Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Hedeflenen doi: 10.3791/55263 Published: January 26, 2017

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dört çekirdekli histon proteinleri H2A, H2B, H3, H4 ve ökaryotik kromozomların sıkıştırma, organizasyon ve fonksiyonunda önemli rol oynarlar. Bu histonlar her iki set sonuçta nükleozom 1 oluşumu ile sonuçlanır, histon oktameri, kendi etrafında DNA ~ 147 baz çifti sarma yönlendiren bir molekül makara oluşturur. Nükleozomlar bu tür kromozom üzerinde gen transkripsiyonu düzenlenmesi ve ökromatin oluşumu ve heterokromatin olarak kromozom tabanlı süreçleri, çeşitli aktif katılımcılar vardır ve gibi, son birkaç on yıl boyunca yoğun bir araştırmanın odak noktası olmuştur. Bu mekanizmalar histon kalıntılarının sonrası modifikasyon, ATP-bağımlı nükleozom remodeling ve ATP-bağımsız nükleozom yeniden düzenlenmesi dahil - bir takım mekanizmalar hangi nükleozom belirli işlemlerin uygulanmasını kolaylaştırabilir yollarla manipüle edilebilir tarif edilmiştirve montaj / demontaj 2, 3.

Tomurcuklanan maya Saccharomyces cerevisiae ökaryotlarda histon işlevinin anlaşılması için özellikle güçlü bir model organizmadır. Bu büyük ölçüde etki ökaryotlarının boyunca histon proteinlerinin evrimsel korunması yüksek derecede ve genetik ve biyokimyasal deneysel çeşitli maya amenability isnat edilebilir 4 yaklaşır. maya Ters genetik yaklaşımlar yaygın kromatin biyolojinin çeşitli yönlerine ilişkin belirli histon mutasyonların etkilerini incelemek için kullanılır olmuştur. deneyler bu tür için anormal hücre içi (nedeniyle hücrelerde plazmidlerin sayıları değişen) histon proteinleri seviyeleri ve yol açabilir bağımsız plazmidlerden ifade mutant histonlar kendi ana genomik lokusları eksprese edildiği hücrelerin kullanımı genellikle tercih edilir kromatin tr eş zamanlı değişikliksonuçta sonuçların yorumunu karıştırabilir vironments.

Burada, genomu içinde kalan eksojen DNA sekansları olmadan arzu edilen mutasyon (lar) ın üretiminde bir klonlama aşaması ve sonuç gerektirmez kendi ana genomik konumlarda histon genlerinin hedeflenen mutagenezi için izin veren bir PCR bazlı teknik açıklar. Bu teknik, maya etkili homolog rekombinasyon sistemi yararlanır ve diğer gruplar tarafından geliştirilen diğer benzer teknikler ile ortak birçok özelliğe sahiptir - özellikle Delitto Perfetto, alana özgü genomik (SSG) mutajenez ve klonlama içermeyen PCR bazlı alel yedek yöntemleri 5, 6, 7. Bununla birlikte, tarif tekniği özellikle histon gen mutagenezi için çok uygundur hale getiren bir yönü vardır. haploid maya hücreleri, dört çekirdek histon her iki olmayan a göre kodlanmıştırllelic ve yüksek ölçüde homolog genlerin: Örneğin, histon H3 HHT1 ve HHT2 genleri tarafından kodlanan ve iki genin açık okuma çerçeveleri (ORF'ler), sırayla% 90 üzerinde özdeştir. homoloji Bu yüksek derecede spesifik mutagenez için iki histon-kodlayan genlerin biri hedef için tasarlanmış deneyler karmaşık hale getirebilir. Yukarıda bahsedilen yöntemler genellikle homolog rekombinasyon sürücü hedef genin ORF içinde en azından bazı dizilerin kullanılmasını gerektirir ise, burada tarif tekniği için (daha az sekans benzerliği paylaşan) histon gen ORF eteklenen dizileri kullanır rekombinasyon adımı ve böylece arzu edilen mahaline mutagenez başarılı hedefleme olasılığını arttırır. Ayrıca, rekombinasyonu sürücü homolog bölgeleri daha verimli hedeflenen homolog rekombinasyon katkıda çok geniş olabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Not: in situ histon geni mutagenez hedef için deneysel strateji (Şekil 1 'de özetlenmektedir) çeşitli adımlar içerir. Bu adımlar şunlardır: URA3 geni hedef histon geninin (1) değiştirilmesi, (2) üretimi ve arzu edilen mutasyon (lar) yataklık primerler kullanılarak, hedef histon geninin iki kısmen üst üste parçalarının karşılık gelen PCR ürünlerinin saflaştırılması (3 ) kısmen örtüşen parçalarının PCR erimesi işaretleyici ile plazmit üzerinde (4) tam boyut PCR ürünlerinin ve omurga plasmid eş-dönüşüm ve seçim, (5) Resim 5-FOA dayanıklı, entegrasyon için tam boyut PCR ürünleri elde etmek için transformantlar, (6) 5-FOA-dirençli koloni saflaştırılması ve omurga plasmid kaybı, ve (7) Moleküler mutant alelinin uygun entegrasyonu için tahlil analiz eder.

Şekil 1
yerinde Mutajenesisin Hedeflenen Stratejisi Genel Bakış. Bu örnekte, hedeflenen gen HHT2, ancak herhangi bir diğer temel histon geni de bu strateji kullanılarak mutajenize edilebilir. Şekilde görüldüğü gibi (A) 'Haploid maya hücreleri düzenlenmiş iki histon H3 kodlayan genler (HHT1 ve HHT2) ve iki histon H4 kodlayan genler (HHF1 ve HHF2) liman (HHT1 ve HHF1 genleri kromozom II HHT2 yer almaktadır ve HHF2 genleri kromozom XIV bulunmaktadır - her bir durumda, oklar), transkripsiyon yönünde işaret etmektedir. Yöntemin birinci aşamasında, HHT2 geni ORF, bir hht2Δ :: URA3 suşu sebebiyet veren, URA3 geni ile değiştirilmiştir. Bölüm 1 (B), genomik bir DNA örneğinden HHT2 geninin doğal tipte bir kopyalama cins için iki PCR reaksiyonu için şablon olarak kullanılırgeninin iki kısmen üst üste parçaları te. Birinci reaksiyon için ters primer genomuna yerleştirilebilir istenen mutasyonu (ler) e karşılık gelir (kırmızı bir daire ile gösterilir), bir veya daha fazla uyumsuz olan nükleotidler içermektedir. İkinci reaksiyon için ileri primer (aynı zamanda kırmızı daire ile gösterilen) bir ters tamamlayıcı konfigürasyonda eşdeğer uyumsuzluk vardır. Iki PCR bölümü 1 'de üretilen ürün (ürün A ve B) daha sonra, füzyon PCR için şablon şekilde ürün A ve B tavlama Bu tam boy PCR oluşmasına neden Bölüm 2 de gösterilen iki primer kullanılarak olarak kullanılan istenen mutasyon (ler) barındıran ürünleri (bölüm 3 ürün c). (C) hht2Δ :: URA3 soyu daha sonra eş-dönüştürülmüş yoksun ortam (tam boy PCR ürünlerinin ve omurga plasmid (a HIS3- bu örnekte plazmidi işaretli) ile ve hücreler, plasmid varlığı için seçilmektedir hBu örnekte istidine). Transformantlar daha sonra 5-FOA direnci için elenir - dirençli hücrelerin gösterildiği gibi, URA3 geni PCR ürünü ve eksizyon üyelik için homolog bir rekombinasyon olayı geçirmiş için adaydırlar. mitotik hücre bölünmesi sureti ile omurga plazmitinin kaybetmesine istenen son histon mutant yol açar. Çoğunlukla kendiliğinden URA3 mutasyonlar ulaşan hücreleri tanımlayan 5-FOA plakalar doğrudan seçim ile karşılaştırıldığında doğru entegrasyon olaylarının belirlenmesi çok daha yüksek bir frekansta 5-FOA direnci sonuçları ve akabinde omurga plazmitinin bu seçimi bulduk. (Bu rakam referans 14 modifiye edilmiştir). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

URA3 ile Hedef Histon Gene 1. YedekGen

  1. URA3 geni 8, 9 hedef histon geninin ORF yerine standart PCR dolayımlı tek-aşamalı bir gen bozulması gerçekleştirin.
    NOT: Bu mutasyon, böylece URA3 mahalinde 8 içine PCR ürününün entegrasyonu kaçınarak, tüm endojen URA3 ORF kaldırır gibi ura3Δ0 taşıyan maya hücrelerinin kullanılması tavsiye edilir. S. cerevisiae'de fonksiyonel ama S. Cerevisiae URA3 geni ile sadece kısmi dizi benzerliğine sahip olan Alternatif olarak, K lactis URA3 geni bir URA3 arka histon değiştirme üretilmesi için etkin olarak kullanılabilir. türü de transformasyon deneyinde (Bu protokolün adım 4) omurga plazmidin seçilmesine izin verecek en az bir bileşik için oksotropik olmalıdır. Bu adım, bir hedef histon geneΔ halinde :: URA3 gerekli değildirsuşu zaten mevcuttur.

2. Üretim ve istenen mutasyonu barındıran primerler kullanılarak hedef Histon geninin iki kısmen üst üste fragmanlarına karşılık gelen PCR ürünlerinin saflaştırılması (lar)

  1. Hedef histon geninin iki kısmen üst üste parçalarının karşılık gelen PCR ürünleri.
    1. şu şekilde iki PCR reaksiyonları hazırlanması:
      1. Isı ayarlı 1 ul DNA şablonu, 5 μl10 uM ileri primer, 5 μl10 uM ters primer, 0.5 ul (1.25 U): Aşağıdaki reaksiyon ayarlamak gen (Şekil 1B ürünü a), ilk yarısında tekabül eden PCR ürünleri üretmek için DNA polimeraz, 10 ul 5x DNA polimeraz tamponu, 5 ul dNTP karışımı (her biri 2 mm) ve 23.5 ul dH 2 O
        Not: Şablon DNA, hedef histon geni için bir gerilme vahşi tip türetilen genomik DNA olabilir standart pro kullanılarak izole10 prosedürlerinin. DNA konsantrasyonu ve genomik preparasyonlar safsızlıkların seviyesi farklılaşmaların hesaba katılması için, bu seyreltilmemiş DNA veya genomik preparatlar değişik seyreltiler kullanılarak reaksiyonları optimize etmek için tavsiye edilir (örneğin, 1:10 ve 1: 100). ileri primer, hedef genin üst akışında bir bölgeye tavlama gerekir. Ters primer (örnekler için Şekil 1B-1 ve Temsilcisi Sonuçlar bölümüne bakınız) uzunluğunda ~ olması, ORF içinde 40 nükleotidleri tavlama ve bunun ortasında bir yerde istenen mutasyonu (ler) içermelidir. yüksek doğrulukta bir DNA polimeraz kullanılması PCR ürünlerinin sentezi sırasında istenmeyen mutasyonlar oranlarını azaltmak için tavsiye edilir.
      2. 2.1.1.1 fakat farklı primerler ile belirtildiği gibi gen (Şekil 1B ürünü b), ikinci yarısına tekabül eden PCR ürünleri üretmek için, bir tepki ayarlayın.
        NOT: ileri primer uzunluğunda ~ olması, ORF içinde 40 nükleotidleri tavlama, ve bir yerde onun ortasında istenen mutasyonu (ler) içermelidir. Bu primer mutasyon (lar) ının 2.1.1.1 ters primer mutasyon (lar) ın ters komplemanı olduğuna dikkat edin. Ters primer, hedef genin alt bölgeye tavlanması gerekmektedir (örnekler için Şekil 1B-1 ve Örnek Sonuçlar bölümüne bakınız).
    2. Aşağıdaki ayarlarla bir PCR reaksiyonları yerleştirin: 94 ˚C 30 saniye; Aşağıdaki ayarlardan 30 döngü: 98 ˚C 10 sn, 60 ° 5 sn, 72 ˚C 1.5 dakika; ve 72 ° C'de 10 dakika.
      PCR parametrelerinin optimizasyonu spesifik primer setleri için gerekli olabilir ve histon geni hedef Not:.
  2. 89 mM Tris baz, 89 mM borik asit, 2.5 mM EDTA (TBE) tampon maddesi içinde bir% 0.9 düşük erime noktalı agaroz jeli üzerinde PCR reaksiyonu ürünü 50 ul - 20 çalıştırın.
  3. PCR pr içeren Cut agaroz jel bölümlerive temiz bir neşter veya jilet kullanarak jelden oducts 1.5 ml mikrosantrifüj tüpüne her aktarın. Kullanıma hazır olana kadar -20 ° C'de, PCR ürünlerini içeren agaroz bölümleri saklayın.

İki Parçalı Çakışan Fragments 3. Fusion PCR Entegrasyon Tam Boyut PCR Ürünleri Elde

  1. PCR reaksiyonları için şablon hazırlanması
    1. 5 dakika boyunca 65 ° C'de bir ısıtma bloğu kümesindeki mikrosantrifüj tüpleri yerleştirerek adım 2.3 agaroz jel bölümleri eriyik (ya da tam olarak eriyene kadar). Vorteks tüpler her 1-2 dk eritme sürecini kolaylaştırmak için.
    2. Her bir numuneden erimiş agaroz bir miktar aktarın (örneğin 50 ul, her biri 100 ul toplam) tek bir mikrosantrfuj tübüne ve vorteks ile karıştırın. Füzyon PCR reaksiyonlarında şablon olarak kullanın. Kullanıma hazır olana kadar -20 ° C'de tüp yerleştirin.
  2. Tam boy PCR ürününün büyük miktarda yükseltmek (ürün c) Şekil 1B
    1. 2 ul hedef DNA, 10 ul 10 uM ileri primer, 10 ul 10 uM ters primeri, 1 ul (2.5 U) termostabil DNA polimeraz, 20 ul 5x DNA polimeraz tamponu, 10 ul altı PCR reaksiyonları, aşağıdaki bileşenlerin her ayarlama dNTP karışımı (2 mM her biri) ve 47 ul dH 2 O
      Not: reaksiyonların sayısı, PCR etkinliğine bağlı değiştirilebilir. Erimiş vorteks ıle karıştırılmıştır, ve PCR reaksiyon karışımına Son eklenen kadar model DNA (3.1.2) 65 ° C'ye ısıtılmalıdır. Eklendikten sonra çözümü pipetleme ve birkaç kez yavaşça ama iyice karıştırın. Farklı örneklerde DNA konsantrasyonunun farklılıkları hesaba katmak, ilk sulandırılmamış şablon veya şablonun farklı seyreltiler birini kullanarak tepkilerini optimize etmek için tavsiye edilir (örneğin, 1:10 ve 1: 100). hastalıklı olarak hedef genin iki kısmen üst üste binen fragmanlara tavlama Kullanılan iki primerŞekil 1B-2 ustrated ve son PCR ürünleri, homolog rekombinasyon adım (örnekler için Örnek Sonuçlar bölümüne bakınız) izlerler, URA3 ORF kuşatan bölgelere iki tarafında homolog en az 40 baz çiftine sahip olacaktır şekilde tasarlanabilir. yüksek doğrulukta bir DNA polimeraz kullanılması PCR ürünlerinin sentezi sırasında istenmeyen mutasyonlar oranlarını azaltmak için tavsiye edilir.
    2. Aşağıdaki ayarlarla bir PCR tüpleri yerleştirin: 94 ˚C 30 saniye; Aşağıdaki ayarlardan 30 döngü: 98 ˚C 10 sn, 50 ˚C 15 sn, 72 ˚C 1.5 dakika; ve 72 ° C'de 10 dakika.
      Not: PCR parametrelerinin optimizasyonu özel primer kümeleri ve hedef histon geni için gerekli olabilir.

Plazmid üzerinde Marker için 4. Tam Boyut PCR Ürünleri ve Omurga Plazmid Co-dönüşümü, ve Seçim

  1. PCR ürünlerinin konsantre
    1. s havuzix PCR reaksiyonları tek bir mikrosantrifüj tüp içine adım 3.2.2 den (600 ul toplam) ve vorteks karıştırın.
    2. mikrosantrifüj tüplerinde üç 200 ul kısma örnek bölün. 3M sodyum asetat 20 ul (pH 5.2) ve% 100 etanol içinde 550 ul ekleyerek, her bir tüp içinde DNA hızlandırabilir. İyice çözelti birleştirilir ve en az 15 dakika boyunca buz üzerine yerleştirin. 10 dakika boyunca ~ 14,000 x g'de santrifüj ile DNA'nın toplanması 200,% 70 etanol ul, ve kuru hava ile pelet yıkayın.
    3. DH 2 O 25 ul her bir DNA pelletini, ve (75 ul toplam) tek bir tüp içine havuz.
  2. Maya co-dönüşüm
    1. Maya ekstraktı Peptonlu Dekstroz (YPD) 11 orta sıvı bölüm 1'de oluşturulan gerginlik gecede kültür 10 ml hazırlayın.
    2. Sonraki sabah, doymuş bir gece boyunca kültür 8 ml YPD sıvı ortam 400 ml inoküle ve çalkalanarak inkübe4 30 ° C'de - 5 saat hücrelerin büyüme logaritmik fazı girmesine izin vermek için.
    3. 10 dakika boyunca ~ 3.220 x g santrifüj ile hücreler toplama sıvı ortam atmak ve 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1 hacim hücreleri tekrar süspansiyon 0.1 M lityum asetat çözeltisi (TE / LiAc) .
    4. 10 dakika boyunca ~ 3,220 x g'de santrifüj ile hücreler toplamak ve TE / LiAc atın.
    5. 1 ml TE / LiAc hücrelerinin yeniden süspanse.
    6. mikrosantrifüj tüpü içinde aşağıdaki reaksiyon kokteyli kurun: hücre 800 ul aşama 4.2.5 arasında, kaynatılmış, 10 mg / ml som balığı spermi DNA'sı 40 uL, omurga plasmid DNA 12.5 ug toplam ve konsantre PCR ürünü 75 ul adım 4.1.3 den.
      Not: somon sperm DNA 5 dakika için kaynatılır ve reaksiyonunda kullanılmadan önce en az 5 dakika için buz üzerine yerleştirilmiş olmalıdır. ilave omurga plasmid DNA toplam hacmi en az (~ 80 ul ya da daha az) tutulmalıdır. Bir omurga plasm bir örnek için Temsilcisi Sonuçlar bölümüne bakınİD.
    7. eşit sekiz mikrosantrifüj tüpler (- 8 Tüpler 1) içine kokteyl iyice tüp ve kısım karıştırın.
    8. Aşağıdaki iki kontrol dönüşüm reaksiyon tüpleri ayarlayın:
      1. Boru 9 (Resim PCR ürünü kontrol): Aşama 4.2.5 den 100 ul hücre, kaynatılmış, 10 mg / ml som balığı spermi DNA'sı 5 ul;, 1.56 ug toplam (5 dakika için kaynatılır adım 4.2.6 nota bakınız) omurga plasmid DNA ve hiçbir PCR ürününün ilave edildi.
      2. Tüp 10 (Resim DNA kontrol): Aşama 4.2.5, kaynatılmış, 10 mg / ml somon spermi DNA'sı (aşama 4.2.6 Not) 5 uL hücreler 100 ul DNA eklenmiş omurga plasmid ve hiç PCR ürünü ilave edildi.
      3. yukarı pipetleme ve birkaç kez yavaşça ama iyice her iki tüpü karıştırın.
    9. 30 dakika boyunca 30 ° C'de on inkübe edin.
    10. Her bir tüpe, TE / LiAc içinde% 40 polietilen glikol, 1.2 ml (PEG 3350) ekleyin. Çözelti homojen hale gelene kadar iyice P-1000 pipeti kullanarak karıştırın.
    11. 30 on tüpler inkübe30 dakika ° C. Yavaşça aşağı pipetleme çözeltisi karışımı ve ardından 15 dakika boyunca 42 ° C'de inkübe edin.
    12. 30 sn için ~ 14,000 xg bir mikrosantrifüj tüpleri iplik hücreleri toplamak. Sıvı atın ve steril dH 2 O 1 ml hücreleri tekrar süspansiyon
    13. 30 sn için ~ 14,000 xg bir mikrosantrifüj tüpleri iplik hücreleri toplamak. Sıvı atın ve steril dH 2 O 500 ul hücreleri tekrar süspansiyon
    14. Havuz tüpleri 1-8 birlikte (toplam 4 ml hacim) ve aşağı yukarı pipetleme ile iyice karıştırın.
    15. Levha omurgası plazmidin seçilmesine yirmi tam az bırakma ortamı plakaları 11 (levhalar 1-20) her biri için yukarıdaki karışım 200 ul.
    16. Levha boru 9'daki karışıma 200 ul ve kendi seçimi plaka üzerinde tüp 10, her karışımın 200 ul (plakaları, sırasıyla 21 ve 22).
    17. 5 gün 3 - 30 ° C 'de 22 inkübe edinplazmid transformantlar seçin.
    18. inkübasyon 5 gün - 3 sonra dönüşüm plakaları kontrol edin. Yaklaşık 5.000 koloni plakalar 1-21 (bir örnek için Temsilcisi Sonuçlar bakınız) görünür olmalı ve hiçbir kolonileri 22 mevcut olmalıdır.

5-FOA dirençli transformantlar 5. Ekran

  1. Plakalardan hücreleri aktarın 1-20 (ve dönüşüm, kontrol olarak plaka 21) 5-fluoroorotic asit (5-FOA) plakaları 11 ile çoğaltma kaplama entegrasyonu sonucu URA3 geninin kaybı taranması amacıyla 12 istenilen yerde PCR ürünleri.
    1. plaka kapağını çıkarın ve steril bir kadife koloniler içeren plaka basın. kadife plaka basarak 5-FOA plakasına kadife hücreleri aktarın. 2 gün boyunca 30 ° C'de inkübe edin.
  2. 2 günlük inkübasyondan sonra, dikkatli bir şekilde gr 5-FOA plakaları kontrolowth.
    NOT: Bir aday entegrasyon olay 5-FOA plaka üzerinde küçük bir asimetrik "ezilmiş" koloni tarafından temsil edilecek - tersine, 5-FOA plakaları üzerinde büyüyen küçük papillalar kolonilerin büyüme sırasında ortaya çıkan spontan URA3 mutasyonların olası temsilcisi dönüşüm plakaları ve istenen uyum olayı (bazı örneklerde bu noktada daha hazırlanması için Örnek Sonuçlar bölümünde ve için bakınız Şekil 3) 'i temsil etmek ve böylece olası değildir.

5-FOA dayanıklı Kolonileri ve Omurga Plazmid Kaybının 6. saflaştırılması

  1. Steril kürdan kullanarak, YPD plakalar üzerine tek koloniler için adım 5.2 ve çizgi açıklanan 5-FOA plakaları aday koloniler seçin. 30 ° C 'de 3 gün - 2 inkübe edin.
  2. Kuluçka, kopya ardından - plaka taze YPD plaka her YPD arıtma plaka, bir bırakma plakası kaybı kontrol etmek için urasil eksikURA3 geni, ve bir ikinci çıkış elemanı omurga plazmitinin olup olmadığını belirlemek için izlemek için. 30 ° C'de 2 gün 1 - inkübe edin.
  3. Inkübasyondan sonra, YPD plaka üzerinde büyüyen ama ya bırakma plaka üzerinde büyüyen değil her aday örnek bir koloni tanımlamak (örneğin bir koloni rekombinasyon olayı ile URA3 genini kaybetmiş beklenen ve mitoz sırasında omurga plazmid kaybolur hücre bölünmesi). Taze YPD plakalar üzerinde bu tür koloniler Restreak. Bu koloniler entegrasyon adayları ve 7. adımda daha da analiz edilecektir.

Mutant alelinin Uygun Bütünleşme tahlile 7. Moleküler Analiz

  1. Standart prosedürler 10 kullanılarak aday örneklerinden genomik DNA izole edin.
  2. Hedef sitesini kapsayan genomik bölge yükseltin.
    1. 0.5 ul DNA şablonu, 5 ul: her bir örnek için, aşağıdaki PCR reaksiyon ayarlama10 uM ileri primer, 5 ul 10 uM ters primer, 0.5 ul (2.5 birim) Taq DNA polimeraz, 5 ul 10x Taq DNA polimeraz tamponu, 5 ul dNTP karışımı (her biri 2 mm) ve 29 ul DH 2 O
      Not: Şablon DNA, aday örneklerinden türetilmiş genomik DNA'dır. Bir orijinal histon geneΔ türetilen genomik DNA :: şablon olarak URA3 suşu kullanarak, şablon olarak yabani tip bir histon soyundan başka bir kullanılarak genomik DNA: iki kontrol reaksiyonları dahil edilmesi önerilmektedir. DNA konsantrasyonu ve genomik preparasyonlar safsızlıkların seviyesi farklılaşmaların hesaba katılması için, bu seyreltilmemiş DNA veya genomik preparatlar değişik seyreltiler kullanılarak reaksiyonları optimize etmek için tavsiye edilir (örneğin, 1:10 ve 1: 100). Emin olmak için önemli olduğu varsayımsal entegre PCR ürünü kapsadığı bölgenin dışından DNA dizilerine, bu primerler, tavlama - bu şekilde, bu r PCR ürünlerinin boyutunureaksiyonlarda doğru genomik konumda ürünlerin entegrasyonu için bir tanı aracı olarak kullanılabilir (bir örnek için Temsilcisi Sonuçlar bakınız).
    2. aşağıdaki ayarlarla bir PCR reaksiyonları yerleştirin: 94 ° C 3 dakika; Aşağıdaki ayarlardan 30 döngü: 94 ° C'de 45 saniye, 50 ° C, 45 saniye, 72 ° C'de 2 dakika; ve 72 ° C'de 10 dakika.
      Not: PCR parametrelerinin optimizasyonu özel primer kümeleri ve hedef histon geni için gerekli olabilir.
  3. PCR ürünlerinin işlenmesi
    1. % 0.8 TBE agaroz jeli üzerinde her bir reaksiyonun 20 ul çalıştırın.
    2. URA3 geni başarılı varsayımsal mutasyona uğramış histon geni tarafından değiştirilmiştir olup olmadığını belirlemek için bir referans olarak, DNA standartları kullanılarak PCR ürünlerinin boyutunu değerlendirmek (örnek için Örnek sonuçlar).
      NOT: Bazı durumlarda, arzu edilen mutasyon (lar) histon genler girmiş ya oluşturabilir ya da oturup bir kısıtlama yoke. Bu durumda ise, doğru entegrasyon gösterge büyüklükte PCR ürünlerinde arzu edilen mutasyonun varlığı jel elektroforez analizi ile takip karşılık gelen sınırlama enzimi ile sindirme ürünleri tabi tutulması ile tespit edilebilir (örnek için Örnek Sonuçlar bakınız) .
    3. DNA dizilimi doğru entegrasyon gösterge boyutu Konusu PCR ürünleri istenilen mutasyon (lar) varlığını doğrulamak için ve hiçbir ek mutasyonlar genomu içine girmiştir emin olmak için.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In situ mutagenez stratejisi hedef arasında temsili bir örnek olarak, bir glutamik asit (mutan H3-R53E) bir arjininden pozisyonda 53 bir ikame barındıran bir histon H3 mutan proteini ifade eden bir hht2 alel üretilmesini tarif eder.

Biz HHT2 bütün ORF URA3 geni (protokol aşamasını 1 e bakınız) ile ikame edildiği bir soy elde. Bu soy, yAAD156 da hücrelerin histidin için oksotropik olduğu neden olan bir his3Δ200 alel, barındırır. Protokolün adım 2'de gösterilen prosedüre göre, o zaman HHT2 iki kısmen üst üste parçaları oluşturulur. Aşağıdaki primerler, birinci fragmana ait kullanılmıştır: ileri primer (OAD20): 5 'GCGTTCATTATCGCCCAATGTG 3' ve revers primer (R53Erev): 5 'GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3'. aşağıdaki PRIMERS ikinci fragmanı kullanılmıştır: ileri primer (R53Efor): 5 'CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3' ve revers primer (OAD21): 5 'GCGCTTGATCAGCAGTTCATCG 3'. bu verimli tavlama için izin verdiği, bu mutasyona uğramış nükleotitler yabani tip dizilerin ikisi arasında uzun menziller sokuldu - İkinci reaksiyonda ilk tepki Ters Astar ve İleri Astar (küçük harflerle) mutasyona uğramış istenen nükleotid içeren unutmayın mutasyonlu pozisyonlarda uyumsuzluğu rağmen, şablon DNA primeri. Ayrıca, bu iki primer mutasyona uğramış nükleotitler, birbirini tamamlayıcı ters ve sonuçta kodlanmış protein R53E mutasyonu üreten kodon değişikliği GAA bir AGA sonuçlanan sens iplikçik GA mutasyonuna bir Ag neden olduğuna dikkat edin. Bu PCR reaksiyonları alınan sonuçlar Şekil 2A'da gösterilmiştir.

basamak 3'deki yöntem kullanılarak, daha sonra bir hidro Tam boyutlu PCR ürünleri ated. Kullanılan primerler ileri primer (OAD479) 5'TATGGCTCGGTGTCAAAACA 3 've revers primer (OAD480): 5' CATGGTTTCTTGCCGGTTAT 3 '. Bu primerler tasarlanırken, ya homolog rekombinasyon reaksiyonu (homoloji bölgeleri uzun, daha verimli ve spesifik homolog rekombinasyon olayları olacak götürmek biter üzerinde ortaya çıkan füzyon PCR ürünleri en az 40 baz çifti dahil olduğundan emin olmak için önemlidir ) olmak. Yaptığımız denemelerde, tam boyutlu PCR ürünleri sırasıyla 195 baz çifti bölgesi ve 220 baz çifti bölge homolog yukarı bölgelere ve HHT2 ORF aşağı, içeriyordu. Bu PCR ürünlerinin bir örneği, agaroz jel elektroforezi (Şekil 2B) kullanılarak analiz edilmiştir.

Tam boy PCR ürünleri daha sonra plazmid pRS413 (a sentromerik ile transforme ortak edildi, HIS3- plazmid işaretlenmişprotokol aşama 4'te tarif edildiği gibi F "> 13) ve transformantlar histidin (SC-His plakalar) yoksun levhaları üzerinde seçilmiştir. His + kolonileri daha sonra protokol aşama 5'te tarif edilen prosedürleri takip eden 5-FOA direnci için taranmıştır. Şekil 3, aynı zamanda, Şekil 3'te sunulan bir dönüşüm plakasının (SC-his) ve aday örneklerinin çoğaltma kaplama SC-his plakalardan. örnek olarak, istenen uyum olaylarını temsil etmek için olası örnekleri takip eden 5-FOA plakalar bir örneğini göstermektedir protokolün 6. adımda açıklandığı gibi. bizim deneyde, ekranlı ~ 90,000 transformantların arasından oniki aday örnekleri tespit ettik. Bu adaylar daha sonra arıtılmış bulundu.

On iki aday sonra, mutant PCR ürünleri ile URA3 geni otantik bir yedek yansımış değerlendirmek için protokol aşama 7'de tarif PCR analizine tabi tutuldu. Bizim experimen içint, biz PCR ürününün entegrasyon bölgesinden aşağıya doğru 302 baz çiftini tavlanan PCR ürününün entegrasyonu sitesi ve ters primer 89 baz çifti yukarı yumuşayan bir ileri primer kullanılır. HHT2 lokus HHT2 (veya HHT2 mutant alternatifler baz çifti ikameleri barındıran) veya boyutu 2188 baz çifti PCR ürünlerinin tarafından işgal edilmiş ise odağı, URA3 işaretleyici gen tarafından işgal edilirse, bu primerler, boyutu 1217 baz çifti PCR ürünleri . 5 'GAAACTATTGGCACGCCCTA ve revers primer bu (OAD477) kullanılır:: 5' CCTGCGAATCAACCGATACT 3 'ileri primer sekansı (OAD476) kullanılacak. Tespit on iki aday dördü doğru konuma (örneğin, bkz, Şekil 4A) bir PCR ürünü entegrasyonunu göstermektedir. GA mutasyon AG, yeni bir Eco RI kısıtlama alanı oluşturur çünkü Son olarak, bir başarılı entegrasyon örneklerinden biri PCR ürünlerini tabi Şekil 4B). Bu özel durumda, bu ek istenmeyen mutasyonlar genomuna dahil değil sağlamak için PCR ürünleri sırası değil, fakat, bir son çalışma 14 HHT2 mutasyonlar büyük bir sayı üretmek için bu çok benzer bir prosedür kullanılmış, ve entegre mutant alelleri çoğunluğu istenen dışındaki herhangi bir mutasyon taşıyan bulundu.

şekil 2
Şekil 2: PCR Ürünleri barındıran Nesil Maya Genom içine Entegrasyon Mutasyonlar İstenen. (A) PCR reaksiyonu, arzu edilen mutasyonların barındıran HHT2 kısmen üst üste binen parçaları üretmek için. Üst: t karikatür gösterimiiki HHT2 fragmanları elde etmek için iki PCR reaksiyonu (1B-1 bakınız Şekil). Kırmızı daireler genin duygusu ipliğinde AG GA mutasyonu tanıtmak için kullanılan primerler eşleşmeyen nükleotidleri temsil etmektedir. Alt: PCR ürünleri A ve B (sırası ile, kulvarlar 2 ve 3), jel elektroforezi analizi. DNA standartları maya genomuna entegrasyon için tam boy PCR ürünü oluşturmak için şerit 1 (B) 'Füzyon PCR reaksiyonunda gösterilir (1 b-2 ve şekil 3). En: karikatür PCR reaksiyonunda temsili ve PCR ürünü (ürün c) beklenen. Yukarıdaki (A) 'da tarif edildiği gibi kırmızı daireler mutasyona istenen temsil eder. Alt: PCR ürünleri c jel elektroforesis (şerit 2). DNA standartları şeritli 1'de gösterilmiştir , bu rakamın büyük halini görmek için lütfen buraya tıklayınız.


Şekil 3: Co-dönüşüm Deney ve 5-FOA ekranından Temsilcisi Sonuçlar. Sol: 30 ° C'de 3 günlük inkübasyondan sonra eş-dönüşüm işlemine tabi hücreleri ile kaplı Örnek SC-His plaka. Yaklaşık 5.000 koloniler sayılmıştır. Orta: 30 ° C'de 2 günlük inkübasyondan sonra SC-co-dönüşüm plakasından çoğaltma kaplama, aşağıdaki Örnek 5-FOA plaka. Numuneler 1 ve 2 nedeniyle asimetrik morfolojiye başarılı bir entegrasyon olayı ile gitmiş olan için aday olarak kabul edildi. Hht2 alleline sahip URA3 geni gerçek yerine bir sonucu olarak, bir dönüştürülmüş hücre SC-His plakasına kaplanmıştır önce meydana gelme olasılığı (ya da çok kısa bir süre sonra) ve bu nedenle, bu konumda ortaya çıkacak kolonisi çoğunlukla, eğer sadece değil, 5-FOA dayanı içerecektirt hücreleri - böyle bir koloni daha sonra daha sonra çoğaltma kaplama plaka üzerinde hücrelerin bir asimetrik görünümlü yama sebebiyet veren, bu ezilmiş olacak bir 5-FOA plakasına olduğunda. Bunun tersine, kendiliğinden koloni oluşumu sırasında ortaya çıkabilecek URA3 genindeki mutasyonlar bir koloni küçük bir bölgede sınırlı olması daha muhtemeldir ve 5-FOA plakasına çoğaltma kaplama zaman papilla doğuran böylece daha olasıdır. Sağ: 30 ° C'de 3 günlük inkübasyondan sonra bir SC-co-dönüşüm plakasından çoğaltma kaplama ardından farklı bir Örnek 5-FOA plaka. Papilla, çok açık bir şekilde görülebilir inkübasyondan 3 veya daha fazla gün sonra spontan URA3 mutasyonları olup temsil muhtemeldir - bir ek aday (Numune 3) ve iki küçük papillalar bu plakanın (örnekler 4 ve 5) üzerinde görülebilir istenilen entegrasyon olayı. Görmek için buraya tıklayınızBu rakamın daha büyük bir versiyonu.

Şekil 4,
Şekil 4: Aday Entegrasyon Örnekleri Moleküler Analizleri. (A) PCR testi başarılı entegrasyon olayları tanımlamak için. En: genomuna hht2 mutant allelin başarılı entegrasyonu değerlendirmek için kullanılan PCR reaksiyonlarının karikatür temsilleri. Alt: Bir HHT2 vahşi tip suşu elde edilen genomik DNA (bir kontrol olarak kullanılmıştır, şerit 2), şekil değiştirme yAAD156 (şerit 3, bir kontrol olarak kullanılan) hht2Δ :: URA3 değiştirme barındıran kullanılarak PCR reaksiyonlarının jel elektroforez analizi, aday entegrasyon örneği (şerit 4) ve 5-FOA dayanıklı papillalar örneği (doğru entegrasyon olayını temsil etmek üzere olası ve böylece, şerit 5). DNA standartları Aday entegrasyon örnek için PCR ürünlerinin büyüklükleri consiste olduğu şerit Not 1. gösterilmiştirnt başarılı entegrasyon etkinlikle, papilla numune için PCR ürünlerinin boyutunu ise sağlam bir hht2Δ :: URA3 mahalinde ile tutarlıdır. (B) Çevre RI sindirim mutant allelin varlığını doğrulamak için. En: vahşi tip HHT2 geni ya da mutant hht2 aleli ya da ihtiva eden PCR ürünleri, bir EcoRI sindirimi reaksiyonundan türetilmiş beklenen sindirim fragmanları çizgi gösterimi. Alt: vahşi tip HHT2 suşundan türetilen PCR ürünlerinin sindirme reaksiyonları jel elektroforesis (şerit 2, panel A Şerit 2'de kullanılan ile aynı örnekten elde edilmiştir Burada kullanılan PCR ürünleri) ve bir aday entegrasyon örneği ( şerit 3, bu panelde, A bir hat 4'te kullanıldığı gibi), aynı örnekten elde edilmiştir burada kullanılan PCR ürünleri. DNA standartları sindirim desenleri GA mutasyon AG başarıyla aday genomuna girmiştir teyit o şerit 1. Not gösterilmektedirEntegrasyon örnek. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Haploid S. cerevisiae hücreleri dört temel histon proteinlerinin her biri için kod özel mutagenez için iki genin biri hedeflemek isteyen araştırmacılar için bir meydan okuma temsil edebilir olmayan iki alel genler arasındaki dizi homoloji yüksek düzeyde. Daha önce sık kullanan, Delitto Perfetto, alana özgü genomik (SSG) mutajenez ve klonlama içermeyen PCR bazlı alel değiştirme yöntemleri 5, 6, 7, hem de daha yeni maya CRISPR tabanlı teknikleri 15 de dahil olmak üzere, maya mutagenez yöntemleri tarif istenen genomik siteye rekombinasyon veya onarım makine işe bir hedef genin ORF içerisindeki sekanslarda, en azından kısmen en sonunda son mutant aleli üretir. Öte yandan, burada sunulan stratejiyi homologo sürücü hedeflenen ORF eteklenen DNA dizisi kullanırUS rekombinasyon olayı mutasyon entegrasyonu için gerekli olan ve bunun bir sonucu olarak, yüksek ölçüde homolog ORF sahip iki gen olmasına rağmen başka bir yere bir genin daha spesifik hedefleme için izin verir. Bu özellik, özellikle, histon mutajenez için uygundur stratejimiz yapar. Bununla birlikte, bu strateji de, maya genomuna diğer genlerin mutagenezi için adapte edilebilir.

stratejimizin Ek özellikler tasarlanabilir mutant genlerin homolog rekombinasyon sürücü bölgelerin uzunlukları böylece (istenilen mutasyon yanı sıra hedef genomik yerde entegrasyon etkinliğinin artırılması ve bu, çok geniş olması bu gerçekleri içerir ler ) ek DNA dizileri genoma eklenir. Bu sistemin diğer bir avantajı URA3 olan belirli histon geninin yerine barındıran bir suş inşa edildikten sonra, bu özel HIST istenen herhangi bir mutan versiyonunun üretimi için kullanılabilir olmasıdırBir geni. Bu durumda, örneğin, isteğe bağlı olarak bir araştırma eden kullanılabilir suşu yAAD156, de novo hht2Δ :: URA3 alel inşa gerek olmadan herhangi bir arzu edilen hht2 mutasyon yapmak için kullanılabilir. Son olarak, uygun şekilde tasarlanmış PCR primerlerini kullanarak, bu strateji de sürece bağlantılı şekilde birbirine (örneğin, biz kodlayan bir hht2 allel yarattı yakın olarak, iç silmeler veya birden fazla kodon mutasyonlarla histon alelleri oluşturmak için kullanılabilir H3-K56R, bu stratejiyi kullanan L61W çift mutant protein).

özel olarak mutajenez için iki yüksek ölçüde homolog histon gen bir hedefleme kabiliyeti farklı deneysel ayarları bir dizi yararlı olabilir. HHT1-HHF1 genleri HHT2-HHF2 genlerinin 16 ile karşılaştırıldığında farklı düzeylerde ifade edilir çünkü belirli bir H3 veya H4 mutasyon di sağlayıp sağlamadığı Örneğin, bu belirlemek için ilgi olabilirBu eksprese edildiği genin bağlı fferent fenotipleri. Diğer bir örnek, bir araştırmacı her iki mukabil histon gen belirli bir histon mutantını ifade haployid hücrelerini oluşturmak için istediği bir senaryo - bu ilk çapraz boyunca çift mutant haployid hücrelerini elde etmek daha sonra iki farklı suşlarda her biri bağımsız olarak gen mutasyonu ve elde edilebilir ve istenen mayoz ürünlerin müteakip izolasyon. Yine başka bir örnek histon H2A ve H2B mutagenezi ile ilgilidir: Her proteinin iki biraz farklı izoformlar gelen olmayan alelik gen kümesi tarafından kodlanmış göz önüne alındığında, bir araştırmacı, belirli bir H2A veya H2B mutasyonu etkilerini değerlendirmek isteyebilirsiniz Her iki izoformun bağlam. HTA1 ve HTB1 loci mutagenize için deney tasarlarken, araştırmacılar suşları bir (hta1-htb1) taşıyan bu ö gösteren son bulgular farkında olmalıdır canlı olan (sırasıyla H2A ve H2B, kodlayan) ben sadeceBu sonuçların yorumlanmasını karmaşık hale getirebilir olarak f onlar, küçük dairesel 17. kromozomun nesil yoluyla HTA2-HTB2 lokus (ve aynı zamanda yakındaki HHT1-HHF1 lokusu) amplifiye.

Son zamanlarda, normal olarak amino asidi lösin 14 tarafından işgal edilmiş pozisyon 61, tüm muhtemel amino asit ikamelerini ifade histon H3 proteinleri oluşturmak için bu histon mutagenez stratejisi versiyonu kullanılmıştır. Bu deneyler için, yerine mutagenez için başlangıç gerginlik olarak yAAD156 kullanarak, biz URA3 ve TRP1 beslenme belirteçleri (yerine URA3) hem de HHT2 ORF yerini barındıran suşu yADP106 kullanılır. Her iki marker genlerinin mevcudiyeti candidat olarak, 5-FOA ekranı ve saflaştırma aşama (5 ve protokol 6 kademede) aşağıdaki mutant PCR ürünlerinin entegrasyonu için adayların tanımlanması kolaylaştırılmışTrp + fenotip - spontan URA3 mutasyonu Ura ile hücrelerde sonuçlandı oysa, - ve Trp - es fenotipik Ura oldu. bir birim olarak büyütülmüş ve bu tarifnamede tarif edilen bir strateji kullanılarak başka histon gen mutagenezi için kullanılabilir URA3-TRP1 kaseti dizisi olarak yADP106, isteğe bağlı olarak mevcuttur.

Edilememesi entegrasyon aşamasında ya da eş-dönüşüm aşamasının ardından transformantların yetersiz sayıda için kullanılan tam boy PCR ürünlerinin yetersiz miktarda olmak üzere olası nedenleri, bir dizi atfedilebilecek olabilir bu stratejiyi kullanarak istenen histon mutantlar elde etmek. İkinci sorun ko-transformasyon deneyinde omurga plazmid yüksek miktarda kullanılarak çözülebilir ise eski bir sorun, PCR reaksiyonlarının birlikte büyük setleri havuzu ya da ürünün daha yüksek bir verim üretmek farklı primer setleri tasarlayarak ele alınabilir. gerçiDaha önce belirtildiği gibi öf, bir, iki veya daha fazla amino asit yer değiştirmelerine barındıran histon mutantlar oluşturmak için bu yordamı kullanabilirsiniz, hedeflenen amino asitler, ilgili kodonları aynı astar molekül içinde yer alması gerekiyor çünkü birbirine nispeten yakın olmak zorunda. Böylece, bu strateji, kolayca protein uzunluğu boyunca birbirinden uzaktan bulunan birden fazla mutasyon histonların üretimi için adapte edilemez.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder (DNA standards) New England BioLabs N3232L
Agarose  Sigma A5093-100G
Boric Acid Sigma B0394-500G
dNTP mix (10 mM each) ThermoFisher Scientific R0192
EDTA solution (0.5 M, pH 8.0) AmericanBio AB00502-01000
Ethanol (200 Proof) Fisher Scientific 16-100-824
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma E4884-500G
Lithium acetate dihydrate Sigma L6883-250G
MyCycler Thermal Cycler BioRad 170-9703
Poly(ethylene glycol) (PEG) Sigma P3640-1KG
PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)  and 5x buffer Fisher Scientific 50-443-960
Salmon sperm DNA solution ThermoFisher Scientific 15632-011
Sigma 7-9 (Tris base, powder form) Sigma T1378-1KG
Sodium acetate trihydrate Sigma 236500-500G
Supra Sieve GPG Agarose (low metling temperature agarose) AmericanBio AB00985-00100
Taq Polymerase and 10x Buffer New England BioLabs M0273X
Toothpicks Fisher Scientific S67859
Tris-HCl (1 M, pH 8.0) AmericanBio AB14043-01000
a-D(+)-Glucose Fisher Scientific AC170080025 for yeast media
Agar Fisher Scientific DF0140-01-0 for yeast media
Peptone Fisher Scientific DF0118-07-2 for YPD medium
Yeast Extract Fisher Scientific DF0127-17-9 for YPD medium
4-aminobenzoic acid Sigma A9878-100G for complete minimal dropout medium 
Adenine Sigma A8626-100G for complete minimal dropout medium 
Glycine hydrochloride Sigma G2879-100G for complete minimal dropout medium 
L-Alanine Sigma A7627-100G for complete minimal dropout medium 
L-Arginine monohydrochloride Sigma A5131-100G for complete minimal dropout medium 
L-Asparagine monohydrate Sigma A8381-100G for complete minimal dropout medium 
L-Aspartic acid sodium salt monohydrate Sigma A6683-100G for complete minimal dropout medium 
L-Cysteine hydrochloride monohydrate Sigma C7880-100G for complete minimal dropout medium 
L-Glutamic acid hydrochloride Sigma G2128-100G for complete minimal dropout medium 
L-Glutamine Sigma G3126-100G for complete minimal dropout medium 
L-Histidine monohydrochloride monohydrate Sigma H8125-100G for complete minimal dropout medium 
L-Isoleucine Sigma I2752-100G for complete minimal dropout medium 
L-Leucine Sigma L8000-100G for complete minimal dropout medium 
L-Lysine monohydrochloride Sigma L5626-100G for complete minimal dropout medium 
L-Methionine Sigma M9625-100G for complete minimal dropout medium 
L-Phenylalanine Sigma P2126-100G for complete minimal dropout medium 
L-Proline Sigma P0380-100G for complete minimal dropout medium 
L-Serine Sigma S4500-100G for complete minimal dropout medium 
L-Threonine Sigma T8625-100G for complete minimal dropout medium 
L-Tryptophan Sigma T0254-100G for complete minimal dropout medium 
L-Tyrosine Sigma T3754-100G for complete minimal dropout medium 
L-Valine Sigma V0500-100G for complete minimal dropout medium 
myo-Inositol Sigma I5125-100G for complete minimal dropout medium 
Uracil Sigma U0750-100G for complete minimal dropout medium 
Ammonium Sulfate Fisher Scientific A702-500 for complete minimal dropout medium 
Yeast Nitrogen Base Fisher Scientific DF0919-07-3 for complete minimal dropout medium 
5-Fluoroorotic acid (5-FOA) AmericanBio AB04067-00005 for  5-FOA medium

DOWNLOAD MATERIALS LIST

References

  1. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389, (6648), 251-260 (1997).
  2. Campos, E. I., Reinberg, D. Histones: annotating chromatin. Annu Rev Genet. 43, 559-599 (2009).
  3. Rando, O. J., Winston, F. Chromatin and transcription in yeast. Genetics. 190, (2), 351-387 (2012).
  4. Duina, A. A., Miller, M. E., Keeney, J. B. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. Genetics. 197, (1), 33-48 (2014).
  5. Storici, F., Resnick, M. A. Delitto perfetto targeted mutagenesis in yeast with oligonucleotides. Genet Eng (N Y). 25, 189-207 (2003).
  6. Gray, M., Kupiec, M., Honigberg, S. M. Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast. BMC Biotechnol. 4, 7 (2004).
  7. Erdeniz, N., Mortensen, U. H., Rothstein, R. Cloning-free PCR-based allele replacement methods. Genome Res. 7, (12), 1174-1183 (1997).
  8. Brachmann, C. B., et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 14, (2), 115-132 (1998).
  9. Lundblad, V., Hartzog, G., Moqtaderi, Z. Manipulation of cloned yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  10. Hoffman, C. S. Preparation of yeast DNA. Curr Protoc Mol Biol. Chapter 13, (2001).
  11. Treco, D. A., Lundblad, V. Preparation of yeast media. Curr Protoc Mol Biol. Chapter 13, (2001).
  12. Lederberg, J., Lederberg, E. M. Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63, (3), 399-406 (1952).
  13. Sikorski, R. S., Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 122, (1), 19-27 (1989).
  14. Johnson, P., et al. A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics. G3 (Bethesda). 5, (5), 741-749 (2015).
  15. DiCarlo, J. E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, (7), 4336-4343 (2013).
  16. Cross, S. L., Smith, M. M. Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae. Mol Cell Biol. 8, (2), 945-954 (1988).
  17. Libuda, D. E., Winston, F. Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae. Nature. 443, (7114), 1003-1007 (2006).
Hedeflenen<em&gt; In situ</emBudding Maya&gt; Mutajenezis Histon ve Genler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).More

Duina, A. A., Turkal, C. E. Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast. J. Vis. Exp. (119), e55263, doi:10.3791/55263 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter