Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing Potentiel de membrane de neurones moteurs dans les embryons vivants de zébrés

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'analyse in vivo des composants systémiques permet aux scientifiques d'étudier le comportement cellulaire de la manière la plus fiable. Cela est particulièrement vrai lorsque l'activité sous contrôle est fortement influencée par les interactions cellule-cellule (dépendantes en contact et sans contact), comme dans le système nerveux, où les changements de tension membranaire entraînent la communication entre les cellules excitables. La compréhension de l'information codée par ces signaux électriques est la clé pour comprendre comment fonctionne le système nerveux dans les états physiologiques et pathologiques.

Afin d'étudier les propriétés électriques cellulaires dans les conditions physiologiques les plus non invasives, plusieurs indicateurs de tension génétiquement codés ont récemment été développés 1 . Par opposition aux générations précédentes de capteurs de tension optique (principalement des colorants sensibles à la tension) 2 , les GEVI permettent des analyses in vivo du système nerveux intact, etLeur expression peut être limitée à des types ou populations de cellules spécifiques.

L'embryon de poisson zèbre est le «substrat» in vivo de choix pour tirer parti du grand potentiel attribué aux GEVI. En fait, grâce à sa clarté optique et à son système nerveux simplifié mais progressivement conservé, le modèle du poisson zèbre permet une identification et une manipulation simples de chaque composant cellulaire dans un réseau. En effet, l'emploi du GEVI Mermaid 3 à base de FRET a permis d'identifier des altérations pré-symptomatiques du comportement des neurones moteurs de la moelle épinière dans un modèle de sclérose latérale amyotrophique (ALS) 4 .

Le protocole in vivo suivant décrit comment surveiller les propriétés électriques des neurones moteurs vertébraux dans des embryons de poissons zèbres intacts exprimant la sirène d'une manière spécifique aux neurones. En outre, il démontre comment Chan pharmacologiquement induitCes propriétés électriques peuvent être associées à des altérations de la fréquence des bobines spontanées embryonnaires, l'activité motrice stéréotypée qui caractérise le comportement de mouvement du poisson zèbre à des stades de développement très précoces.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pHuC_Mermaid Plasmid Generation

NOTE: Mermaid est un biocapteur développé en associant le domaine de détection de tension (VSD) de Ciona intestinalis (maintenant Ciona robusta ) 5 capteur de tension contenant de la phosphatase (Ci-VSP) avec les fluorophores partenaires de FRET Umi-Kinoko Green (mUKG: donneur) et une version monomère de la protéine fluorescente émettrice d'orange Kusabira Orange (mKOk: accepteur). Pour ce biocapteur, les changements conformationnels du domaine VSD, induits par la dépolarisation de la membrane, augmentent la proximité des protéines fluorescentes donneuses et acceptrices, ce qui augmente le transfert d'énergie entre elles (en augmentant le rapport FRET) 3 . La VSD assure la localisation efficace du biocapteur à la membrane plasmique. L'expression neuronale du biocapteur (dans la moelle épinière, le signal est détectable chez les interneurones et les neurones moteurs) est obtenue par clonage de l'opérateur MermaidEn cadre de lecture (ORF) sous le promoteur pan-neural Zebrafish HuC 6 .

  1. Amplifier par PCR (polymerase chain reaction) la Mermaid ORF à partir du pCS4 + Mermaid plasmid 3 avec Pfu (proofreading) DNA polymerase en utilisant l'amorce T3 Universal et l'amorce Mermaid Sma I (5'TATCCCGGGATTCGACGGTTCAGATTTTA) afin d'insérer un site de restriction Sma I en amont De l'ORF Mermaid.
    1. Utiliser le mélange de PCR suivant: 0,5 μl d'ADN polymérase de Pfu, 7,5 μL du tampon 10x spécifique, 1 μL de dNTP 10 mM, 2,5 μL de diméthylsulfoxyde (DMSO), 0,5 μL (50 ng) de la préparation de plasmide et 1 ΜL de solutions stock de 20 μM de chaque amorce dans un volume total de 50 μL.
    2. Chauffer le mélange de PCR pendant 15 s à 95 ° C, l'amorcer pendant 15 s à 50 ° C et l'allonger pendant 4 min à 72 ° C pour un total de 35 cycles.
  2. Gel-purifie le brouilleur spécifiqueProduit de PCR utilisant un kit de purification de gel commercial, suivant le protocole du fabricant.
  3. Cloner le fragment d'ADN dans le vecteur flasque pCMV-SC suivant le protocole du fabricant.
  4. Linéariser le plasmide positif Mermaid (appelé pCMV-SC_Mermaid) avec l'enzyme de restriction Sma I pour l'insertion suivante du promoteur HuC.
    1. Configurez la réaction de restriction comme suit: 0,5 μL (10 U) d'enzyme de restriction Sma I, 2 μL du tampon kit 10x et 5 μg d'ADN plasmidique dans un volume total de 20 μL. Incuber la réaction à 25 ° C pendant 1 h.
  5. Gel-purifier le plasmide digéré en utilisant un kit de purification de gel commercial suivant le protocole du fabricant.
  6. PCR-amplifier le promoteur HuC (pHuC), avec l'ADN polymerase de Pfu et l'ADN génomique du poisson zèbre en tant que modèle, en utilisant une paire d'amorces spécifiques HuC (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA et HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) et couvrant une région de 3,150 pb en amont de l'ATG.
    1. Mettre en place le mélange de PCR en utilisant le schéma suivant: 0,5 μL d'ADN polymerase de Pfu, 7,5 μL du tampon 10x spécifique, 1 μL de dNTP 10 mM, 2,5 μL de DMSO, 200 ng d'ADN génomique et 1 μL de 20 μ M Stock de solutions de chaque amorce dans un volume total de 50 μL.
    2. Après une étape initiale de 2 min à 95 ° C, chauffer le mélange PCR pendant 15 s à 95 ° C, l'amorcer pendant 15 s à 50 ° C et l'allonger pendant 4 min à 72 ° C pour un total de 35 cycles .
  7. Gel-purifiez le produit de PCR brut spécifique en utilisant un kit de purification de gel commercial suivant le protocole du fabricant.
  8. Liaiser une quantité équimolaire du pCMV-SC_Mermaid purifié (étape 1.5) et de l'ADN de pHuC (étape 1.7) en utilisant 1 μL d'ADN ligase T4 et 1 μL du tampon spécifique 10X dans un volume total de 10 μL. Incuber la réaction pendant 16 h à4 ° C.
  9. Transformer une aliquote de cellules compétentes avec 5 μL de la réaction de ligature (étape 1.8) en suivant les instructions du fabricant.
  10. Sélectionnez les clones pHuC-positive (pHuC_Mermaid) avec le promoteur inséré dans l'orientation appropriée par une double digestion Sal I- Eco RV (le site de restriction Sal I a été inséré en amont du fragment promoteur à l'étape 1.6, tandis que le site de restriction Eco RV Est positionné en aval de la région de polyadénylation, PolyA, du plasmide pCMV-SC).
    1. Réglez la réaction de restriction comme suit: 0,5 μL (10 U) des enzymes de restriction Sal I et Eco RV, 2 μL du tampon kit10X et 1 μg d'ADN de pHuC_Mermaid dans un volume total de 20 μL. Incuber la réaction à 37 ° C pendant 1 h. Exécutez les réactions sur un gel d'agarose.

2. Micro-injection d'embryons

  1. Transférer les engrais par exempleGs obtenus à partir d'une espèce de type sauvage (souche AB) ou Sod1-G93R poisson zèbre adultes 4 à une boîte de Pétri 10 mm à l'aide d'une pipette en plastique.
  2. Rincer les embryons dans de l'eau de poisson froide (4 ° C) et les microinjecter immédiatement dans le jaune d'oeuf avec 200 pg de plasmide pHuC_Mermaid à l'aide d'un micro-injecteur (pour une description globale et détaillée de la procédure de microinjection, voir les références 7 et 8).
  3. À l'aide d'une pipette en plastique, transférer les embryons dans une boîte de Petri et les incuber dans de l'eau de poisson à 28 ° C jusqu'à ce qu'ils atteignent le stade de développement souhaité (20-24 h après la fertilisation, hpf) pour les analyses suivantes.

3. Analyse spontanée de la queue d'enroulement

NOTE: Évaluez le comportement spontané de l'enroulement de la queue dans des embryons de 20 à 24 hpf avec ou sans le médicament riluzole.

  1. Transférer un embryon dans une boîte de Petri ronde de 90 mm remplie d'eau de poisson contenant 0,2% de DMSO (véhicule riluzole) et le déchifférer manuellement en utilisant deuxPince à bijoux avec pointes pointues. Incuber l'embryon pendant 5 min.
  2. Détectez l'enroulement de la queue à la RT pendant un enregistrement vidéo de 1 min à l'aide d'un appareil photo numérique monté sur un stéréomicroscope. Acquérir des séries chronologiques à une résolution de temps de 30 images / s.
  3. Calculez la fréquence des bobines spontanées de la queue en comptant le nombre de virages (à la fois contralatéral et ipsilatéral) par unité de temps.
  4. Pour évaluer l'effet du médicament riluzole, utilisez doucement une pipette Pasteur en plastique pour transférer l'embryon dans une nouvelle boîte de Petri de 90 mm remplie d'eau de poisson contenant 5 μM de riluzole.
    1. Incuber l'embryon pendant 5 min avant d'enregistrer une vidéo de 1 min et d'effectuer l'analyse comportementale comme ci-dessus.

4. Configuration de l'imagerie pour la visualisation du biocapteur de la sirène dans les embryons vivants: détection simultanée des signaux du donneur et de l'accepteur

  1. Monter les embryons de 20 à 24 hpf dans 1% d'agarose à faible point de fusion dans de l'eau de poisson à37 ° C dans un plat d'imagerie à fond de verre de 35 mm. Orientez les embryons sur leurs côtés. Attendre que l'agarose se solidifie à température ambiante.
  2. Transférer le plat d'imagerie au stade d'un confocal inversé monté sur un microscope inversé. Identifiez les neurones moteurs exprimant le biocapteur avec un objectif 20X (0,7 ouverture numérique, NA) en excitant le mUKG avec la ligne laser argon 488 nm et en enregistrant son émission entre 495 et 525 nm.
  3. Pour une mesure FRET, exciter mUKG, le donneur de la paire FRET, avec la ligne laser 488 nm. Détecte simultanément, avec un scanner résonnant fonctionnant à 8 000 Hz en mode bidirectionnel, la fluorescence émise par le donneur (entre 495 et 525 nm) et la fluorescence émise par l'accepteur mKOk (entre 550 et 650 nm, canal FRET). Si disponible, utilisez le laser 473 nm.
    NOTE: L'efficacité d'excitation du donneur sera légèrement réduite (85% au lieu de 93% avec 488 nm), mais l'excitation croisée de l'accepteur seraÊtre réduit aussi (de 17% avec 488 nm à 9% avec une ligne laser 473 nm).
  4. Pour réduire la phototoxicité et le blanchiment des fluorophores, minimisez l'illumination de l'échantillon en réduisant la puissance de la ligne laser (sur la fenêtre du chemin de faisceau du logiciel d'acquisition).
  5. Optimisez l'excitation pour faire correspondre les paramètres de gain et de décalage qui sont définis au début de l'expérience et maintenus constants tout au long de la session. Pour définir le décalage, modifiez la couleur des valeurs de l'image en intensité (en utilisant la table de recherche Q) et, lors de la numérisation avec le laser éteint, tournez le bouton de décalage (décalage intelligent) afin que les pixels de fond aient légèrement une intensité Supérieur à zéro. Avec la même table de consultation, en allumant le laser pendant la numérisation, tournez le bouton de gain (gain intelligent) pour maximiser le rapport signal sur bruit, en prenant soin d'éviter les pixels saturés.
  6. À l'aide d'un trou d'œil ouvert (2 unités aériennes), acquérir des images 16 bits pour fournir une gamme dynamique suffisante pour quantitatifE analyse. Évitez la moyenne pour augmenter la vitesse d'acquisition et pour minimiser le photoblanchage.
  7. Dans la fenêtre d'acquisition du logiciel, sélectionnez une taille de champ d'image de 512 x 64 pixels (taille de pixel: 605 nm) dans le menu déroulant.
  8. Dans la fenêtre du mode d'acquisition, sélectionnez xyt (time lapse sur un seul plan xy) dans le menu déroulant et enregistrez les changements dans la tension des neurones de la colonne vertébrale embryonnaire en acquérant un seul plan xy, en définissant les paramètres d'acquisition pour enregistrer une image tous les 30 Ms pendant 1 min.
  9. Pour évaluer l'effet de l'administration du riluzole sur la dépolarisation de la membrane dans le même neurone, acquérir un nouveau jeu de données 5 min après l'addition d'eau de poisson contenant 5 μM de riluzole.
  10. Pour les analyses FRET, utilisez la macro macro ImageJ BIS (ce qui implique les biosensors FRET à une seule chaîne).
  11. Évaluer le rapport FRET de la membrane basale de chaque neurone à t 1 comme ((moyen FRET - fond FRET) / (Donor mean - Donor background)), où FRET et DonOu l'intensité moyenne est l'intensité de fluorescence moyenne calculée dans la même région d'intérêt (ROI) dessinée autour de la cellule pour chaque canal acquis et le fond de FRET et Donor est l'intensité de fluorescence moyenne calculée dans un ROI du champ de vision sans l'échantillon fluorescent.
    REMARQUE: une description détaillée étape par étape de l'utilisation du plugin se trouve sur le site www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Utilisez un logiciel graphique pour comparer la fréquence, l'amplitude et la durée de la dépolarisation entre différents paradigmes expérimentaux. Comparez deux groupes en utilisant un t- test Student non accompagné et considérez les valeurs moyennes comme étant statistiquement différentes lorsque P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Un vecteur d'expression portant la séquence de codage du biocapteur Mermaid à base de FRET sous le contrôle du promoteur pan-neuronal pHuC, qui conduit la synthèse de la protéine exclusivement dans le système nerveux, a été administré dans des oeufs fertilisés à une seule cellule au moyen d'une micro-injection dans Afin d'obtenir des embryons transgéniques transitoires ( figure 1 , Panneau de gauche). Après avoir maîtrisé la technique de micro-injection, le pourcentage d'embryons positifs à la sirène était proche de 100%. Parmi ceux-ci, seuls les embryons exprimant la quantité appropriée de biocapteur Mermaid à la membrane plasmique ont été considérés pour l'analyse de FRET / acquisition d'image.

Les bobines spontanées, les réponses motrices qui consistent exclusivement en une contraction complète du corps, amenant la pointe de la queue à la tête 9 , 10 , ont été enregistrées au stade 20-24 hpf en milieu de poisson régulier ( Figure 1 , panneau central et Vidéo 1 ) et suite à une incubation dans 5 μM de riluzole ( Vidéo 2 ). Les analyses statistiques des changements dans la fréquence des bobines de queue spontanées déclenchées par le médicament riluzole sont rapportées ailleurs 4 .

Pour vérifier si les altérations de l'activité électrique des neurones moteurs rachidiens étaient à la base des changements induits par le riluzole dans la fréquence d'enroulement spontané, le potentiel de membrane dans les neurones moteurs embryonnaires de la colonne vertébrale a été étudié de manière non invasive, en mesurant l'intensité de fluorescence Rapport de la paire FRET du donneur / accepteur du biocapteur Mermaid (rapport FRET: figure 1 , panneau droit). Les neurones moteurs de la colonne vertébrale primaire exprimant le biocapteur ont été identifiés ( figure 2A ) et leurs activités basales de dépolarisation spontanée ont été enregistrées ( Ng> Figure 2B et Vidéos 3 et 4 ). Avec la réduction de la fréquence des mouvements de l'enroulement de la queue, l'administration de riluzole a réduit la fréquence des événements de dépolarisation spontanée ( figure 2C ).

Figure 1
Figure 1: tableau de flux de la procédure expérimentale. Les embryons à cellules monocellulaires sont collectés et injectés immédiatement avec le plasmide pHuC_Mermaid pour exprimer le biosensor de la tension FRET de sirène de manière pan-neuronale. À 20-24 hpf avec incubation à 28 ° C, les embryons simples sont transférés sous un stéréomicroscope et leur activité spontanée d'enroulement de queue, avec et sans le médicament riluzole présent dans l'eau de poisson, est enregistrée et analysée. Les mêmes embryons subissent une analyse FRET in vivo afin de mesurer les changements dans le potentiel de la membrane des neurones moteurs.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Cliquez ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: Analyse FRET In Vivo pour mesurer les changements dans le potentiel de membrane du neurone moteur. ( A ) Des embryons de poisson zèbre de type sauvage avec l'expression en mosaïque du biosensor de tension à base de FRET Mermaide dans le neurone de la colonne vertébrale. (A) L'image du champ lumineux montre la zone du tronc du poisson zèbre identifié par la boîte noire (sc: la moelle épinière, ms: myoseptum; m: myotome). En superposant sur (a) le signal de fluorescence détecté (b), l'expression efficace du biocapteur dans un neurone moteur médullaire primaire (PM) peut être clairement visualisée. Le donateur (c) et le canal FRET (d) détecté sont affichés avec les tables de recherche respectives en vert et magenta (LUT)sur le côté droit. Tous les embryons sont montés dans une orientation crânienne à caudale. Barre d'échelle = 10 μm. ( B ) La carte du ratio FRET affiche le rapport FRET calculé tous les 0,03 s dans le même neurone moteur. Il montre l'activité basale de dépolarisation spontanée que subit la cellule. Pour le biocapteur Mermaid, l'augmentation du taux de FRET se produit lorsque le potentiel de la membrane augmente. Barre d'échelle = 10 μm. ( C ) Exemple représentatif de changements de rapport FRET moyen spontanés se produisant dans un neurone moteur rachidien d'un embryon de poisson zèbre Sod1-G93R pendant un enregistrement de 1 min. L'administration de Riluzole réduit la fréquence des dépolarisations spontanées. Cliquez ici pour voir une version plus grande de ce chiffre.

Film 1
Film 1:Bobine de queue spontanée dans des embryons de contrôle de type sauvage de 24 hpf . Enregistrement représentatif montrant l'enroulement spontané de la queue dans un embryon de contrôle de type sauvage de 24 hpf incubé dans l'eau de poisson. Cliquez ici pour voir cette vidéo. (Cliquez avec le bouton droit de la souris pour télécharger.)

Movie 2
Film 2: Bobine de queue spontanée dans des embryons traités au riluzole de type 24 hpf. Enregistrement représentatif montrant l'enroulement spontané de la queue dans un embryon de contrôle de type sauvage de 24 hpf incubé dans 5 μM de riluzole (+ R). Par rapport aux témoins, les embryons de + R ont montré une diminution significative de la fréquence du comportement spontané de l'enroulement de la queue à 24 hpf. Cliquez ici pour voir cette vidéo. (Plate-formeHt-cliquez pour télécharger.)

Film 3
Film 3: Activité de dépolarisation spontanée basale d'un neurone moteur primaire dans la moelle épinière d'un embryon de poisson zébré de type sauvage à 20 hpf. Le biocapteur Mermaid est tellement sensible qu'il peut détecter les changements rapides du potentiel de la membrane des neurones moteurs dans les cordes épinaux des embryons intacts. Cliquez ici pour voir cette vidéo. (Cliquez avec le bouton droit de la souris pour télécharger.)

Film 4
Film 4: l'activité de dépolarisation spontanée est couplée à la contraction musculaire. Un neurone moteur secondaire dans la moelle épinière d'un embryon de poisson zèbre de type sauvage à 20 hpf subit une dépolarisation spontanée. Dans ce cas, chaqueLa polarisation est associée à une contraction des muscles du poisson zèbre, organisée dans un syncytium fonctionnellement synchronisé à cette étape de développement. Cliquez ici pour voir cette vidéo. (Cliquez avec le bouton droit de la souris pour télécharger.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le protocole présenté ici nous a permis d'explorer l'association entre les propriétés électriques des neurones moteurs de la colonne vertébrale du embryon de poisson zèbre et le comportement d'enroulement spontané, l'activité motrice stéréotypée la plus ancienne, qui apparaît autour de 17 hpf de développement embryonnaire et dure jusqu'à 24 hpf 10 .

Notre approche fournit aux chercheurs un outil pour étudier le système nerveux des embryons intacts, préservant la complexité des interactions entre les cellules dans un réseau fonctionnel en développement. L'imagerie in vivo des embryons de poisson zèbre a été réalisée en les immobilisant simplement par immersion dans de l'agarose à bas point de fusion. L'étude des changements dans le potentiel de la membrane cellulaire grâce à l'utilisation d'un biocapteur représente l'un des principaux avantages de cette méthode. Les approches électrophysiologiques canoniques, où les neurones doivent être physiquement accessibles en supprimant les tissus enveloppants 11 , sont procédurEs qui pourrait altérer les propriétés électriques des cellules examinées. En outre, l'approche biosensor basée sur FRET permet d'étudier les propriétés électriques cellulaires sans l'utilisation d'anesthésiques ( c'est-à-dire Tricaine, un bloqueur de canal de sodium), évitant toute perturbation potentielle associée à l'administration de produits chimiques ( c'est-à-dire le riluzole ici) Pourrait être crucial dans le plan expérimental. Cette méthode nous a permis de nous concentrer sur la modulation à la fois de l'activité électrique et de la fréquence des bobines spontanées de la queue, une réponse comportementale qui empêche, dans la plupart des cas, les enregistrements électrophysiologiques sans l'administration d'anesthésiques. Enfin, l'emploi des GEVI offre le contrôle expérimental temporel le plus élevé car il permet le travail à un stade de développement embryonnaire spécifique. Nos sessions d'imagerie / enregistrement ont duré une fenêtre de temps très limitée, ce qui nous permet de comparer précisément les étapes de développement des différents embryons en temps réel. ToutLes enregistrements électrophysiologiques conventionnels, au contraire, se déroulent habituellement dans des délais plus larges et moins précis.

Cependant, la mesure des changements de tension par des techniques d'imagerie est intrinsèquement difficile en raison de la nature du signal lui-même, qui peut varier en vitesse, en fréquence et dans la taille des changements de potentiel de membrane. Un capteur de tension idéal doit combiner une réactivité rapide, une sensibilité élevée et une émission élevée de photons. Pour la plupart des GEVI basés sur FRET, les variations de rapport varient en fonction des variations de tension de la membrane, mais l'amplitude des variations du rapport de fluorescence est étroitement associée à la durée des événements de dépolarisation. Récemment, de nouveaux GEVI ont été développés et caractérisés, ce qui permet de choisir la meilleure sonde par rapport au type de problème expérimental, au modèle et au dispositif d'imagerie.

Les biocapteurs de tension sont des protéines membranaires intégrales. Lorsqu'ils sont transfectés dans des cellules cultivées ou exprimésD dans les organismes vivants, la fluorescence du capteur localisé de la membrane plasmatique sera, dans une certaine mesure, associée à la fluorescence du capteur dans d'autres compartiments intracellulaires, où la protéine peut être mal définie ou agrégée, générant ainsi un signal d'arrière-plan. Le niveau d'expression et la localisation de la membrane appropriée de chaque construction doivent être surveillés dans des modèles expérimentaux simplifiés ( c'est-à-dire transfectant des lignées cellulaires ou des cultures primaires) avant d'utiliser les biocapteurs dans les organismes vivants.

Dans la configuration expérimentale actuelle, une autre étape critique potentielle du protocole pourrait être représentée par l'efficacité de la procédure de transgenèse. Si nécessaire, le pourcentage de cellules positives au plasmide peut être augmenté de manière drastique en utilisant le système de transposon Tol2 12 . Un aspect crucial supplémentaire qui doit être pris en compte est la perte d'émission de fluorescence dans le fluorophore donneur et la perte de FRET sigNal lors de la séance d'imagerie en raison de l'éclairage intense. Cela devrait être évité en minimisant l'illumination de l'échantillon, ce qui réduit la puissance de la ligne laser utilisée. De même, le gain et le décalage des photomultiplicateurs doivent être soigneusement accordés au début de chaque session d'enregistrement pour obtenir le meilleur rapport signal sur bruit dans les images acquises ainsi que pour éviter les pixels saturés. Tous ces paramètres peuvent varier en fonction du type de cellule examinée, des caractéristiques du biocapteur et des instruments utilisés pour l'acquisition d'images (les microscopes de fluorescence à large champ peuvent également être utilisés, comme décrit récemment 13 ). Le chercheur devrait toujours considérer, cependant, que pendant l'imagerie in vivo , le niveau de bruit pourrait interférer avec le signal spécifique du capteur plus que dans les enregistrements in vitro . Enfin, si disponible, les mesures de contrôle utilisant des sondes mutantes, qui ne répondent pas à la tension, seraient un moyen pratiquePour évaluer le niveau de bruit et / ou des artefacts spécifiques au système.

L'emploi d'embryons de poissons zèbres représente une caractéristique essentielle de cette approche grâce à leur réactivité à la manipulation génétique et à l'investigation microscopique. En fait, ces caractéristiques rendent possible la transgénèse transitoire et l'analyse par FRET des propriétés électriques neuronales. À notre avis, avec les combinaisons de promoteurs et de biocapteurs les mieux adaptés, il serait potentiellement possible d'analyser sélectivement l'activité électrique de tout type d'intérêt cellulaire et de paralyser cette activité avec le phénotype embryonnaire.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing Potentiel de membrane de neurones moteurs dans les embryons vivants de zébrés
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter