A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

6.6K views

⸱

DOI:

10.3791/55297

⸱

June 26th, 2017

* These authors contributed equally

In This Article

Summary

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Abstract

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos.

Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Introduction

In vivo systemic component analysis allows scientists to investigate cellular behavior in the most reliable way. This is particularly true when the activity under scrutiny is heavily influenced by cell-cell interactions (both contact- and non-contact-dependent), as in the nervous system, where membrane voltage changes drive the communication among excitable cells. The comprehension of the information encoded by these electrical signals is the key to understanding the way the nervous system works in both physiological and disease states.

In order to study cell electrical properties in the most non-invasive physiological conditions, several genetically encoded voltage indicators have been recently developed1. As opposed to the previous generations of optical voltage sensors (mainly voltage-sensitive dyes)2, GEVIs allow for in vivo analyses of the intact neural system, and their expression can be limited to specific cell types or populations.

The zebrafish embryo is the in vivo "substrate" of choice to take advantage of the great potential attributed to GEVIs. In fact, thanks to its optical clarity and its simplified yet evolutionarily conserved nervous system, the zebrafish model allows for the straightforward identification and manipulation of every cellular component in a network. Indeed, the employment of the FRET-based GEVI Mermaid3 led to the identification of pre-symptomatic alterations in spinal motor neuron behavior in a zebrafish model of amyotrophic lateral sclerosis (ALS)4.

The following in vivo protocol describes how to monitor the electrical properties of spinal motor neurons in intact zebrafish embryos expressing Mermaid in a neuronal-specific manner. Moreover, it demonstrates how pharmacologically induced changes in such electrical properties can be associated with alterations in the frequency of embryonic spontaneous coilings, the stereotypic motor activity that characterizes the movement behavior of the zebrafish at very early stages of development.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. pHuC_Mermaid Plasmid Generation

NOTE: Mermaid is a biosensor developed by pairing the voltage-sensing domain (VSD) of the Ciona intestinalis (now Ciona robusta)5 voltage sensor containing phosphatase (Ci-VSP) with the FRET partner fluorophores Umi-Kinoko Green (mUKG: donor) and a monomeric version of the orange-emitting fluorescent protein Kusabira Orange (mKOk: acceptor). For this biosensor, conformational changes of the VSD domain, induced by membrane depolarization, increase the proximity of the donor and acceptor fluorescent proteins, thus increasing the energy transfer between them (increasing the FRET Ratio)3. The VSD assures the efficient localization of the biosensor at the plasma membrane. The neuronal expression of the biosensor (in the spinal cord, the signal is detectable in both interneurons and motor neurons) is achieved by cloning the Mermaid open reading frame (ORF) under the zebrafish pan-neural promoter HuC6.

  1. Amplify by polymerase chain reaction (PCR) the Mermaid ORF from the pCS4+ Mermaid plasmid3 with Pfu (proofreading) DNA polymerase using the T3 Universal primer and the Mermaid SmaI primer (5′TATCCCGGGATTCGACGGTTCAGATTTTA) in order to insert a SmaI restriction site upstream of the Mermaid ORF.
    1. Use the following PCR mixture: 0.5 µL of Pfu DNA polymerase, 7.5 µL of the specific 10x buffer, 1 µL of 10 mM dNTPs, 2.5 µL of dimethyl sulfoxide (DMSO), 0.5 µL (50 ng) of the plasmid preparation, and 1 µL of 20-µM stock solutions of each primer in a total volume of 50 µL.
    2. Heat the PCR mixture for 15 s at 95 °C, prime it for 15 s at 50 °C, and elongate it for 4 min at 72 °C for a total of 35 cycles.
  2. Gel-purify the specific blunt PCR product using a commercial gel purification kit, following the manufacturer's protocol.
  3. Clone the DNA fragment into the pCMV-SC blunt vector following the manufacturer's protocol.
  4. Linearize the Mermaid-positive plasmid (named pCMV-SC_Mermaid) with the SmaI restriction enzyme for the following insertion of the HuC promoter.
    1. Set up the restriction reaction as follow: 0.5 µL (10 U) of SmaI restriction enzyme, 2 µL of the kit 10x buffer, and 5 µg of plasmid DNA in a total volume of 20 µL. Incubate the reaction at 25 °C for 1 h.
  5. Gel-purify the digested plasmid using a commercial gel purification kit following the manufacturer's protocol.
  6. PCR-amplify the HuC promoter (pHuC), with Pfu DNA polymerase and zebrafish genomic DNA as template, using a pair of HuC-specific primers (HuCprom-forw1_SalI: 5′-GTAGTCGACCAGACTTGTCAAAAGGGTCCA and HuCprom-rev1: 5′-TCCATTCTTGACGTACAAAGATG) and spanning a 3,150-bp region upstream of the ATG.
    1. Set up the PCR mixture using the following scheme: 0.5 µL of Pfu DNA polymerase, 7.5 µL of the specific 10x buffer, 1 µL of 10 mM dNTPs, 2.5 µL of DMSO, 200 ng of genomic DNA, and 1 µL of 20-µM stock solutions of each primer in a total volume of 50 µL.
    2. After an initial step of 2 min at 95 °C, heat the PCR mixture for 15 s at 95 °C, prime it for 15 s at 50°C, and elongate it for 4 min at 72 °C for a total of 35 cycles.
  7. Gel-purify the specific blunt PCR product using a commercial gel purification kit following the manufacturer's protocol.
  8. Ligate an equimolar amount of the purified pCMV-SC_Mermaid (step 1.5) and the pHuC DNA (step 1.7) using 1 µL of T4 DNA ligase and 1 µL of the specific 10X buffer in a total volume of 10 µL. Incubate the reaction for 16 h at 4 °C.
  9. Transform an aliquot of competent cells with 5 µL of the ligation reaction (step 1.8) following the manufacturer's instructions.
  10. Select the pHuC-positive clones (pHuC_Mermaid) with the promoter inserted in the proper orientation by a SalI-EcoRV double digestion (the SalI restriction site has been inserted upstream of the promoter fragment in step 1.6, while the EcoRV restriction site is positioned downstream of the polyadenylation region, PolyA, of the pCMV-SC plasmid).
    1. Set up the restriction reaction as follow: 0.5 µL (10 U) of both SalI and EcoRV restriction enzymes, 2 µL of the kit10X buffer, and 1 µg of pHuC_Mermaid DNA in a total volume of 20 µL. Incubate the reaction at 37 °C for 1 h. Run the reactions onto an agarose gel.

2. Embryo Microinjection

  1. Transfer the fertilized eggs obtained from wild-type (AB strain) or Sod1-G93R adult zebrafish4 to a 10 mm Petri dish using a plastic pipette.
  2. Rinse the embryos in cold (4 °C) fish water and immediately microinject them into the yolk with 200 pg of pHuC_Mermaid plasmid using a microinjector (for an overall and detailed description of the microinjection procedure, see References 7 and 8).
  3. Using a plastic pipette, transfer the embryos to a Petri dish and incubate them in fish water at 28 °C until they reach the desired developmental stage (20-24 h post-fertilization, hpf) for the following analyses.

3. Spontaneous Tail Coiling Analysis

NOTE: Evaluate the spontaneous tail coiling behavior in 20-24 hpf embryos with or without the drug riluzole.

  1. Transfer an embryo to a 90-mm round Petri dish filled with fish water containing 0.2% DMSO (riluzole vehicle) and manually dechorionate it using two jeweler's forceps with sharp tips. Incubate the embryo for 5 min.
  2. Detect the tail coiling at RT during a 1 min video recording using a digital camera mounted on a stereomicroscope. Acquire time series at a time resolution of 30 frames/s.
  3. Calculate the frequency of spontaneous tail coilings by counting the number of bends (both contralateral and ipsilateral) per time unit.
  4. To evaluate the effect of the drug riluzole, gently use a plastic Pasteur pipette to transfer the embryo to a new 90 mm Petri dish filled with fish water containing 5 µM riluzole.
    1. Incubate the embryo for 5 min before recording a 1-min video and performing the behavioral analysis as above.

4. Imaging Setup for Mermaid Biosensor Visualization in Living Embryos: Simultaneous Detection of Donor and Acceptor Signals

  1. Mount the 20 - 24 hpf embryos in 1% low-melting-point agarose in fish water at 37 °C inside a 35 mm glass-bottomed imaging dish. Orient the embryos on their sides. Wait until the agarose solidifies at room temperature.
  2. Transfer the imaging dish to the stage of a inverted confocal mounted on an inverted microscope. Identify motor neurons expressing the biosensor with a 20X objective (0.7 numerical aperture, NA) by exciting the mUKG with the 488 nm argon laser line and recording its emission between 495 and 525 nm.
  3. For a FRET measurement, excite mUKG, the donor of the FRET pair, with the 488 nm laser line. Simultaneously detect, with a resonant scanner operating at 8,000 Hz in the bidirectional mode, the fluorescence emitted by the donor (between 495 and 525 nm) and the fluorescence emitted by the mKOk acceptor (between 550 and 650 nm, FRET channel). If available, use the 473 nm laser.
    NOTE: The excitation efficiency of the donor will be slightly reduced (85% instead of 93% with 488 nm), but the cross-excitation of the acceptor will be reduced as well (from 17% with the 488 nm to 9% with 473 nm laser line).
  4. To reduce phototoxicity and fluorophore bleaching, minimize the illumination of the sample by reducing the power of the laser line (on the beam path window of the acquisition software).
  5. Optimize the excitation to match gain and offset parameters that are set at the beginning of the experiment and kept constant throughout the session. To set the offset, change the color of the image to intensity values (by using the Q look-up table) and, while scanning with the laser off, turn the offset knob (smart offset) so that the background pixels have an intensity slightly higher than zero. With the same look-up table, by switching the laser on while scanning, turn the gain knob (smart gain) to maximize the signal-to-noise ratio, being careful to avoid saturated pixels.
  6. Using an opened pinhole (2 airy units), acquire 16-bit images to provide a sufficient dynamic range for quantitative analyses. Avoid averaging to increase the acquisition speed and to minimize photobleaching.
  7. In the software acquisition window, select an image field size of 512 x 64 pixels (pixel size: 605 nm) from the drop-down menu.
  8. From the acquisition mode window, select xyt (time lapse on a single xy plane)from the drop-down menu and record the changes in embryo spinal neuron voltage by acquiring a single xy plane, setting the acquisition parameters to record one image every 30 ms for 1 min.
  9. To evaluate the effect of riluzole administration on membrane depolarization in the same neuron, acquire a new dataset 5 min after the addition of fish water containing 5 µM riluzole.
  10. For FRET analysis, use the ImageJ macro Biosensor_FRET (expressing single-chain FRET biosensors.
  11. Evaluate the basal membrane FRET ratio of each neuron at t1 as ((FRET mean - FRET background)/(Donor mean - Donor background)), where FRET and Donor mean intensity is the mean fluorescence intensity calculated in the same region of interest (ROI) drawn around the cell for each channel acquired and FRET and Donor background is the mean fluorescence intensity calculated in an ROI of the field of view without the fluorescent sample.
    NOTE: A detailed step-by-step description of the use of the plugin can be found at the www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret website.
  12. Use a graphing software to compare the frequency, amplitude, and duration of depolarization between different experimental paradigms. Compare two groups using an unpaired Student's t-test and consider mean values as statistically different when P <0.05.

Access restricted. Please log in or start a trial to view this content.

Results

An expression vector carrying the FRET-based Mermaid biosensor coding sequence under the control of the pHuC pan-neuronal promoter, which drives the synthesis of the protein exclusively in the nervous system, was delivered into single-cell fertilized eggs by means of a microinjection in order to obtain transient transgenic embryos (Figure 1, left panel). After mastering the microinjection technique, the percentage of Mermaid-positive embryos was close to ...

Access restricted. Please log in or start a trial to view this content.

Discussion

The protocol presented here allowed us to explore the association between the electrical properties of zebrafish embryo spinal motor neurons and the spontaneous coiling behavior, the earliest stereotypic motor activity, which appears around 17 hpf of embryonic development and lasts until 24 hpf10.

Our approach provides researchers with a tool to study the neural system of intact embryos, fully preserving the complexity of the interactions between cells in a developing f...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors would like to thank Simona Rodighiero for her priceless support with the FRET imaging analysis.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Low Melting Point Agarose Sigma-AldrichA9414
DMSO Sigma-AldrichW387520
RiluzoleSigma-AldrichR116
Pfu Ultra HQ DNA polymerase Agilent Technologies - Stratagene Products Division600389
T3 Universal primer Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up systemPromegaA9280
Universal SmaI primer Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector Agilent Technologies - Stratagene Products Division 240228
SmaI New England BiolabsR0141S
T4 DNA ligasePromegaM1801
SalINew England BiolabsR0138S
EcoRVNew England BiolabsR0195S
35 mm, glass-bottomed imaging dish Ibidi81151
forcepsSigma-AldrichF6521
StereomicroscopeLeica MicrosystemsM10 F
Digital cameraLeica MicrosystemsDFC 310 FX
Leica Application Suite 4.7.1 software Leica Microsystems
QuickTime Player, v10.4Apple
Confocal microscope (inverted)Leica MicrosystemsTCS SP5
Microinjector Eppendorf Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c GraphPad Software, Inc

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104 (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5 (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515(2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10 (5), 0122879(2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227 (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68 (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97 (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566(2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

FRET BiosensorSpinal NeuronsConfocal MicroscopyFluorescence ImagingGenetic EncodingVoltage IndicatorsRiluzole TreatmentTail Coiling Analysis