Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Målinriktad doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De fyra kärn histonproteiner H2A, H2B, H3 och H4 spela en central roll i den kompaktering, organisation och funktion av eukaryota kromosomer. Två uppsättningar av vardera av dessa histoner bilda histon oktamer, en molekyl spole som styr omslags av ~ 147 baspar av DNA runt sig själv, vilket slutligen resulterar i bildandet av en nukleosom 1. Nukleosomer är aktiva deltagare i en mängd olika kromosombaserade processer, såsom reglering av gentranskription och bildandet av eukromatin och heterokromatin över kromosomer, och som sådan har varit föremål för en intensiv forskning under loppet av de senaste årtiondena. Ett antal mekanismer har beskrivits av vilka nukleosomer kan manipuleras på ett sätt som kan underlätta utförandet av specifika processer - dessa mekanismer innefattar posttranslationell modifiering av histon rester, ATP-beroende nukleosomen ombyggnad, och ATP-oberoende nukleosomen omorganisationoch montering / demontering 2, 3.

Den spirande jästen Saccharomyces cerevisiae är en särskilt kraftfull modellorganism för förståelsen av histon funktion i eukaryoter. Detta kan till stor del tillskrivas den höga graden av evolutionär konservering av histonproteiner hela domänen eukarya och mottaglighet av jäst till en mängd genetiska och biokemiska försöks närmar 4. Omvänd-genetiska metoder i jäst har använts i stor utsträckning för att studera effekterna av specifika histon mutationer på olika aspekter av kromatin biologi. För dessa typer av experiment är det ofta föredraget att använda celler i vilka de mutanta histonerna uttrycks från deras nativa genomiska loci, såsom expression från autonoma plasmider kan leda till onormala intracellulära nivåerna av histonproteiner (på grund av varierande antal plasmider i celler) och samtidig förändring av kromatin enjöer, vilket i slutändan kan förbrylla tolkningen av resultaten.

Här beskriver vi en PCR-baserad teknik som möjliggör för riktad mutagenes av histon gener vid deras nativa genomiska lägen som inte kräver en kloningssteg och resulterar i alstringen av den önskade mutationen (erna) utan överblivna exogena DNA-sekvenser i genomet. Denna teknik drar fördel av en effektiv homolog rekombination systemet i jäst och har flera gemensamma drag med andra liknande tekniker som utvecklats av andra grupper - notably Delitto Perfetto, platsspecifik genomisk (SSG) mutagenes och kloning fria PCR-baserad allel ersättningsmetoder 5, 6, 7. Men tekniken beskriver vi har en aspekt som gör det särskilt väl lämpad för mutagenes av histon gener. I haploida jästceller, är vart och ett av de fyra kärn histoner som kodas av två icke-allelic och mycket homologa gener: till exempel, är histon H3 kodas av HHT1 och HHT2 gener och de öppna läsramarna (ORF) av de två generna är över 90% identisk i sekvens. Denna höga grad av homologi kan komplicera experiment utformade för att specifikt rikta en av de två histon-kodande gener för mutagenes. Medan de tidigare nämnda metoder kräver ofta användning av åtminstone några sekvenser inom ORF av målgenen för att driva homolog rekombination, den teknik som vi beskriver här använder sig av sekvenser som flankerar de ORF hos histon gener (som delar mycket mindre sekvenshomologi) för rekombinationen steget, vilket ökar sannolikheten för en framgångsrik målinriktning av mutagenes för att den önskade lokuset. Dessutom kan de homologa regionerna som driver rekombination vara mycket omfattande, vilket ytterligare bidrar till en effektiv målinriktad homolog rekombination.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

OBS: Den experimentella strategi för riktad in situ histon genen mutagenes innefattar flera steg (som sammanfattas i figur 1). Dessa steg är: (1) Ersättning av mål-histon-genen med URA3-genen, (2) Generering och rening av PCR-produkter motsvarande två delvis överlappande fragment av mål-histon-genen med användning av primrar som härbärgerar den önskade mutationen (s), (3 ) Fusion PCR av de två partiellt överlappande fragment för att erhålla full storlek PCR-produkter för integrering, (4) Co-transformation av full storlek PCR-produkter och ryggrad plasmid, och urval för markören på plasmiden, (5) Screening med avseende på 5-FOA-resistenta trans (6) Rening av 5-FOA-resistenta kolonier och förlust av ryggraden plasmid, och (7) Molekyl analyser för analys korrekt integrering av den muterade allelen.

Figur 1
in situ mutagenes av Histon gener i knoppande jäst. I detta exempel den målinriktade genen är HHT2, men varje annan kärn histon-genen kan även mutageniseras med användning av denna strategi. (A) Haploid jästceller hyser två histon H3-kodande gener (HHT1 och HHT2) och två histon H4-kodande gener (HHF1 och HHF2) anordnade som visas i figuren (de HHT1 och HHF1 generna är belägna på kromosom II och HHT2 och HHF2 generna är belägna på kromosom XIV - i varje enskilt fall, pilarna pekar i riktningen för transkription). I det första steget av förfarandet, är den ORF av HHT2 genen ersatt med URA3-genen, som ger upphov till en hht2Δ :: URA3-stam. (B) I del 1, är en vild-typ kopia av HHT2 genen från ett genomiskt DNA-prov användes som mall för två PCR-reaktioner på släktente de två partiellt överlappande fragment av genen. Den omvända primern för den första reaktionen innefattar en eller flera felparade nukleotider (indikeras med en röd cirkel) som motsvarar den önskade mutationen (erna) som skall införas i genomet. Den främre primer för den andra reaktionen har motsvarande obalans i en omvänd komplementär konfiguration (även indikeras med en röd cirkel). De två PCR-produkter som genereras i del 1 (produkterna A och B) används sedan som mallar för fusion PCR med användning av två primers som hybridiserar till produkterna A och B på det sätt som visas i del 2. Detta resulterar i generering av full storlek PCR produkter (produkt C i del 3) hyser den önskade mutationen (s). (C) Den hht2Δ :: URA3 stammen är sedan samtransformeras med fullstora PCR-produkter och en ryggrad plasmid (en HIS3- märkt plasmid i detta exempel), och celler selekteras för närvaro av plasmiden (på media som saknar histidine i detta exempel). Transformanter screenas sedan för 5-FOA resistens - resistenta celler är kandidater för att ha genomgått en homolog rekombinationshändelse leder till integration av PCR-produkten och excision av URA3-genen, såsom visas. Efterföljande förlust av ryggraden plasmiden genom mitotisk celldelning leder till den slutliga önskade histon mutant stam. Vi har funnit att valet av ryggraden plasmid följt av screening med avseende på 5-FOA-beständighetsresultaten i en mycket högre frekvens för identifiering av korrekta integrationshändelser i jämförelse med direkt selektion på 5-FOA-plattor, som för det mesta identifierar celler som har förvärvat spontana URA3 mutationer. (Denna siffra har ändrats från 14 referens). Klicka här för att se en större version av denna siffra.

1. Byte av Target Histon Gene med URA3Gen

  1. Utför standard PCR-medierad ett steg genavbrott ersätter ORF av mål histon-genen med URA3-genen 8, 9.
    OBS: Användning av jästceller som bär ura3Δ0 rekommenderas som denna mutation avlägsnar hela den endogena URA3 ORF och därmed undvika integrering av PCR-produkten in i URA3-locus 8. Alternativt kan den K. lactis URA3-genen användas effektivt för generering av histon ersättare i något ura3 bakgrund som den är funktionell i S. cerevisiae men har endast partiell sekvenshomologi med S. cerevisiae URA3-genen. Stammen bör också vara auxotrof för åtminstone en förening som gör det möjligt för val av ryggraden plasmiden i transformationsexperiment (se steg 4 i detta protokoll). Detta steg är inte nödvändigt om ett mål histon geneΔ :: URA3stammen är redan tillgänglig.

2. Generation och rening av PCR-produkter motsvarande två delvis överlapp Fragment av Target Histon Gene använder Primers härbärgerar den önskade mutationen (s)

  1. Generera PCR-produkter motsvarande två delvis överlappande fragment av mål histon-genen.
    1. Förbered två PCR-reaktioner enligt följande:
      1. För att generera PCR-produkter som motsvarar den första halvan av genen (produkt A i figur 1B), ställa in följande reaktion: 1 pl mall-DNA, 5 μl10 iM framåtriktad primer, 5 μl10 iM omvänd primer, 0,5 l (1,25 U) termo DNA-polymeras, 10 pl 5x-DNA-polymeras-buffert, 5 pl dNTP-blandning (2 mM av vardera), och 23,5 ^ il dH2O
        OBS: mall-DNA kan vara genomiskt DNA härlett från en stam av vildtyp för målet histon-genen isolerades med användning av standard proförfaranden 10. Att ta hänsyn till variationer i DNA-koncentration och graden av föroreningar i olika genomiska preparat, är det rekommenderat att optimera reaktionerna med hjälp av antingen outspädd DNA eller olika utspädningar av de genomiska preparat (t.ex. 1:10 och 1: 100). Den framåtriktade primern bör hybridisera till en region uppströms av målgenen. Den bakåtriktade primern bör hybridisera inom ORF, vara ~ 40 nukleotider i längd, och innehåller den önskade mutationen (er) någonstans i mitten av det (se figur 1B-1 och Representativa resultat avsnittet för exempel). Användningen av en high fidelity-DNA-polymeras rekommenderas i syfte att minska andelen oönskade mutationer under syntesen av PCR-produkterna.
      2. För att generera PCR-produkter som motsvarar den andra halvan av genen (produkt B i figur 1B), skapa en reaktion som anges i 2.1.1.1, men med olika primers.
        OBS: Den främre primeren bör hybridisera inom ORF, vara ~ 40 nukleotider i längd, och innehåller den önskade mutationen (er) någonstans i mitten av den. Notera att mutationen (er) i denna primer är det omvända komplementet av mutationen (er) i den omvända primern i steg 2.1.1.1. Den bakåtriktade primern bör hybridisera till en region nedströms av målgenen (se figur 1B-1 och Representativa resultat avsnittet för exempel).
    2. Placera reaktionerna i en termocykler med följande inställningar: 94 ˚C 30 sek; 30 cykler av följande inställningar: 98 C 10 sekunder, 60 ° C 5 sek, 72 ˚C 1,5 min; och 72 ˚C 10 min.
      Obs: Optimering av PCR-parametrar kan krävas för specifika primeruppsättningar och mål histon genen.
  2. Köra 20 - 50 pl av materialet från PCR-reaktionerna på en 0,9% lågsmältande agaros-gel i 89 mM Tris-bas, 89 mM borsyra, 2,5 mM EDTA (TBE) buffert.
  3. Klipp agarosgel sektioner som innehåller PCR-produkter från gelén med användning av en ren skalpell eller rakblad och överför varje till ett 1,5 ml mikrocentrifugrör. Lagra agaros avsnitt innehåller PCR-produkter vid -20 ° C tills den ska användas.

3. Fusion PCR av de två partiellt överlappande fragment för att få full storlek PCR produkter för integration

  1. Förbered mall för PCR-reaktioner
    1. Smält agarosgel sektioner från steg 2,3 genom att placera mikrocentrifugrör i ett värmeblock inställd på 65 C under 5 minuter (eller tills helt smält). Vortexrör varje 1 - 2 min för att underlätta smältprocessen.
    2. Överför en viss summa smält agaros från varje prov (t.ex. 50 pl vardera, för totalt 100 pl) i en enda mikrocentrifugrör och blanda genom att vortexa. Använda detta som mall i fusions PCR-reaktioner. Placera röret vid -20 ° C tills den ska användas.
  2. Förstärka en stor kvantitet av full storlek PCR-produkt (produkt ci figur 1B)
    1. Inrättat sex PCR-reaktioner, var och en med följande komponenter: 2 | il mall-DNA, 10 | j, l 10 | iM framåtriktad primer, 10 | il 10 | iM bakåtriktad primer, 1 | il (2,5 U) termostabilt DNA-polymeras, 20 pl 5x DNA-polymerasbuffert, 10 | j, l dNTP-blandning (2 mM vardera), och 47 pl dH 2 O.
      OBS: antal reaktioner kan ändras beroende på PCR-effektiviteten. Mall-DNA (se 3.1.2) bör värmas till 65 C tills smält, blandas genom virvling, och sist sattes till PCR-reaktionsblandningen. När du har lagt blanda försiktigt men grundligt genom att pipettera lösningen upp och ner flera gånger. Att ta hänsyn till variationer i DNA-koncentration i de olika proverna, är det rekommenderat att först optimera reaktionerna med hjälp av antingen outspädda mall eller olika utspädningar av mallen (t.ex. 1:10 och 1: 100). De två primrar som användes bör para till de två partiellt överlappande fragment av målgenen som illustrated i figur 1B-2 och vara utformad så att de slutliga PCR-produkterna kommer att ha minst 40 baspar på vardera sidan homolog till regionerna som flankerar URA3 ORF som kommer att driva den homologa rekombinationen steget (se Representativa resultat avsnittet för exempel). Användningen av en high fidelity-DNA-polymeras rekommenderas i syfte att minska andelen oönskade mutationer under syntesen av PCR-produkterna.
    2. Placera rören i en termocykler med följande inställningar: 94 ˚C 30 sek; 30 cykler av följande inställningar: 98 C 10 sekunder, 50 ° C 15 sek, 72 ° C 1,5 min; och 72 ˚C 10 min.
      OBS: Optimering av PCR-parametrar kan krävas för specifika primeruppsättningar och mål histon-genen.

4. Samtidig omvandling av full storlek PCR produkter och Backbone Plasmid, och urval för markör på plasmiden

  1. Koncentrationen av PCR-produkter
    1. Pool Six PCR-reaktioner (600 ul totalt) från steg 3.2.2 till en enda mikrocentrifugrör och blanda genom att vortexa.
    2. Dela upp provet i tre 200 l alikvoter i mikrocentrifugrör. Fälla ut DNA: t i varje rör genom tillsats av 20 | il 3 M natriumacetat (pH 5,2) och 550 ul av 100% etanol. Blanda lösningen ordentligt och placera på is under minst 15 min. Samla DNA genom centrifugering vid ~ 14.000 xg under 10 minuter, skölj pelleten med 200 pl 70% etanol och lufttorka.
    3. Återsuspendera varje DNA pelleten i 25 | il dH 2 O, och förena i ett enda rör (för totalt 75 | il).
  2. Jäst samtransformering
    1. Bered 10 ml av övernattskultur av stammen som genereras i avsnitt 1 i Jästextrakt Pepton dextros (YPD) flytande medium 11.
    2. Följande morgon, inokulera 400 ml flytande YPD-medium med 8 ml av den mättade över natten odlade kulturen och inkubera genom skakningvid 30 ° C i 4 - 5 h för att tillåta cellerna att gå in logaritmisk tillväxtfas.
    3. Samla cellerna genom centrifugering vid ~ 3220 x g under 10 min, kasta bort det flytande mediet, och återsuspendera cellerna i en volym av 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 M litiumacetat-lösning (TE / LiAc) .
    4. Samla upp cellerna genom centrifugering vid ~ 3220 x g under 10 min, och kassera TE / LiAc.
    5. Resuspendera cellerna i 1 ml TE / LiAc.
    6. Ställ in följande reaktions cocktail i ett mikrocentrifugrör: 800 pl celler från steg 4.2.5, 40 pl kokt 10 mg / ml laxspermie-DNA, totalt 12,5 mikrogram av ryggraden plasmid-DNA, och 75 pl koncentrerad PCR-produkt från steg 4.1.3.
      OBS: laxsperma-DNA bör kokas under 5 min och placerades på is under åtminstone 5 min innan användning i reaktionen. Total volym av ryggraden plasmid-DNA tillsätts bör hållas till ett minimum (~ 80 l eller mindre). Se representativa resultat avsnittet för ett exempel på en ryggrad plasmaid.
    7. Blanda cocktail röret noggrant och delprov jämnt i åtta mikrocentrifugrör (Rör 1-8).
    8. Ställ in följande två kontroll omvandling reaktionsrör:
      1. Röret 9 (ingen PCR-produkt-kontroll): 100 pl av celler från steg 4.2.5, 5 | j, l av kokt 10 mg / ml laxspermie-DNA (kokades under 5 min; se steg 4.2.6 Note), totalt 1,56 pg av ryggrad plasmid-DNA och ingen PCR-produkt tillsätts.
      2. Röret 10 (inget DNA kontroll): 100 pl av celler från steg 4.2.5, 5 mikroliter av kokt 10 mg / ml laxspermie-DNA (se steg 4.2.6 Not), ingen ryggrad plasmid-DNA tillsätts, och ingen PCR-produkt tillsätts.
      3. Blanda båda rören försiktigt men noggrant genom att pipettera upp och ned flera gånger.
    9. Inkubera de tio rören vid 30 C under 30 min.
    10. Till varje rör, tillsätt 1,2 ml av 40% polyetylenglykol (PEG 3350) i TE / LiAc. Blanda noggrant med en P-1000 pipett tills lösningen är homogen.
    11. Inkubera de tio rören vid 30° C under 30 min. Blanda försiktigt lösningen genom att pipettera upp och ned och sedan inkubera rören vid 42 ° C under 15 min.
    12. Samla upp cellerna genom att snurra rören i en mikrocentrifug vid ~ 14.000 xg under 30 sek. Kassera vätskan och återsuspendera cellerna i 1 ml steril dH 2 O.
    13. Samla upp cellerna genom att snurra rören i en mikrocentrifug vid ~ 14.000 xg under 30 sek. Kassera vätskan och återsuspendera cellerna i 500 | j, l av steril dH 2 O.
    14. Pool rören 1-8 tillsammans (total volym av 4 ml) och blanda omsorgsfullt genom pipettering upp och ned.
    15. Plattan 200 | il av den ovannämnda blandningen på var och en av tjugo kompletta minimal dropout mediumplattor 11 (plattor 1-20) för val av ryggraden plasmiden.
    16. Plattan 200 | il av blandningen från Tube 9 och 200 | il av blandningen från Tube 10 vardera på eget val av plattan (plattor 21 och 22, respektive).
    17. Inkubera de 22 plattorna vid 30 ° C i 3 - 5 dagar tillselektera för plasmiden transformanter.
    18. Inspektera transformations plattorna efter 3 - 5 dagars inkubation. Cirka 5000 kolonier ska vara synliga på plattor 1-21 (se Representativa resultat för ett exempel) och inga kolonier bör finnas på plattan 22.

5. Skärm för 5-FOA-resistenta transformanter

  1. Överför celler från plattor 1-20 (och transformation plattan 21 som en kontroll) till 5-fluororotsyra (5-FOA) plattor 11 genom replika-plating 12 för att screena för förlust av URA3-genen som ett resultat av integration av PCR-produkter på önskad plats.
    1. Ta bort locket plattan och tryck plattan innehåller kolonier på en steril sammet. Överföra celler från sammets till en 5-FOA plattan genom att trycka på plattan på sammet. Inkubera plattorna vid 30 C under 2 dagar.
  2. Efter den 2 dagar långa inkubationen noggrant inspektera 5-FOA-plattor för growth.
    OBS: En integration kandidat händelse kommer att representeras av en liten asymmetrisk "kläm" koloni på en 5-FOA platta - omvänt, liten papiller växer på 5-FOA-plattor sannolikt representativa för spontana URA3 mutationer som uppstod under tillväxten av kolonier på transformationsplattor, och är därför osannolikt att representera den önskade integration händelsen (se figur 3 i avsnittet Representativa resultat för vidareutveckling på denna punkt och för några exempel).

6. Rening av 5-FOA-resistenta kolonier och förlust av Backbone Plasmid

  1. Med hjälp av sterila tandpetare, plocka kandidat kolonier från 5-FOA-plattor som beskrivs i steg 5,2 och strimma för enstaka kolonier på YPD-plattor. Inkubera i 2 - 3 dygn vid 30 ° C.
  2. Efter inkubation replik - tallrik varje YPD rening platta till en ny YPD-platta, en drop-out plåt som saknar uracil för att kontrollera förlustav URA3-genen, och en andra avhopp plattan för att övervaka med avseende på närvaro eller frånvaro av ryggraden plasmiden. Inkubera i 1 - 2 dagar vid 30 ° C.
  3. Efter inkubation identifiera en koloni från varje prov kandidat som växer på YPD plattan men inte växer på antingen avhopp plåt (t.ex. en koloni förväntas ha förlorat URA3-genen genom rekombination händelse och förlorade ryggraden plasmiden under mitotisk celldelning). Restreak sådana kolonier på färska YPD-plattor. Dessa kolonier är kandidaterna integration och kommer att analyseras ytterligare i steg 7.

7. Molekylära analyser för analys för rätt integrering av den mutanta allelen

  1. Isolera genomisk DNA från kandidatprover med användning av standardprocedurer 10.
  2. Amplifiera genomregion som omfattar målstället.
    1. Ställ in följande PCR-reaktionen för varje prov: 0,5 l mall-DNA, 5 ^10 | iM framåtriktad primer, 5 pl 10 pM omvänd primer, 0,5 | il (2,5 enheter) Taq DNA-polymeras, 5 | il 10 x Taq DNA-polymerasbuffert, 5 | il dNTP-blandning (2 mM av vardera), och 29 | j, l dH2O
      OBS: Template DNA är genomiskt DNA härrörande från kandidatprover. Det rekommenderas att även omfatta två kontrollreaktioner: en med hjälp av genomiskt DNA som härrör från de ursprungliga histon geneΔ :: URA3 stammen som mall och en annan med hjälp iskt DNA från en vild-typ histon stam som mall. Att ta hänsyn till variationer i DNA-koncentration och graden av föroreningar i olika genomiska preparat, är det rekommenderat att optimera reaktionerna med hjälp av antingen outspädd DNA eller olika utspädningar av de genomiska preparat (t.ex. 1:10 och 1: 100). Det är viktigt att se till att dessa primers till DNA-sekvenser utanför regionen omfattas av förmodat integrerade PCR-produkten - detta sätt storleken av PCR-produkter i dessa reactions kan användas som ett diagnostiskt verktyg för integration av produkterna på rätt genomisk plats (se Representativa resultat för ett exempel).
    2. Placera reaktionerna i en termo med följande inställningar: 94 ° C 3 min; 30 cykler av följande inställningar: 94 ° C 45 sek, 50 ° C 45 sek, 72 ° C 2 min; och 72 ° C 10 min.
      OBS: Optimering av PCR-parametrar kan krävas för specifika primeruppsättningar och mål histon-genen.
  3. Bearbetning av PCR-produkter
    1. Köra 20 | il från varje reaktion på en 0,8% TBE-agarosgel.
    2. Bedöma storleken av PCR-produkterna med användning av DNA-standarder som en referens för att bestämma om URA3-genen har framgångsrikt ersättas med förmodat muterade histon-genen (se Representativa resultat för ett exempel).
      OBS: I vissa fall, den önskade mutationen (s) infördes i histon gener antingen skapa eller förstöra en begränsning sittae. Om detta är fallet, kan bedömas närvaron av den önskade mutationen i PCR-produkter av storleken som indikerar korrekt integrering genom att utsätta produkterna för klyvning med motsvarande restriktionsenzym, följt av gelelektrofores-analys (se Representativa resultat för ett exempel) .
    3. Subject PCR-produkter av storleken som indikerar korrekt integrering till DNA sekvensering för att bekräfta närvaron av den önskade mutationen (er) och för att säkerställa att inga ytterligare mutationer har införts i genomet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi beskriver genereringen av en hht2 allel som uttrycker en histon H3 muterade proteinet hyser en substitution vid position 53 från en arginin till en glutaminsyra (H3-R53E mutant) som ett representativt exempel på den riktade in situ mutagenes strategi.

Vi genererade en stam i vilken hela ORF av HHT2 ersättas med URA3-genen (se steg 1 i protokollet). Denna stam, yAAD156, härbärgerar också en his3Δ200 allel, vilket gör att cellerna att vara auxotrof för histidin. Genom att följa förfarandet som anges i steg 2 i protokollet, då genererade vi två delvis överlappande fragment av HHT2. Följande primers användes för första fragmentet: Forward Primer (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' och den omvända primern (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. Följande primers användes för det andra fragmentet: Forward Primer (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' och den omvända primern (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. Observera att Reverse Primer i den första reaktionen och Forward Primer i den andra reaktionen innehålla den önskade muterade nukleotiderna (i gemener) - dessa muterade nukleotider är inbäddat i mellan två långa sträckor av vild-typ-sekvenser, eftersom det möjliggör effektiv glödgning av primern till templat-DNA trots felpaming vid de muterade positioner. Observera också att de muterade nukleotiderna i dessa två primers är omvänd komplementära till varandra och orsaka ett AG till GA mutation i senssträngen, vilket resulterar i en AGA att GAA kodon förändring, vilket i slutändan producerar R53E mutation i det kodade proteinet. Resultat från dessa PCR-reaktioner visas i figur 2A.

Med användning av förfarandet i steg 3, sedan Gener vi de fullstora PCR-produkter ated. De primers som användes var Forward Primer (OAD479): 5'TATGGCTCGGTGTCAAAACA 3 'och omvänd primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. När man utformar dessa primrar är det viktigt att se till att de resulterande fusions PCR-produkterna innefattar åtminstone 40 baspar på vardera slutar att driva den homologa rekombinationsreaktionen (ju längre de regioner av homologi, de mer effektiva och specifika de homologa rekombinationshändelser kommer vara). I vårt experiment, de fullstora PCR-produkterna innehöll ett 195 baspar region och 220 baspar region homolog till regionerna uppströms och nedströms HHT2 ORF, respektive. Ett prov av dessa PCR-produkter analyserades genom elektrofores på agarosgel (Figur 2B).

De fullstora PCR-produkterna sedan samtransformerade tillsammans med plasmid pRS413 (en centro, HIS3- märkt plasmidf "> 13) och transformanter selekterades på plattor som saknar histidin (SC-hans plattor) som beskrivs i steg 4 i protokollet. Hans + kolonier screenades sedan för 5-FOA motstånd efter de förfaranden som beskrivs i steg 5 i protokollet. Figur 3 visar ett exempel på en omvandlingsplatta (SC-his) och 5-FOA-plattor efter replika-plating från SC-hans plattor. exempel på kandidatprover samt prover osannolikt att representera de önskade integrationshändelser visas också i Figur 3 . i vårt experiment identifierade vi tolv kandidatprover ur ~ 90.000 transformanter screenas. Dessa kandidater renades sedan såsom beskrivits i steg 6 i protokollet.

De tolv kandidater utsattes därefter för PCR-analys som beskrivs i steg 7 i protokollet för att bedöma om de reflekterade autentiska utbyten av URA3-genen med muterade PCR-produkter. För våra experiment, använde vi en framåtriktad primer som hybridiserar 89 baspar uppströms från integrationsstället av PCR-produkten och en omvänd primer som hybridiserar 302 baspar nedströms från integrationsstället av PCR-produkten. Dessa primrar generera PCR-produkter av 1217 baspar i storlek, om HHT2 lokuset är upptagen av HHT2 (eller mutanta versioner av HHT2 härbärgerar basparsubstitutioner) eller PCR-produkter av 2188 baspar i storlek, om lokus är upptagen av URA3-markörgenen . Sekvensen av den framåtriktade primern som används (OAD476) är: 5 'GAAACTATTGGCACGCCCTA och den för den omvända primern som används (OAD477) är: 5' CCTGCGAATCAACCGATACT 3 '. Av de tolv kandidater som vi hade identifierat, fyra visade integrering av en PCR-produkt på rätt plats (se figur 4A för ett exempel). Slutligen, eftersom AG till GA mutationen skapar ett nytt EcoRI-restriktionsställe, vi utsätts PCR-produkter från en av de framgångsrika prov integrations en figur 4B). I detta fall har vi inte sekvensera PCR-produkter för att säkerställa att ytterligare oönskade mutationer hade inte införlivats i genomet: Men har vi använt en procedur som liknar detta att generera ett stort antal HHT2 mutationer i en tidigare studie 14, och fann att majoriteten av de integrerade muterade alleler bär inga andra än de önskade sådana mutationer.

figur 2
Figur 2: Framställning av PCR-produkter som härbärgerar önskade mutationer för integrering i jästgenomet. (A) PCR-reaktion för att generera de delvis överlappande fragment av HHT2 härbärgerar de önskade mutationerna. Överst: tecknad representation av than två PCR-reaktioner för att erhålla de två HHT2 fragmenten (se Figur 1B-1). Röda cirklar representerar de felparade nukleotider på de primrar som används för att introducera AG till GA mutation i sens-strängen av genen. Botten: gelelektrofores-analys av PCR-produkterna A och B (spår 2 och 3, respektive). DNA-standarder visas i bana 1. (B) Fusion PCR-reaktion för att generera full storlek PCR-produkt för integrering i jästgenomet (se Figur 1B-2 och 3). Top: tecknad representation av PCR-reaktionen och förväntade PCR-produkten (produkt c). Röda cirklar representerar önskade mutationen som beskrivits i (A) ovan. Botten: gelelektrofores-analys av PCR-produkter c (spår 2). DNA-standarder visas i bana 1. Klicka här för att se en större version av denna siffra.


Figur 3: representativa resultat från Co-omvandlingen Experiment och 5-FOA Screen. Vänster: representativ SC-sin tallrik klädd med celler som utsätts för samtransformation förfarande efter en 3-dagars inkubation vid 30 ° C. Cirka 5000 kolonier räknades. USA: representativ 5-FOA platta efter replika-plating från en SC-hans co-transformation plattan efter en två dagars inkubation vid 30 ° C. Prov 1 och 2 ansågs kandidater för att ha gått igenom ett lyckat evenemang integration på grund av deras asymmetriska morfologier. Detta beror på är en sann ersättning av URA3-genen med den hht2 allelen sannolikt kommer att ske före (eller mycket snart efter) en transformerad cell stryks ut på SC-sin tallrik och, som ett resultat, kolonin som kommer att uppstå på den platsen kommer att innehålla mest, om inte uteslutande, 5-FOA-resistanT-celler - när en sådan koloni är därefter replika-klädd till en 5-FOA platta kommer det att klämd, vilket ger upphov till en asymmetrisk utseende lapp av celler på plattan. Omvänt, spontan mutationer i URA3-genen som kan uppstå under kolonibildning är mer sannolikt att ligga inom ett litet område av en koloni, och därmed mer benägna att ge upphov till papiller när replika-klädd till en 5-FOA platta. Höger: en annan representativ 5-FOA plattan efter replika-plating från en SC-his samtransformation plattan efter en 3-dagars inkubation vid 30 ° C. En ytterligare kandidat (prov 3) samt två små papiller är synliga på denna platta (prov 4 och 5) - så papiller, som är mest tydligt efter 3 eller fler dagars inkubation, sannolikt för att representera spontana URA3 mutationer och inte den önskade integrationen händelse. Klicka här för att seen större version av denna siffra.

figur 4
Figur 4: Molecular Analyser av kandidat Integration Samples. (A) PCR-analys för att identifiera framgångsrika integrationshändelser. Överst: tecknade representationer av PCR-reaktioner används för att bedöma en framgångsrik integration av hht2 muterade allelen i genomet. Botten: gelelektrofores-analys av PCR-reaktioner med användning av genomiskt DNA härlett från en HHT2 vildtypsstam (användes som en kontroll, spår 2), stam yAAD156 härbärgerande hht2Δ :: URA3 utbyte (som användes som kontroll, bana 3), en kandidat prov integration (bana 4), och en 5-FOA-resistenta papiller provet (och således troligen inte med en korrekt händelse integration, spår 5). DNA-standarder visas i bana 1. Notera att storleken på PCR-produkterna för provintegrations kandidat är consistent med ett lyckat arrangemang integration, medan storleken av PCR-produkterna för papiller prov motsvarar en intakt hht2Δ :: URA3-locus. (B) EcoRI-digerering för att bekräfta närvaron av mutant allel. Top: tecknad representation av de förväntade digererings fragment härledda från en EcoRI-digerering reaktion av PCR-produkter innehållande antingen vildtyp HHT2 genen eller den mutanta hht2 allelen. Botten: gelelektrofores-analys av digereringsreaktioner av PCR-produkter härledda från en vildtyp HHT2-stam (bana 2; PCR-produkterna som används här var härledda från samma prov som det som användes i bana 2 av panel A) och ett prov integrationskandidat ( bana 3, PCR-produkterna som används här var härledda från samma prov som det som användes i bana 4 i panel A). DNA-standarder visas i bana 1. Notera att de uppslutningsmönster bekräfta att AG till GA-mutationen har framgångsrikt introducerats in i genomet hos kandidatenprov integration. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den höga graden av sekvenshomologi mellan de två icke-alleliska gener som kodar för var och en av de fyra kärn histonproteiner i haploida S. cerevisiae-celler kan representera en utmaning för forskare som vill särskilt rikta ett av de två generna för mutagenes. Tidigare beskrivna jästmutagenesmetoder, inklusive Delitto Perfetto, platsspecifik genomisk (SSG) mutagenes och kloning fritt PCR-baserade allel ersättningsmetoder 5, 6, 7, såväl som mer nyligen jäst crispr baserade tekniker 15, ofta förlitar sig åtminstone delvis på sekvenser inom ORF av en målgen för att rekrytera de rekombinationsställen eller reparations maskinerier till den önskade genomiska platsen för att så småningom generera den slutliga mutant allel. Å andra sidan, den strategi som vi har presenterat här använder sig av DNA-sekvenser som flankerar den målinriktade ORF att driva homologooss rekombination händelse som krävs för integrering av mutationen, och som ett resultat, gör det möjligt för mer specifik inriktning av en gen över en annan trots de två generna har mycket homologa ORF. Denna funktion gör vår strategi särskilt väl lämpad för histon mutagenes. Emellertid kan denna strategi också anpassas för mutagenes av andra gener i jästgenomet.

Ytterligare funktioner i vår strategi inkluderar de fakta att längderna hos de regioner som driver homolog rekombination av de mutanta gener kan utformas för att vara mycket omfattande, vilket ökar effektiviteten av integration vid målet genomiska läge, och att förutom den önskade mutationen (s ) inga ytterligare DNA-sekvenser införes i genomet. En ytterligare fördel med detta system är att när en stam som hyser ersättning av en specifik histon-gen med URA3 har konstruerats, kan den användas för genereringen av varje önskad muterad version av just den histen gen. Således, till exempel, stam yAAD156, som är tillgänglig för forskarsamhället på begäran, kan användas för att göra någon önskad hht2 mutation utan att behöva bygga en de novo hht2Δ :: URA3-allelen. Slutligen, genom att använda rätt utformade PCR-primers, denna strategi kan även användas för att generera histon alleler med interna deletioner eller med mutationer vid flera kodon, så länge de är relativt nära varandra (till exempel, vi har genererat en hht2 allel som kodar för ett H3-K56R, L61W dubbel mutant protein med hjälp av denna strategi).

Förmågan att specifikt rikta in en av två mycket homologa histon gener för mutagenes kan vara användbart i ett antal olika experimentella inställningar. Till exempel, eftersom HHT1-HHF1 gener uttrycks på olika nivåer jämfört med HHT2-HHF2 gener 16, kan det vara av intresse att avgöra om en viss H3 eller H4 mutation ger different fenotyper beroende på vilken gen det uttrycks från. Ett annat exempel är ett scenario där en utredare vill generera haploida celler som uttrycker en viss histon mutant från båda motsvarande histon gener - Detta skulle kunna uppnås genom att först mutagenes varje gen oberoende i två olika stammar, och sedan få dubbla mutant haploida celler genom ett kors och efterföljande isolering av de önskade meiotiska produkter. Ännu ett exempel avser mutagenes av histoner H2A och H2B: med tanke på att två något olika isoformer av varje protein kodas av motsvarande icke-alleliska genuppsättning, kan en utredare vill bedöma effekterna av en specifik H2A eller H2B mutation i samband med någon isoform. Vid utformningen av experiment för att mutera den HTA1 och HTB1 loci (som kodar för H2A och H2B, respektive), bör utredarna vara medvetna om nya rön visar att stammar som bär en (hta1-htb1) Δ är lönsamt endast if de har förstärkt den HTA2-HTB2 locus (och närliggande HHT1-HHF1 locus också) genom generering av en liten cirkulär kromosom 17, eftersom detta skulle kunna försvåra tolkningen av resultaten.

Vi har nyligen använt en version av denna histon mutagenes-strategin för att generera histon H3 proteiner som uttrycker alla möjliga aminosyrasubstitutioner vid position 61, som normalt är upptagen av aminosyran leucin 14. För de experiment, istället för att använda yAAD156 som utgångsstam för mutagenesen använde vi stam yADP106, vilken härbärgerar en ersättning av HHT2 ORF med både URA3 och TRP1 näringsmarkörer (i stället för bara URA3). Närvaron av både markörgener underlättade identifieringen av kandidater för integrering av de muterade PCR-produkter efter 5-FOA-skärm och reningssteget (steg 5 och 6 i protokollet), som sådan candidates blev fenotypiskt Ura - och Trp - medan spontan URA3 mutation resulterade i celler med Ura - Trp + fenotyp. yADP106 är också tillgängliga på begäran, som är följden av URA3-TRP1 kassett, som kan förstärkas som en enhet och som används för mutagenes av andra histon gener genom att använda den strategi som beskrivs häri.

Oförmåga att erhålla de önskade histon mutanter som använder denna strategi skulle kunna tillskrivas ett antal möjliga orsaker, bland annat otillräcklig mängd full storlek PCR-produkter som används för integration steg eller ett otillräckligt antal transformanter efter samtransformering steg. Den tidigare problem skulle kunna lösas genom att samla ihop större uppsättningar av PCR-reaktioner eller genom att utforma olika primeruppsättningar som producerar ett högre utbyte av produkt, medan det senare problemet kan lösas genom att använda större mängder ryggrad plasmiden i samtransformering experiment. although, såsom angivits tidigare, kan man använda denna procedur för att generera histon mutanter som hyser två eller flera aminosyrasubstitutioner, riktade aminosyrorna måste vara relativt nära varandra, eftersom de respektive kodon måste placeras inom samma primer molekyl. Således denna strategi kan inte enkelt anpassas för generering av histoner med multipla mutationer belägna avlägset från varandra över längden av proteinerna.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Målinriktad<em&gt; In situ</em&gt; mutagenes av Histon Gener i knoppande jäst
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter