de la misma molécula de cebador. Por lo tanto, esta estrategia no se puede adaptar fácilmente para la generación de las histonas con múltiples mutaciones localizadas alejadas una de la otra a través de la longitud de las proteínas.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Targeted<em&gt; In situ</em&gt; mutagénesis de histona genes en la levadura en ciernes
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter