Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing Motor Neuron Membraan Potentieel in Live Zebrafish Embryo's

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

In vivo systeemanalyse analyse maakt wetenschappers in staat om cellulaire gedrag op de meest betrouwbare manier te onderzoeken. Dit is vooral waar wanneer de onderzochte activiteit sterk beïnvloed wordt door cel-cel interacties (zowel contact- als niet-contactafhankelijk), zoals in het zenuwstelsel, waarbij membraanspanning verandert de communicatie onder excitabele cellen. Het begrip van de informatie die door deze elektrische signalen wordt gecodeerd, is de sleutel tot het begrijpen van de manier waarop het zenuwstelsel in zowel fysiologische als ziektestaten werkt.

Om cellulaire elektrische eigenschappen te bestuderen in de meest niet-invasieve fysiologische omstandigheden, zijn verscheidene genetisch gecodeerde spanningsindicatoren recentelijk ontwikkeld 1 . In tegenstelling tot de vorige generaties optische spanningsensoren (voornamelijk spanningsgevoelige kleurstoffen) 2 , bieden GEVI's in vivo analyses van het intacte neurale systeem enHun expressie kan worden beperkt tot specifieke celtypen of populaties.

Het embryo van de zebravis is het in vivo "substraat" van de keuze om te profiteren van het grote potentieel dat aan GEVI's wordt toegeschreven. Dankzij zijn optische helderheid en zijn vereenvoudigde, maar evolutionair geconserveerde zenuwstelsel, maakt het zebravismodel de identificatie en manipulatie van elke cellulaire component in een netwerk eenvoudig. De werkgelegenheid van de FRV-GEVI-zeemeermin 3 leidde immers tot het identificeren van pre-symptomatische veranderingen in het spinale motorische neurongedrag in een zebravismodel van amyotrofe laterale sclerose (ALS) 4 .

Het volgende in vivo protocol beschrijft hoe de elektrische eigenschappen van spinale motorische neuronen in intacte zebravis embryo's op een neuronale manier worden uitgedrukt. Bovendien toont het aan hoe farmacologisch geïnduceerde chanGes in dergelijke elektrische eigenschappen kan worden geassocieerd met veranderingen in de frequentie van embryonale spontane spoelingen, de stereotype motorische activiteit die het bewegingsgedrag van de zebravis in zeer vroege ontwikkelingsstadia kenmerkt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plasmid Generation

OPMERKING: Zeemeermin is een biosensor die is ontwikkeld door het spanningswaarnemende domein (VSD) van de Ciona intestinalis te koppelen (nu Ciona robusta ) 5 spanningssensor die fosfatase (Ci-VSP) bevat met de FRET-partner fluorophoren Umi-Kinoko Green (mUKG: donor) en een monomere versie van het oranje-emitterende fluorescerende eiwit Kusabira Orange (mKOk: acceptor). Voor deze biosensor verhogen conformiteitsveranderingen van het VSD-domein, geïnduceerd door membraan depolarisatie, de nabijheid van de donor- en acceptor fluorescerende eiwitten, waardoor de energieoverdracht tussen hen wordt verhoogd (de FRET Ratio) 3 verhogen. De VSD verzekert de efficiënte lokalisatie van de biosensor bij het plasmamembraan. De neuronale expressie van de biosensor (in het ruggenmerg, het signaal is detecteerbaar in zowel interneuronen als motorneuronen) wordt bereikt door de Zeemeermin op te klonenEn leesframe (ORF) onder de zebravis pan-neurale promotor HuC 6 .

  1. Versterk met behulp van de T3 Universal primer en de Mermaid Sma I primer (5'TATCCCGGGATTCGACGGTTCAGATTTTA) door polymerase kettingreactie (PCR) de Mermaid ORF van het pCS4 + Mermaid plasmide 3 met Pfu (proofreading) DNA polymerase om een Sma I restrictie plaats in de stroomopwaartse stroom Van de zeemeermin ORF.
    1. Gebruik het volgende PCR mengsel: 0,5 μL Pfu DNA polymerase, 7,5 μl van de specifieke 10x buffer, 1 μl 10 mM dNTPs, 2,5 μl dimethylsulfoxide (DMSO), 0,5 μL (50 ng) van de plasmide bereiding en 1 ΜL 20 μM voorraadoplossingen van elke primer in een totaal volume van 50 μl.
    2. Verhit het PCR-mengsel gedurende 15 s bij 95 ° C, prikkel het gedurende 15 s bij 50 ° C en verleng het gedurende 4 minuten bij 72 ° C gedurende een totaal van 35 cycli.
  2. Gel-zuiveren de specifieke stompePCR-product met een commercieel gelzuiveringskit volgens het protocol van de fabrikant.
  3. Kloneer het DNA-fragment in de pCMV-SC stompe vector volgens het protocol van de fabrikant.
  4. Lineariseer het zeemeermin-positieve plasmide (genaamd pCMV-SC_Mermaid) met het Sma I-restrictie-enzym voor de volgende invoeging van de HuC-promotor.
    1. Stel de restrictie-reactie als volgt in: 0,5 μL (10 U) van Sma I-restrictie-enzym, 2 μl van de kit 10x buffer en 5 μg plasmide-DNA in een totaal volume van 20 μl. Incubeer de reactie bij 25 ° C gedurende 1 uur.
  5. Gel-zuiveren het verteerde plasmide met behulp van een commerciële gelzuiveringskit volgens het protocol van de fabrikant.
  6. PCR-amplificeer de HuC-promotor (pHuC), met Pfu DNA-polymerase en zebravis genomisch DNA als sjabloon, met behulp van een paar HuC-specifieke primers (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA en HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) en strekt zich uit op een gebied van 3,150-bp stroomopwaarts van de ATG.
    1. Stel het PCR-mengsel op met behulp van de volgende schema: 0,5 μl Pfu DNA-polymerase, 7,5 μl van de specifieke 10x buffer, 1 μl 10 mM dNTPs, 2,5 μl DMSO, 200 ng genomisch DNA en 1 μl 20 μM Voorraadoplossingen van elke primer in een totaal volume van 50 μl.
    2. Na een eerste stap van 2 minuten bij 95 ° C verwarm het PCR-mengsel gedurende 15 s bij 95 ° C, prikkel het gedurende 15 s bij 50 ° C en verleng het gedurende 4 minuten bij 72 ° C gedurende een totaal van 35 cycli .
  7. Gel-zuiveren het specifieke stompe PCR-product met behulp van een commerciële gelzuiveringskit volgens het protocol van de fabrikant.
  8. Ligereer een equimolaire hoeveelheid van de gezuiverde pCMV-SC_Mermaid (stap 1.5) en het pHuC-DNA (stap 1.7) onder gebruikmaking van 1 μl T4 DNA-ligase en 1 μl van de specifieke 10X buffer in een totaal volume van 10 μl. Incubeer de reactie gedurende 16 uur bij4 ° C.
  9. Transformeer een aliquot van bevoegde cellen met 5 μl van de ligatie-reactie (stap 1.8) volgens de instructies van de fabrikant.
  10. Selecteer de pHuC-positieve klonen (pHuC_Mermaid) met de promotor die in de juiste oriëntatie is ingebracht door een dubbele verdeling van Sal I- Eco RV (de Sal I-restrictieplaats is stroomopwaarts van het promotorfragment in stap 1.6 ingevoegd, terwijl de Eco RV restrictieplaats Is stroomafwaarts geplaatst van het polyadenyleringsgebied, PolyA, van het plasmide pCMV-SC).
    1. Stel de restrictie-reactie als volgt in: 0,5 μL (10 U) van zowel Sal I als Eco RV restrictie enzymen, 2 μl van de kit10X buffer en 1 μg pHuC_Mermaid DNA in een totaal volume van 20 μl. Incubeer de reactie gedurende 1 uur bij 37 ° C. Breng de reacties op een agarosegel.

2. Embryo Microinjectie

  1. Vervoer de bevruchte bvGs verkregen uit wildtype (AB-stam) of Sod1-G93R volwassen zebravis 4 op een 10 mm petrischaal met behulp van een plastic pipet.
  2. Spoel de embryo's in koud (4 ° C) viswater en meng ze onmiddellijk in de dooier met 200 pg pHuC_Mermaid plasmide met behulp van een microinjector (voor een algehele en gedetailleerde beschrijving van de microinjectie procedure, zie Referenties 7 en 8).
  3. Met behulp van een plastic pipet, verplaats de embryo's naar een Petri-schotel en incubeer ze in viswater bij 28 ° C tot ze de gewenste ontwikkelingsfase (20-24 uur na bevruchting, hpf) bereiken voor de volgende analyses.

3. Spontane Tail Coiling Analysis

OPMERKING: Evalueer het spontane staartwisselingsgedrag in 20-24 pkf embryo's met of zonder de drug riluzole.

  1. Breng een embryo over op een 90 mm ronde Petri-schaal, gevuld met viswater dat 0,2% DMSO bevat (riluzole voertuig) en handmatig deksioneren met twO juwelierspinnen met scherpe tips. Incubeer het embryo gedurende 5 minuten.
  2. Ontdek de staartcoiling bij RT tijdens een 1 minuten videorecorder met behulp van een digitale camera die op een stereomicroscoop is gemonteerd. Verkrijg tijdsreeks bij een tijdresolutie van 30 frames / s.
  3. Bereken de frequentie van spontane staartspoelen door het aantal bochten (zowel contralaterale als ipsilaterale) per tijdseenheid te tellen.
  4. Om het effect van het geneesmiddel riluzole te evalueren, gebruikt u een plastic Pasteur pipette voorzichtig om het embryo over te brengen naar een nieuwe 90 mm Petri-schaal, gevuld met viswater dat 5 μM riluzole bevat.
    1. Incubeer het embryo gedurende 5 minuten voordat u een 1-min-video opneemt en de gedragsanalyse uitvoert zoals hierboven.

4. Imaging Setup voor Mermaid Biosensor Visualisatie in Living Embryo's: Simultaneous Detection of Donor and Acceptor Signals

  1. Monteer de 20-24 pk embryo's in 1% laagsmeltpunt agarose in viswater bij37 ° C in een 35 mm glazen bodem beeldschotel. Richt de embryo's aan hun zijden. Wacht tot de agarose bij kamertemperatuur stoomt.
  2. Verplaats de beeldschotel naar het stadium van een omgekeerde confocal die op een omgekeerde microscoop is gemonteerd. Identificeer motorische neuronen die de biosensor uitdrukken met een 20X-doelstelling (0,7 numerieke diafragma, NA) door de mUKG op te spannen met de 488 nm-argonlaserlijn en de emissie tussen 495 en 525 nm op te nemen.
  3. Voor een FRET-meting, exciteer mUKG, de donor van het FRET-paar, met de 488 nm laserlijn. Gelijktijdig detecteren, met een resonante scanner die actief is bij 8000 Hz in de bidirectionele modus, de fluorescentie die door de donor wordt uitgestoten (tussen 495 en 525 nm) en de fluorescentie die door de mKOk-acceptor wordt afgegeven (tussen 550 en 650 nm, FRET-kanaal). Indien beschikbaar, gebruik de 473 nm laser.
    OPMERKING: De excitatie-efficiëntie van de donor zal licht verminderd worden (85% in plaats van 93% bij 488 nm), maar de kruis-excitatie van de acceptor zalEveneens verminderd (van 17% met de 488 nm tot 9% met 473 nm laserlijn).
  4. Om de fototoxiciteit en het fluorofore bleken te verminderen, minimaliseer de belichting van het monster door de kracht van de laserlijn te verminderen (op het straalpadvenster van de acquisitie software).
  5. Optimaliseer de excitatie om winst- en compensatieparameters aan te passen die aan het begin van het experiment zijn ingesteld en constant blijven door de sessie. Om de offset in te stellen, wijzigt u de kleur van de afbeelding op intensiteitswaarden (met behulp van de Q-opzoektabel) en schuift u met de laser uit de offsetknop (slimme offset) zodat de achtergrondpixels een lichtintensiteit hebben Hoger dan nul. Met de zelfde opzoektafel, door de laser aan te zetten tijdens het scannen, draai dan de winstknop (slimme versterking) om de signaal-ruisverhouding te maximaliseren, zodat u verzadigde pixels vermijdt.
  6. Met behulp van een geopend pinhole (2 luchtige eenheden), verwerven u 16-bits beelden om een ​​voldoende dynamisch bereik voor kwantitatief te biedenE analyses. Vermijd gemiddelde om de aanschafsnelheid te verhogen en om het fotobak te minimaliseren.
  7. In het venster voor het ophalen van software selecteert u een afbeeldingsveldgrootte van 512 x 64 pixels (pixelformaat: 605 nm) in de vervolgkeuzelijst.
  8. Selecteer in het acquisitiemodus venster xyt (tijdverloop op een enkel xy-vliegtuig) in het vervolgkeuzemenu en let op de veranderingen in de spiernervelspanning van het embryo door een enkel xy-vliegtuig te verwerven, waarbij de acquisitieparameters één beeld opnemen elke 30 Ms gedurende 1 min.
  9. Om het effect van riluzole toediening op membraan depolarisatie in hetzelfde neuron te evalueren, verwerven een nieuwe dataset 5 minuten na de toevoeging van viswater dat 5 μM riluzole bevat.
  10. Voor FRET analyse, gebruik de ImageJ macro Biosensor_FRET (expressie van single-chain FRET biosensors.
  11. Evalueer de basale membraan FRET verhouding van elke neuron bij t 1 als ((FRET gemiddelde - FRET achtergrond) / (Donor gemiddelde - Donor achtergrond)), waar FRET en DonOf gemiddelde intensiteit is de gemiddelde fluorescentie-intensiteit, berekend in dezelfde regio van belang (ROI), getekend rond de cel voor elk verkregen kanaal. FRET en Donor background zijn de gemiddelde fluorescentie-intensiteit berekend in een ROI van het zichtveld zonder het fluorescerende monster.
    OPMERKING: een gedetailleerde stap-voor-stap beschrijving van het gebruik van de plugin vindt u op de website www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Gebruik een grafische software om de frequentie, amplitude en duur van depolarisatie tussen verschillende experimentele paradigma's te vergelijken. Vergelijk twee groepen met behulp van een unpaired Student's t- test en let op gemiddelde waarden als statistisch verschillend wanneer P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Een expressievector die de FRET-gebaseerde zeemeermin biosensor coderende sequentie draagt ​​onder de controle van de pHuC pan-neuronale promotor, die de synthese van het eiwit uitsluitend in het zenuwstelsel drijft, werd afgeleverd in enkelvoudige bevruchte eieren door middel van een microinjectie in Om transiente transgene embryo's te verkrijgen ( Figuur 1 , Linker paneel). Na het masteren van de microinjectietechniek was het percentage zeemeermin-positieve embryo's bijna 100%. Onder deze werden alleen de embryo's die de juiste hoeveelheid Mermaid biosensor op het plasmamembraan uitdrukken, overwogen voor FRET analyse / beeldverwerving.

Spontane spoelingen, motorreacties die uitsluitend bestaan ​​uit een volledige lichaamscontractie die de punt van de staart op het hoofd 9 , 10 brengen , werden op het stadium van 20 opgenomen-24 pkf in regelmatig vismedium ( Figuur 1 , middenpaneel en Video 1 ) en volgend incubatie in 5 μM riluzole ( Video 2 ). De statistische analyses van de veranderingen in de frequentie van de spontane staartspoelen die door de drug riluzole worden veroorzaakt, worden elders gerapporteerd 4 .

Om te testen of veranderingen in de elektrische activiteit van de spinale motorische neuronen op basis waren van de riluzole-geïnduceerde veranderingen in de spontane coilfrequentie, werd het membraanpotentiaal in embryo-spinale motorische neuronen bestudeerd op een niet-invasieve manier, waarbij de fluorescentie-intensiteit werd gemeten Verhouding van het donor / acceptor FRET-paar van de zeemeermin biosensor (FRET-verhouding: figuur 1 , rechter paneel). Primaire spinale motorische neuronen die de biosensor uitdrukken werden geïdentificeerd ( Figuur 2A ) en hun basale spontane depolarisatieactiviteiten werden geregistreerd ( Ng> Afbeelding 2B en Video's 3 en 4 ). Samen met de vermindering van de frequentie van staart coil bewegingen verminderde de toediening van riluzole de frequentie van spontane depolarisatie gebeurtenissen ( Figuur 2C ).

Figuur 1
Figuur 1: Stroomschema van de experimentele procedure. Enkele cel-stadium embryo's worden verzameld en onmiddellijk microinjected met het pHuC_Mermaid plasmide om de FRM-spanning biosensor uit te breiden op een pan-neuronale manier. Bij 20-24 hpf met incubatie bij 28 ° C worden enkele embryo's overgebracht onder een stereomicroscoop en wordt hun spontane staart-coilactiviteit, met en zonder de riluzol aanwezig in het viswater, video opgenomen en geanalyseerd. Dezelfde embryo's ondergaan in vivo FRET-analyse om de veranderingen in het motorische neuronmembraanpotentieel te meten.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Klik hier om een ​​grotere versie van deze figuur te zien.

Figuur 2
Figuur 2: In Vivo FRET Analyse om veranderingen in motor neuron membraan potentieel te meten. ( A ) Wild-type zebravis embryo's met de mozaïekuitdrukking van de FRET-gebaseerde spanning biosensor Zeemeermin in de ruggengraat neuron. (A) Het lichte veldbeeld toont het gebied van de zebravisstammen geïdentificeerd door de zwarte doos (sc: ruggenmerg, ms: myoseptum, m: myotoom). Door het superimposeren op (a) het gedetecteerde fluorescentiesignaal (b) kan de efficiënte expressie van de biosensor in een primaire spinale motorneuron (PM) duidelijk zichtbaar zijn. De donor (c) en het FRET (d) kanaal gedetecteerd worden getoond met de respectieve groene en magenta look-up tabellen (LUT)aan de rechterkant. Alle embryo's zijn gemonteerd in een krans-naar-caudale oriëntatie. Schaalbalk = 10 μm. ( B ) De FRET ratio kaart toont de FRET ratio berekend elke 0.03 s in dezelfde motor neuron. Het toont de basale spontane depolariseringsactiviteit die de cel ondergaat. Voor de meermin biosensor komt de toename van de FRET-verhouding voor wanneer het membraanpotentieel toeneemt. Schaalbalk = 10 μm. ( C ) Representatief voorbeeld van spontane gemiddelde FRET ratio veranderingen die zich voordoen in een spinale motor neuron van een Sod1-G93R zebravis embryo tijdens een 1 minuten opname. Riluzole-toediening vermindert de frequentie van de spontane depolarisaties. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Film 1
Film 1:Spontane Tail Coiling in 24-pk Wild-type controle embryo's. Representatieve opname die spontane staart toont in een 24 hpf wildtype controleembryo dat in viswater is geïncubeerd. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

Film 2
Film 2: Spontane Tail Coiling in 24-hpf Wild-type riluzole-behandelde embryo's. Representatieve opname die spontane staart toont in een 24 hpf wildtype controleembryo geïncubeerd in 5 μM riluzole (+ R). Vergeleken met controles bleek dat + R embryo's een significante afname in de frequentie van spontane staart coil gedrag bij 24 pk. Klik hier om deze video te bekijken. (RigHt-klik om te downloaden.)

Film 3
Film 3: Basale Spontane Depolarisatie Activiteit van een Primêre Motor Neuron in het Ruggenmerg van een Wild-type Zebravis Embryo op 20 pkf. De biosensor van de Meermin is zo gevoelig dat het de snelle veranderingen in het motorische neuronmembraanpotentieel in de ruggenmergen van intacte embryo's kan detecteren. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

Film 4
Film 4: Spontane Depolarisatie Activiteit is gekoppeld aan spiercontractie. Een secundaire motorneuron in het ruggengraat van een wild-type zebravis embryo bij 20 pkf ondergaat spontane depolarisatie. In dit geval, elke dePolarisatie is geassocieerd met een samentrekking van de zebravisspieren, georganiseerd in een functioneel gesynchroniseerd syncytium in deze ontwikkelingsfase. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het hier gepresenteerde protocol liet ons de associatie tussen de elektrische eigenschappen van embryo-spinale motorische neuronen en de spontane coilgedrag, de vroegste stereotiepe motoractiviteit, ongeveer 17 pk. Van embryonale ontwikkeling verkennen en duurt tot 24 pkf 10 .

Onze aanpak biedt onderzoekers een instrument om het neurale systeem van intacte embryo's te bestuderen, waarbij de complexiteit van de interacties tussen cellen in een ontwikkelend functioneel netwerk volledig wordt behouden. De in vivo beeldvorming van zebravis embryo's is uitgevoerd door ze simpelweg te immobiliseren door onderdompeling bij laagsmeltende agarose. Het onderzoek naar veranderingen in het celmembraanpotentieel door het gebruik van een biosensor is een van de voornaamste voordelen van deze methode. Kanonische elektrofysiologische benaderingen, waar neuronen fysiek moeten worden geopend door het verwijderen van de omhullende weefsels 11 , zijn procedureDie de elektrische eigenschappen van de onderzochte cellen kunnen veranderen. Bovendien maakt de FRS-gebaseerde biosensor benadering het mogelijk om cel-elektrische eigenschappen te onderzoeken zonder gebruik van verdovingsmiddelen ( dwz Tricaine, een natriumkanaalblokkering), waardoor eventuele storingen die verband houden met de toediening van chemicaliën ( dwz riluzole hier), vermeden worden, welke Kan in het experimentele plan cruciaal zijn. Met deze methode kunnen we zich richten op de modulatie van zowel de elektrische activiteit als de frequentie van de spontane staartspoelingen, een gedragsreactie die in de meeste gevallen elektrofysiologische opnamen voorkomt zonder de anesthetica. Tenslotte biedt de inzet van GEVI's de hoogste tijdelijke experimentele controle, omdat het werk mogelijk maakt op een specifieke embryonale ontwikkelingsfase. Onze beeld- / opnamesessies hebben een zeer beperkt tijdsvenster overschreden, waardoor we de ontwikkelingsfasen van de verschillende embryo's in real time precies kunnen vergelijken. AlleDe conventionele elektrofysiologische opnamen worden integendeel meestal uitgevoerd in grotere en minder nauwkeurige tijdspanningen.

Het meten van spanningswijzigingen door beeldtechnieken is echter inherent moeilijk door de aard van het signaal zelf, die in snelheid, frequentie en grootte van de veranderingen in membraanpotentieel kan variëren. Een ideale spanningssensor combineert snel responsiviteit, hoge gevoeligheid en hoge fotonemissie. Voor de meeste FRET-gebaseerde GEVI's variëren veranderingsveranderingen als een functie van membraanspanningvariaties, maar de amplitude van de veranderingen in de fluorescentieverhouding is nauw verbonden met de duur van de depolariseringsgebeurtenissen. Recent werden nieuwe GEVI's ontwikkeld en gekenmerkt, waardoor het mogelijk is om de beste sonde te kiezen in relatie tot het type experimentele probleem, model en beeldvormingsapparaat.

Spanningsbiosensoren zijn integrale membraaneiwitten. Wanneer getransfecteerd in gekweekte cellen of uitdrukkenD in levende organismen, zal de fluorescentie van de plasmembraan gelokaliseerde sensor in zekere mate worden geassocieerd met de fluorescentie van de sensor in andere intracellulaire compartimenten - waar het eiwit kan worden geklocaliseerd of geaggregeerd, waardoor een achtergrondsignaal wordt opgewekt. Het niveau van expressie en de juiste membraanlocatie van elk construct moet worden gecontroleerd in vereenvoudigde experimentele modellen ( dwz transfectie van cellijnen of primaire culturen) voordat de biosensoren in levende organismen worden gebruikt.

In de huidige experimentele opstelling kan een andere potentiële kritische stap van het protocol worden vertegenwoordigd door de efficiëntie van de transgenese procedure. Indien nodig kan het percentage plasmide-positieve cellen drastisch worden verhoogd door gebruik te maken van het Tol2 transposon systeem 12 . Een extra cruciaal aspect dat moet worden overwogen, is het verlies van fluorescentie-uitstoot in de donor fluorofoor en het verlies in FRET sigNal die optreedt tijdens de beeldsessie door de intense verlichting. Dit moet vermeden worden door de belichting van het monster te minimaliseren, waardoor de kracht van de gebruikte laserlijn wordt verminderd. Evenzo moet de winst en compensatie van de fotomultipliers zorgvuldig worden afgesteld aan het begin van elke opnamesessie om de beste signaal-ruisverhouding in de verworven beelden te behalen, evenals versadigde pixels. Al deze parameters kunnen variëren afhankelijk van het type onderzochte cel, de eigenschappen van de biosensor, en de instrumenten die worden gebruikt voor het verkrijgen van beelden (brede veldfluorescentiemicroscopen kunnen ook worden gebruikt, zoals onlangs beschreven 13 ). De onderzoeker dient echter altijd rekening te houden met het feit dat tijdens het in vivo beeldvorming het geluidsniveau het specifieke signaal van de sensor meer kan beïnvloeden dan in in vitro opnames. Tenslotte, indien beschikbaar, kunnen de meting van de controle met behulp van mutante probes, die niet op spanning reageren, een handige manier zijnHet niveau van systeemspecifiek geluid en / of artefacten beoordelen.

De inzet van zebravis embryo's is een belangrijk kenmerk van deze aanpak, dankzij hun responsiviteit op genetische manipulatie en microscopisch onderzoek. In feite maken deze eigenschappen transiënte transgenese en de FRET-gebaseerde analyse van neuronale elektrische eigenschappen mogelijk. Naar onze mening, met de meest geschikte promotor- en biosensorcombinaties, zou het mogelijk zijn om de elektrische activiteit van elk type celtype selectief te analyseren en parallelle dergelijke activiteit met het embryonale fenotype te analyseren.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing Motor Neuron Membraan Potentieel in Live Zebrafish Embryo&#39;s
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter