Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

بيوسنسينغ موتور الخلايا العصبية الغشاء المحتملة في الأجنة الزرد الحية

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

في الجسم الحي التحليل المكوني يسمح العلماء للتحقيق في السلوك الخلوي في الطريقة الأكثر موثوقية. هذا صحيح بشكل خاص عندما يتأثر النشاط تحت التدقيق بشكل كبير من التفاعلات خلية الخلية (على حد سواء الاتصال وغير تعتمد على الاتصال)، كما هو الحال في الجهاز العصبي، حيث التغييرات غشاء الجهد يدفع التواصل بين الخلايا المنكوبة. إن فهم المعلومات المشفرة بواسطة هذه الإشارات الكهربائية هو المفتاح لفهم الطريقة التي يعمل بها الجهاز العصبي في كل من الحالات الفسيولوجية والمرضية.

من أجل دراسة الخواص الكهربائية الخلية في معظم الحالات الفسيولوجية غير الغازية، وقد وضعت مؤخرا عدة مؤشرات الجهد المشفرة وراثيا 1 . على عكس الأجيال السابقة من أجهزة الاستشعار الجهد البصري (أساسا أصباغ حساسة للجهد) 2 ، جيفيس تسمح لفي الجسم الحي تحليلات للنظام العصبي سليمة، ويمكن أن يقتصر التعبير على أنواع محددة من الخلايا أو السكان.

الجنين الزرد هو في الجسم الحي "الركيزة" من خيار للاستفادة من إمكانات كبيرة تعزى إلى جيفيس. في الواقع، وبفضل وضوحها البصري ونظامها العصبي المبسط بعد التطورية، فإن نموذج الزرد يسمح بالتعرف المباشر والتلاعب لكل مكون خلوي في الشبكة. في الواقع، أدى استخدام جريت مرميد القائم على حفرة 3 إلى تحديد التعديلات قبل الأعراض في السلوك العصبي الحركي في العمود الفقري في نموذج الزرد من التصلب الجانبي الضموري (ألس) 4 .

وفيما يلي في بروتوكول الجسم الحي يصف كيفية مراقبة الخصائص الكهربائية من الخلايا العصبية الحركية في العمود الفقري الأجنة الزرد سليمة معربا عن حورية البحر بطريقة محددة الخلايا العصبية. وعلاوة على ذلك، فإنه يوضح كيف تشان الدوائية التي يسببهاجيس في هذه الخصائص الكهربائية يمكن أن تترافق مع التعديلات في وتيرة لفائف عفوية الجنينية، والنشاط النمطي الحركي الذي يميز سلوك حركة الزرد في المراحل المبكرة جدا من التنمية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pHuC_Mermaid جيل البلازميد

ملاحظة: حورية البحر هو جهاز الاستشعار البيولوجي التي وضعتها الاقتران المجال استشعار الجهد (فسد) من الأمعاء سيونا (الآن سيونا روبوستا ) 5 استشعار الجهد التي تحتوي على الفوسفاتيز (سي-فسب) مع فلوريوفوريس شريك فريت أومي كينوكو الأخضر (موكغ: المانحة) ونسخة أحادية من البرتقال الباعثة للضوء الفلورسنت بروتين كوسابيرا أورانج (مكوك: أسيبتور). لهذا الاستشعار البيولوجي، والتغيرات التوافقية من المجال فسد، التي يسببها الاستقطاب الغشاء، وزيادة القرب من البروتينات المانحة والفلورسنت متقبل، وبالتالي زيادة نقل الطاقة بينهما (زيادة نسبة الحنق) 3 . و فسد يؤكد توطين كفاءة جهاز الاستشعار البيولوجي في غشاء البلازما. ويتحقق التعبير العصبي من جهاز الاستشعار البيولوجي (في الحبل الشوكي، إشارة يمكن الكشف عنها في كل من إنترنيورونس والخلايا العصبية الحركية) عن طريق استنساخ مرميد المرجعإن القراءة الإطار (أورف) تحت الزرد عموم العصبي المروج هوك 6 .

  1. تضخيم عن طريق تفاعل البوليميراز سلسلة (ير) حورية البحر أورف من البلازمايد pcS4 + حورية البحر 3 مع بفو (التدقيق المطبعي) البلمرة الحمض النووي باستخدام التمهيدي العالمي T3 و مرميد سما الأول التمهيدي (5'TATCCCGGGATTCGACGGTTCAGATTTTA) من أجل إدراج سما I موقع تقييد المنبع من حورية البحر أورف.
    1. استخدام خليط ير التالية: 0.5 ميكرولتر من البلمرة دنا بفو، 7.5 ميكرولتر من العازلة 10X محددة، 1 ميكرولتر من 10 دنتبس ملي، 2.5 ميكرولتر من ثنائي ميثيل سلفوكسيد (دمسو)، 0.5 ميكرولتر (50 نانوغرام) من إعداد البلازميد، و 1 ميكرولتر من 20 ميكرومتر حلول الأسهم من كل التمهيدي في الحجم الكلي من 50 ميكرولتر.
    2. تسخين خليط ير لمدة 15 ثانية عند 95 درجة مئوية، رئيس الوزراء لمدة 15 ثانية عند 50 درجة مئوية، واستطالة لمدة 4 دقائق في 72 درجة مئوية لمدة ما مجموعه 35 دورة.
  2. هلام تنقية حادة محددةير المنتج باستخدام مجموعة تنقية هلام التجارية، بعد بروتوكول الشركة المصنعة.
  3. استنساخ جزء الحمض النووي في ناقلة بمف-سك حادة بعد بروتوكول الشركة المصنعة.
  4. خطي البلازميد إيجابي حورية البحر (اسمه بمف-SC_Mermaid) مع سما I انزيم تقييد لإدراج التالية من المروج هوك.
    1. إعداد رد فعل تقييد على النحو التالي: 0.5 ميكرولتر (10 U) من سما I انزيم تقييد، 2 ميكرولتر من العازلة 10X كيت، و 5 ميكروغرام من الحمض النووي البلازميد في حجم إجمالي 20 ميكرولتر. احتضان رد فعل عند 25 درجة مئوية لمدة 1 ساعة.
  5. هلام-تنقية البلازميد هضمها باستخدام عدة تنقية هلام التجارية بعد بروتوكول الشركة المصنعة.
  6. ير-تضخيم المروج هوك (فوك)، مع بفو الحمض النووي البلمرة والحمض النووي الجيني الزرد كقالب، وذلك باستخدام زوج من الاشعال هوك محددة (هوبروم-forw1_SalI: 5'-غتاغغاكتاكتغكاغاغكا و هوكبروm-rev1: 5'-تكاتكتجتاغاكاغاتغ) وتمتد على منطقة 3،150-بب المنبع من أتغ.
    1. إعداد خليط ير باستخدام المخطط التالي: 0.5 ميكرولتر من بفو دنا البلمرة، 7.5 ميكرولتر من العازلة 10X محددة، 1 ميكرولتر من 10 مل دنتبس، 2.5 ميكرولتر من دمسو، 200 نانوغرام من الحمض النووي الجيني، و 1 ميكرولتر من 20 ميكرومتر حلول الأسهم من كل التمهيدي في حجم إجمالي 50 ميكرولتر.
    2. بعد خطوة أولية من 2 دقيقة في 95 درجة مئوية، وتسخين خليط ير لمدة 15 ثانية عند 95 درجة مئوية، رئيس الوزراء لمدة 15 ثانية عند 50 درجة مئوية، واستطالة لمدة 4 دقائق في 72 درجة مئوية لما مجموعه 35 دورات .
  7. هلام تنقية المنتج ير حادة محددة باستخدام مجموعة تنقية هلام التجارية بعد بروتوكول الشركة الصانعة.
  8. ليغات كمية متساوية الملاك من تنقيته بمف-SC_Mermaid (خطوة 1.5) و دنا فوك (الخطوة 1.7) باستخدام 1 ميكرولتر من ليغاز T4 دنا و 1 ميكرولتر من العازلة 10X محددة في حجم إجمالي 10 ميكرولتر. احتضان رد فعل لمدة 16 ساعة في4 درجة مئوية.
  9. تحويل قسامة من الخلايا المختصة مع 5 ميكرولتر من رد فعل ربط (الخطوة 1.8) بعد تعليمات الشركة الصانعة.
  10. حدد استنساخ إيجابية فوك (pHuC_Mermaid) مع المروج إدراجها في التوجه الصحيح من قبل سال I- إكو رف الهضم المزدوج (تم إدراج موقع تقييد I سال المنبع من جزء المروج في الخطوة 1.6، في حين أن موقع إيك رف تقييد يتم وضع المصب للمنطقة بوليادنيلاشيون، بوليا، من البلازميد بمف-سك).
    1. إعداد رد فعل تقييد على النحو التالي: 0.5 ميكرولتر (10 U) من كل من سال I و إكو رف تقييد الإنزيمات، 2 ميكرولتر من العازلة kit10X، و 1 ميكروغرام من الحمض النووي pHuC_Mermaid في حجم إجمالي 20 ميكرولتر. احتضان رد فعل عند 37 درجة مئوية لمدة 1 ساعة. تشغيل ردود الفعل على هلام الاغاروز.

2. ميكروينجكتيون الجنين

  1. نقل المخصبة على سبيل المثالغس التي تم الحصول عليها من البرية من نوع (أب سلالة) أو Sod1-G93R الزرد الكبار 4 إلى طبق بتري 10 ملم باستخدام ماصة بلاستيكية.
  2. شطف الأجنة في الماء البارد (4 درجة مئوية)، وعلى الفور ميكروينجيكت لهم في صفار البيض مع 200 بيكوغرام من البلازميد pHuC_Mermaid باستخدام ميكروينجيكتور (لوصف شامل ومفصل لإجراء ميكروينجكتيون، راجع المراجع 7 و 8).
  3. باستخدام ماصة بلاستيكية، ونقل الأجنة إلى طبق بتري واحتضان لهم في مياه السمك في 28 درجة مئوية حتى تصل إلى مرحلة التنموية المطلوب (20-24 ساعة بعد الإخصاب، هف) للتحليلات التالية.

3. عفوية الذيل تحليل اللف

ملاحظة: تقييم سلوك الذيل الذيل عفوية في 20-24 هف الأجنة مع أو بدون ريلوزول المخدرات.

  1. نقل الجنين إلى 90 ملم طبق بتري جولة مليئة مياه السمك التي تحتوي على 0.2٪ دمسو (سيارة ريلوزول) ودكوريونات يدويا باستخدام توملقط الصائغ مع نصائح حادة. احتضان الجنين لمدة 5 دقائق.
  2. كشف اللف الذيل في رت خلال تسجيل الفيديو 1 دقيقة باستخدام كاميرا رقمية شنت على ستيريوميكروسكوب. الحصول على سلسلة زمنية في وقت قرار من 30 لقطة / ثانية.
  3. حساب تردد لفائف الذيل عفوية من خلال حساب عدد من الانحناءات (على حد سواء المقابل والمثل) في وحدة الزمن.
  4. لتقييم تأثير ريلوزول المخدرات، واستخدام بلطف ماصة باستور البلاستيك لنقل الجنين إلى طبق بتري 90 ملم جديدة مليئة الأسماك الأسماك التي تحتوي على 5 ميكرومتر ريلوزول.
    1. احتضان الجنين لمدة 5 دقائق قبل تسجيل الفيديو 1 دقيقة وأداء التحليل السلوكي على النحو الوارد أعلاه.

4. إعداد التصوير لتصوير حورية البحر بيوسنسور في الأجنة الحية: الكشف في وقت واحد من المانحين والمتقبلين إشارات

  1. جبل 20-24 هف الأجنة في 1٪ منخفضة ذوبان نقطة أغاروس في مياه السمك في37 درجة مئوية داخل طبق التصوير القاع الزجاجية 35 مم. توجيه الأجنة على جانبيها. انتظر حتى تصلب الاغاروز في درجة حرارة الغرفة.
  2. نقل طبق التصوير إلى مرحلة متحد البؤر مقلوب شنت على المجهر مقلوب. تحديد الخلايا العصبية الحركية معربا عن جهاز الاستشعار البيولوجي مع هدف 20X (0.7 فتحة العددية، نا) عن طريق إثارة موكغ مع خط ليزر الأرجون 488 نانومتر وتسجيل انبعاثها بين 495 و 525 نانومتر.
  3. لقياس فريت، تثير موكغ، المانحة من الزوج الحنق، مع 488 نانومتر ليزر خط. في وقت واحد كشف، مع الماسح الضوئي الرنانة التي تعمل في 8000 هرتز في وضع ثنائي الاتجاه، مضان المنبعث من المتبرع (بين 495 و 525 نانومتر) والمضان المنبعثة من متقبل موكوك (بين 550 و 650 نانومتر، قناة فريت). إذا كان متوفرا، استخدم الليزر نانومتر 473.
    ملاحظة: سيتم تخفيض كفاءة الإثارة من المتبرع قليلا (85٪ بدلا من 93٪ مع 488 نانومتر)، ولكن عبر الإثارة من متقبل سوف(من 17٪ مع 488 نانومتر إلى 9٪ مع 473 نانومتر ليزر خط).
  4. للحد من فوتوتوكسيسيتي و فلورفور تبييض، تقليل الإضاءة من العينة عن طريق الحد من قوة خط الليزر (على نافذة مسار شعاع من برنامج الاستحواذ).
  5. تحسين الإثارة لمباراة الكسب والإزاحة المعلمات التي تم تعيينها في بداية التجربة والحفاظ على ثابت طوال الدورة. لتعيين الإزاحة، قم بتغيير لون الصورة إلى قيم الشدة (باستخدام جدول نظرة Q)، وأثناء المسح الضوئي باستخدام الليزر، حرك مقبض الإزاحة (الإزاحة الذكية) بحيث تكون بكسل الخلفية ذات كثافة أعلى من الصفر. مع نفس الجدول المتابعة، عن طريق تحويل الليزر على أثناء المسح الضوئي، وتحويل مقبض المكاسب (المكاسب الذكية) لتعظيم نسبة إشارة إلى الضوضاء، والحرص على تجنب بكسل مشبعة.
  6. باستخدام فتحة مفتوحة (2 وحدات متجدد الهواء)، والحصول على صور 16 بت لتوفير مجموعة ديناميكية كافية ل كوانتيتاتيفه. تجنب المتوسط ​​لزيادة سرعة الاقتناء وتقليل فوتوبلاشينغ.
  7. في نافذة اقتناء البرامج، حدد حجم حقل صورة 512 × 64 بكسل (حجم بكسل: 605 نانومتر) من القائمة المنسدلة.
  8. من نافذة وضع الاستحواذ، حدد شيت (الفاصل الزمني على طائرة زي واحد) و مدمج القائمة المنسدلة وتسجيل التغييرات في الجنين العصبوني في العمود الفقري من خلال الحصول على طائرة زي واحدة، ووضع المعلمات اكتساب لتسجيل صورة واحدة كل 30 مللي ثانية لمدة 1 دقيقة.
  9. لتقييم تأثير إدارة ريلوزول على الاستقطاب الغشاء في نفس الخلايا العصبية، والحصول على مجموعة بيانات جديدة 5 دقائق بعد إضافة ماء السمك التي تحتوي على 5 ميكرومتر ريلوزول.
  10. لتحليل فريت، استخدم ماكرو إيماجيج Biosensor_FRET (معربا عن سلسلة أجهزة الاستشعار الحيوية فريت.
  11. تقييم الغشاء القاعدي نسبة الحنق من كل الخلايا العصبية في t 1 كما ((فريت يعني - خلفية الحنق) / (المانحة المانحة - خلفية المانح))، حيث الحنق ودونأو متوسط ​​الكثافة هو متوسط ​​كثافة مضان تحسب في نفس المنطقة من الفائدة (روي) رسمها حول الخلية لكل قناة المكتسبة و فريت والجهات المانحة الخلفية هو متوسط ​​كثافة مضان تحسب في روي من مجال الرؤية دون عينة الفلورسنت.
    ملاحظة: وصف مفصل خطوة بخطوة لاستخدام البرنامج المساعد يمكن العثور عليها في www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret الموقع.
  12. استخدام برنامج الرسوم البيانية لمقارنة التردد، السعة، ومدة الاستقطاب بين النماذج التجريبية المختلفة. قارن مجموعتين باستخدام t -test الطالب ونايرد ونعتبر القيم المتوسطة كما إحصائيا مختلفة عندما P <0.05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تم نقل ناقلات التعبير تحمل فريت القائم على حورية البحر تسلسل الاستشعار البيولوجي ترميز تحت سيطرة المروج عموم الخلايا العصبية فوك، الذي يدفع تخليق البروتين حصرا في الجهاز العصبي، إلى بيضة واحدة المخصبة عن طريق حقن ميكروينجكتيون في من أجل الحصول على الأجنة المعدلة وراثيا عابرة ( الشكل 1 ، اللوحة اليسرى). بعد اتقان تقنية حقن ميكروينجكتيون، كانت نسبة الأجنة حورية البحر إيجابية قريبة من 100٪. ومن بين هذه، فقط اعتبرت الأجنة معبرا عن كمية مناسبة من جهاز الاستشعار البيولوجي حورية البحر في غشاء البلازما لتحليل فريت / الحصول على الصور.

تم تسجيل لفائف عفوية، ردود السيارات التي تتكون حصريا من انكماش الجسم الكامل جلب غيض الذيل إلى الرأس 9 ، 10 ، في مرحلة 20-24 هف في وسط الأسماك العادية ( الشكل 1 ، لوحة الوسط والفيديو 1 ) وبعد الحضانة في 5 ميكرومتر ريلوزول ( فيديو 2 ). وتفيد التحليلات الإحصائية للتغيرات في وتيرة لفائف الذيل عفوية الناجمة عن ريلوزول المخدرات في أماكن أخرى 4 .

لاختبار ما إذا كانت التعديلات في النشاط الكهربائي للخلايا العصبية الحركية في العمود الفقري كانت على أساس التغيرات التي يسببها ريلوزول في تردد اللف التلقائي، وقد درست إمكانات الغشاء في الخلايا العصبية الحركية في العمود الفقري الجنين بطريقة غير الغازية، وقياس كثافة الفلورسنس نسبة المانح / متقبل الحنق زوج من جهاز الاستشعار البيولوجي حورية البحر (نسبة الحنق: الشكل 1 ، اللوحة اليمنى). تم تحديد الخلايا العصبية الحركية العمود الفقري الأولية معربا عن جهاز الاستشعار البيولوجي ( الشكل 2A ) وسجلت أنشطة الاستقطاب العفوي القاعدية ( نغ> الشكل 2B والفيديو 3 و 4 ). جنبا إلى جنب مع انخفاض في وتيرة الحركات اللف الذيل، خفضت إدارة ريلوزول وتيرة الأحداث الاستقطاب عفوية ( الشكل 2C ).

شكل 1
الشكل 1: مخطط تدفق الإجراء التجريبي. يتم جمع الأجنة أحادية الخلية المرحلة وعلى الفور ميكروينجكتد مع البلازميد pHuC_Mermaid للتعبير عن جهاز الاستشعار البيولوجي حورية البحر الجهد الكهربائي في الأزياء عموم الخلايا العصبية. في 20-24 هف مع الحضانة عند 28 درجة مئوية، يتم نقل الأجنة واحدة تحت ستيريوميكروسكوب وعفوية نشاط اللف الذيل، مع وبدون ريلوزول المخدرات الموجودة في مياه السمك، يتم تسجيل الفيديو وتحليلها. نفس الأجنة تخضع في الجسم الحي تحليل الحنق من أجل قياس التغيرات في المحرك الغشاء العصبي المحتملة.هريف = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" تارجيت = "_ بلانك"> الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: في فيفو فريت تحليل لقياس التغيرات في موتور غشاء الخلايا العصبية المحتملة. ( A ) البرية من نوع الأجنة الزرد مع التعبير الفسيفساء من جهاز استشعار حساس حورية مرتكزة على حورية البحر في الخلايا العصبية في العمود الفقري. (أ) صورة الحقل مشرق يظهر منطقة الجذع الزرد التي حددها الصندوق الأسود (سك: الحبل الشوكي؛ مس: ميوسبتوم؛ م: ميوتوم). عن طريق فرض على (أ) إشارة مضان الكشف عن (ب)، والتعبير الفعال من جهاز الاستشعار البيولوجي في الخلايا العصبية الحركية العمود الفقري (بيإم) يمكن تصور بوضوح. ويظهر المتبرع (c) وقناة فريت (d) المكتشفة مع جداول المظهر الأخضر والأرجواني ذات الصلة (لوت)على الجانب الأيمن. يتم تركيب جميع الأجنة في اتجاه الجمجمة إلى الذيلية. شريط مقياس = 10 ميكرون. ( B ) يعرض خريطة نسبة فريت نسبة فريت محسوبة كل 0.03 ثانية في نفس الخلايا العصبية الحركية. ويظهر النشاط الاستقطاب العفوي القاعدية التي تخضع لها الخلية. للحصول على جهاز الاستشعار البيولوجي حورية البحر، والزيادة في نسبة الحنق يحدث عندما يزيد من احتمال الغشاء. شريط مقياس = 10 ميكرون. ( C ) مثال ممثل من عفوية يعني التغييرات نسبة الحنق التي تحدث في الخلايا العصبية الحركية في العمود الفقري من الجنين الزرد Sod1-G93R خلال تسجيل 1 دقيقة. إدارة ريلوزول يقلل من وتيرة الاستقطاب عفوية. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

فيلم 1
فيلم 1:عفوية الذيل اللف في 24-هف البرية من نوع السيطرة الأجنة. تسجيل ممثل تظهر اللف الذيل عفوية في 24 هف البرية من نوع السيطرة الجنين المحتضنة في مياه السمك. الرجاء النقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

فيلم 2
فيلم 2: عفوية الذيل اللف في 24- هف البرية من نوع ريلوزول المعالجة الأجنة. تسجيل ممثل تظهر اللف الذيل عفوية في 24 هف البرية من نوع السيطرة الجنين المحتضنة في 5 ميكرومتر ريلوزول (+ R). بالمقارنة مع الضوابط، أظهرت + أجنة R انخفاضا كبيرا في وتيرة عفوية سلوك الذيل اللف في 24 هف. الرجاء النقر هنا لمشاهدة هذا الفيديو. (اجهزةهت-كليك تو دونلواد.)

فيلم 3
فيلم 3: القاعدية الاستقطاب عفوية النشاط من الخلايا العصبية المحرك الرئيسي في الحبل الشوكي من نوع البري من الجنين الزرد في 20 هف. جهاز الاستشعار البيولوجي حورية البحر حساسة بحيث يمكن الكشف عن التغيرات السريعة في المحرك الغشاء العصبي المحتملة في الحبل الشوكي من الأجنة سليمة. الرجاء النقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

فيلم 4
الفيلم 4: يقترن النشاط الاستقطاب العفوي للانكماش العضلي. الخلايا العصبية الحركية الثانوية في الحبل الشوكي من نوع البري الجنين الزرد في 20 هف يخضع الاستقطاب عفوية. في هذه الحالة، كل ديويرتبط الاستقطاب لانكماش عضلات الزرد، نظمت في سينسيتيوم متزامنة وظيفيا في هذه المرحلة التنموية. الرجاء النقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

بروتوكول عرضت هنا يسمح لنا لاستكشاف العلاقة بين الخصائص الكهربائية من الخلايا العصبية الحركية الجنين العمود الفقري الزرد والسلوك الالتفافية عفوية، وأقرب النشاط الحركي النمطية، والذي يظهر حوالي 17 هف من التطور الجنيني ويستمر حتى 24 هف 10 .

يوفر نهجنا الباحثين مع أداة لدراسة النظام العصبي للأجنة سليمة، والحفاظ تماما على تعقيد التفاعلات بين الخلايا في شبكة وظيفية النامية. وقد أجريت في الجسم الحي التصوير من الأجنة الزرد ببساطة عن طريق شل حركة لهم من خلال الغمر في الاغاروز ذوبان منخفضة. دراسة التغيرات في إمكانات غشاء الخلية من خلال استخدام جهاز الاستشعار البيولوجي تمثل واحدة من المزايا الرئيسية لهذه الطريقة. النهج الكهربية الكهرومغناطيسية، حيث الخلايا العصبية يجب الوصول إليها جسديا عن طريق إزالة الأنسجة المغلف 11 ، هي الإجرائيةإس التي قد تغير الخصائص الكهربائية للخلايا قيد الفحص. وعلاوة على ذلك، فإن نهج الاستشعار البيولوجي القائم على فريت يسمح لدراسة الخصائص الكهربائية الخلية دون استخدام التخدير ( أي تريكين، حاصرات قناة الصوديوم)، وتجنب أي اضطراب محتمل المرتبطة إدارة المواد الكيميائية ( أي ريلوزول هنا)، والتي قد تكون حاسمة في الخطة التجريبية. وقد سمح لنا هذا الأسلوب بالتركيز على تشكيل كل من النشاط الكهربائي وتواتر لفائف الذيل العفوية، وهي استجابة سلوكية تمنع، في معظم الحالات، التسجيلات الكهربية بدون إدارة التخدير. وأخيرا، فإن توظيف جيفيس يوفر أعلى السيطرة التجريبية الزمنية لأنه يسمح العمل في مرحلة تنموية الجنينية محددة. امتدت جلسات التصوير / التسجيل الخاصة بنا إلى نافذة زمنية محدودة جدا، مما يسمح لنا بمقارنة المراحل التنموية للأجنة المختلفة في الوقت الفعلي. الكلفإن التسجيلات الكهربية التقليدية، على العكس من ذلك، تتم عادة في فترات زمنية أكبر وأقل دقة.

قياس التغيرات الجهد من تقنيات التصوير هو، ومع ذلك، من الصعب في جوهرها بسبب طبيعة الإشارة نفسها، والتي يمكن أن تختلف في السرعة، في التردد، وفي حجم التغيرات في إمكانات الغشاء. يجب أن يجمع جهاز استشعار الجهد المثالي بين الاستجابة السريعة والحساسية العالية وانبعاثات الفوتون العالية. بالنسبة لمعظم جيفيس القائم على الحنق، وتغير نسبة التغيرات كدالة من الاختلافات الجهد الغشاء، ولكن اتساع التغيرات نسبة مضان يرتبط بإحكام مع مدة الأحداث الاستقطاب. في الآونة الأخيرة، تم تطوير جيفيس جديدة وتتميز، مما يجعل من الممكن لاختيار أفضل التحقيق فيما يتعلق نوع من القضية التجريبية، نموذج، وجهاز التصوير.

أجهزة الاستشعار الجهد هي البروتينات غشاء لا يتجزأ. عندما ترانزفكتد في الخلايا المستزرعة أو التعبيرد في الكائنات الحية، ومضان من استشعار غشاء البلازما المترجمة يكون، إلى حد ما، المرتبطة مضان من أجهزة الاستشعار في المقصورات داخل الخلايا الأخرى، حيث يمكن أن يكون ميسلوكاليزد البروتين أو تجميعها وبالتالي توليد إشارة الخلفية. وينبغي رصد مستوى التعبير وتوطين الغشاء المناسب لكل بناء في نماذج تجريبية مبسطة ( أي خطوط الخلايا ترانسفكتينغ أو الثقافات الأولية) قبل استخدام أجهزة الاستشعار في الكائنات الحية.

في الإعداد التجريبي الحالي، يمكن أن تمثل خطوة حاسمة أخرى محتملة من البروتوكول من خلال كفاءة الإجراء ترانزجينيسيس. إذا لزم الأمر، يمكن زيادة النسبة المئوية للخلايا إيجابية البلازميد بشكل كبير من خلال استخدام نظام نقل 2 Tol12. وهناك جانب هام إضافي يحتاج إلى النظر فيه هو فقدان الانبعاثات مضان في فلورفور المانحة والخسارة في الحنق سيجنال التي تحدث أثناء جلسة التصوير بسبب الإضاءة المكثفة. وينبغي تجنب هذا عن طريق تقليل الإضاءة من العينة، والحد من قوة خط الليزر المستخدمة. وبالمثل، يجب ضبط المكاسب والتعويضات للمضخات الضوئية بعناية في بداية كل جلسة تسجيل لتحقيق أفضل نسبة إشارة إلى ضوضاء في الصور المكتسبة وكذلك لتجنب بكسل مشبعة. كل هذه المعلمات يمكن أن تختلف تبعا لنوع من الخلايا فحصها، وخصائص جهاز الاستشعار البيولوجي، والأدوات المستخدمة للحصول على صورة اكتساب (المجاهر مضان حقل واسع يمكن أن تستخدم أيضا، كما وصفت مؤخرا 13 ). على الباحث أن ينظر دائما، مع ذلك، أنه أثناء التصوير في الجسم الحي ، قد يتداخل مستوى الضوضاء مع إشارة محددة من أجهزة الاستشعار أكثر مما هي عليه في التسجيلات في المختبر . وأخيرا، إذا كان متوفرا، فإن قياسات التحكم باستخدام تحقيقات متحولة، والتي لا تستجيب للجهد، سيكون وسيلة مريحةلتقييم مستوى الضوضاء و / أو التحف الخاصة بالنظام.

استخدام الأجنة الزرد يمثل سمة رئيسية من سمات هذا النهج وذلك بفضل استجابتها للتلاعب الجيني والتحقيق المجهري. في الواقع، هذه الخصائص تجعل ترانسجينيسيس عابرة والتحليل القائم على الحصى من الخصائص الكهربائية العصبية ممكنا. في رأينا، مع أفضل المروج تركيبات وأجهزة الاستشعار البيولوجي، فمن المحتمل أن يكون من الممكن تحليل انتقائي النشاط الكهربائي من أي نوع من الخلايا من الفائدة وموازية هذا النشاط مع النمط الظاهري الجنينية.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
بيوسنسينغ موتور الخلايا العصبية الغشاء المحتملة في الأجنة الزرد الحية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter