Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing potenziale del membrane del neurone del motore in embrioni di Zebrafish in tensione

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

L' analisi di componenti sistemica in vivo consente agli scienziati di indagare sul comportamento cellulare in modo più affidabile. Ciò è particolarmente vero quando l'attività sotto controllo è fortemente influenzata dalle interazioni delle cellule cellulari (sia a contatto che a contatto non dipendente), come nel sistema nervoso, dove la tensione della membrana cambia la comunicazione tra le cellule eccitabili. La comprensione delle informazioni codificate da questi segnali elettrici è la chiave per comprendere il modo in cui il sistema nervoso funziona sia negli stati fisiologici che nelle malattie.

Per studiare le proprietà elettriche delle cellule nelle condizioni fisiologiche non invasive, sono stati recentemente sviluppati diversi indicatori di tensione geneticamente codificati 1 . Contrariamente alle precedenti generazioni di sensori di tensione ottica (principalmente coloranti sensibili alla tensione) 2 , GEVI consentono analisi in vivo del sistema neurale intatto eLa loro espressione può essere limitata a specifici tipi di cellule o popolazioni.

L'embrione zebrafish è il "substrato" in vivo della scelta che sfrutta il grande potenziale attribuito ai GEVI. Infatti, grazie alla sua chiarezza ottica e al suo sistema nervoso semplificato ma evoluzionatamente conservato, il modello zebrafish consente la semplice identificazione e manipolazione di ogni componente cellulare in una rete. Infatti, l'impiego della GEET Mermaid 3 a base FRET ha portato all'identificazione di alterazioni pre-sintomatiche nel comportamento dei neuroni dei moti spinali in un modello zebrafish della sclerosi laterale amyotrofica (ALS) 4 .

Il seguente protocollo in vivo descrive come monitorare le proprietà elettriche dei neuroni del motore spinale in embrioni di zebrafish intatti che esprimono la Sirena in maniera specifica al neurone. Inoltre, dimostra come il farmaco farmacologicamente indottoIn tali proprietà elettriche può essere associato con alterazioni della frequenza delle bobine spontanee embrionali, l'attività stereotipica del motore che caratterizza il comportamento di movimento dei zebrafish in fasi molto avanzate di sviluppo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Generazione di plasmidi pHuC_Mermaid

NOTA: La sirena è un biosensore sviluppato accoppiando il dominio di tensione (VSD) della Ciona intestinalis (ora Ciona robusta ) 5 sensori di tensione contenenti fosfatasi (Ci-VSP) con i fluorofori partner FRET Umi-Kinoko Green (mUKG: donatore) e una versione monomerica della proteina fluorescente arancione Kusabira Orange (mKOk: accettore). Per questo biosensore, i cambiamenti conformazionali del dominio VSD, indotti dalla depolarizzazione della membrana, aumentano la prossimità delle proteine ​​fluorescenti donatori e accettore, aumentando così il trasferimento di energia tra di loro (aumentando il rapporto FRET) 3 . Il VSD assicura la localizzazione efficiente del biosensore alla membrana plasmatica. L'espressione neuronale del biosensore (nel midollo spinale, il segnale è rilevabile sia in interneuroni che nei neuroni motori) è ottenuta clonando la sirenaEn frame di lettura (ORF) sotto il promotore pan-neurale zebrafish HuC 6 .

  1. Amplificare con la reazione a catena polimerica (PCR) l'ORF della sirena dal plasmide 3 della sirena pCS4 + con la polimerasi di DNA Pfu (bozza) utilizzando il primer universale T3 e il primer sirena Sma I (5'TATCCCGGGATTCGACGGTTCAGATTTTA) per inserire un sito di restrizione SmaI a monte Della sirena ORF.
    1. Utilizzare la seguente miscela di PCR: 0,5 μL di DNA polimerasi di Pfu, 7,5 μL del buffer 10x specifico, 1 μL di dNTP 10 mM, 2,5 μL di dimetilsolfossido (DMSO), 0,5 μL (50 ng) del plasmide e 1 ΜL di soluzioni di stock di 20 μM di ogni primer in un volume totale di 50 μL.
    2. Riscaldare la miscela PCR per 15 s a 95 ° C, prelevarla per 15 s a 50 ° C e allungarla per 4 minuti a 72 ° C per un totale di 35 cicli.
  2. Gel-purifica la specifica puntaPCR utilizzando un kit di depurazione del gel commerciale, seguendo il protocollo del produttore.
  3. Clonare il frammento del DNA nel vettore blunt pCMV-SC seguendo il protocollo del produttore.
  4. Linearizzare il plasmide sirena-positivo (denominato pCMV-SC_Mermaid) con l'enzima di restrizione Sma I per il successivo inserimento del promotore HuC.
    1. Impostare la reazione di restrizione come segue: 0,5 μL (10 U) di enzima di restrizione SmaI, 2 μL del kit 10x tampone e 5 μg di DNA plasmidico in un volume totale di 20 μL. Incubare la reazione a 25 ° C per 1 ora.
  5. Gel-purifica il plasmide digerito usando un kit di depurazione del gel commerciale seguendo il protocollo del produttore.
  6. PCR amplifica il promotore HuC (pHuC), con DNA polimera Pfu DNA e DNA genomico zebrafish come template, utilizzando una coppia di primers HuC-specific (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA e HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) e che copre una regione di 3.150 bp a monte dell'ATG.
    1. Impostare la miscela PCR utilizzando il seguente schema: 0,5 μL di polimero DNA di Pfu, 7,5 μL del buffer 10x specifico, 1 μL di dNTP 10 mM, 2,5 μL DMSO, 200 ng di DNA genomico e 1 μL di 20 μM Soluzioni di ciascun primer in un volume totale di 50 μL.
    2. Dopo una fase iniziale di 2 minuti a 95 ° C, scaldare la miscela PCR per 15 s a 95 ° C, prelevare per 15 s a 50 ° C e allungarlo per 4 min a 72 ° C per un totale di 35 cicli .
  7. Gel-purifica il prodotto specifico blunt PCR usando un kit di depurazione del gel commerciale seguendo il protocollo del produttore.
  8. Si lega una quantità equimolare della pCMV-SC_Mermaid purificata (fase 1.5) e del pHuC DNA (fase 1.7) usando 1 μL di ligasi del DNA T4 e 1 μl del buffer specifico 10X in un volume totale di 10 μL. Incubare la reazione per 16 ore a4 ° C.
  9. Trasformare una aliquota di cellule competenti con 5 μL di reazione di legatura (passo 1.8) seguendo le istruzioni del produttore.
  10. Selezionare i cloni pHuC-positive (pHuC_Mermaid) con il promotore inserito nel giusto orientamento mediante una doppia digestione Sal I- Eco RV (il sito di restrizione Sal I è stato inserito a monte del frammento promotore nel passaggio 1.6 mentre il sito di restrizione Eco RV È posizionata a valle della regione di poliadenilazione, PolyA, del plasmid pCMV-SC).
    1. Impostare la reazione di restrizione come segue: 0,5 μL (10 U) di entrambi gli enzimi di restrizione Sal I e Eco RV, 2 μL del tampone kit10X e 1 μg di pHuC_Mermaid DNA in un volume totale di 20 μL. Incubare la reazione a 37 ° C per 1 ora. Eseguire le reazioni su un gel agarosio.

2. Microinjection dell'embrione

  1. Trasferire il fertilizzato, ad esempioGs ottenuti da ceppi selvatici (AB strain) o Sod1-G93R zebrafish adulti 4 ad un piatto di Petri da 10 mm utilizzando una pipetta di plastica.
  2. Sciacquare gli embrioni in acqua fredda (4 ° C) e immediatamente microiniziarli nel tuorlo con 200 pg di pluuro di pHuC_Mermaid utilizzando un microinjector (per una descrizione generale e dettagliata della procedura di microinjection, vedere Riferimenti 7 e 8).
  3. Usando una pipetta di plastica, trasferire gli embrioni in un piatto di Petri e incubarli in acqua di pesce a 28 ° C fino a raggiungere la fase di sviluppo desiderata (20-24 ore dopo la fertilizzazione, hpf) per le seguenti analisi.

3. Analisi spontanea del coil di coda

NOTA: Valutare il comportamento di coil spontaneo della coda negli embrioni da 20-24 hlf con o senza il riluzolo di farmaco.

  1. Trasferire un embrione in un piatto di Petri da 90 mm riempito con acqua di pesce contenente 0,2% DMSO (veicolo riluzolo) e manualmente dechorionate usando twO pinze di gioielliere con punte taglienti. Incubare l'embrione per 5 min.
  2. Rileva la bobina di coda in RT durante una registrazione video di 1 min usando una fotocamera digitale montata su uno stereomicroscopio. Acquisizione di serie temporali a una risoluzione di 30 fotogrammi / s.
  3. Calcolare la frequenza delle bobine di coda spontanee contando il numero di curve (sia contralaterali che ipsilaterali) per unità di tempo.
  4. Per valutare l'effetto del riluzolo di farmaco, utilizzare delicatamente una pipetta di Pasteur plastica per trasferire l'embrione in un nuovo piatto di Petri da 90 mm riempito con acqua di pesce contenente 5 μM riluzolo.
    1. Incubare l'embrione per 5 minuti prima di registrare un video di 1 minuto e eseguire l'analisi comportamentale come sopra.

4. Imaging per la visualizzazione di Mermaid Biosensor in embrioni viventi: rilevazione simultanea dei segnali di donatore e ricevente

  1. Montare gli embrioni da 20 a 24 hpf in agarosio a basso punto di fusione dell'1% nell'acqua di pesce a37 ° C all'interno di un piatto da 35 mm di imaging di vetro. Orientare gli embrioni sui loro lati. Attendere che l'agarosio si solidifichi a temperatura ambiente.
  2. Trasferire il piatto di imaging allo stadio di un confocale invertito montato su un microscopio invertito. Identificare i neuroni dei motori che esprimono il biosensore con un obiettivo 20X (0,7 apertura numerica, NA) emozionando il mUKG con la linea laser a 488 nm di argon e registrando le sue emissioni tra 495 e 525 nm.
  3. Per una misura FRET, eccitate mUKG, donatore della coppia FRET, con la linea laser 488 nm. Rilevare contemporaneamente, con uno scanner a risonanza a 8000 Hz in modalità bidirezionale, la fluorescenza emessa dal donatore (fra 495 e 525 nm) e la fluorescenza emessa dall'accettatore mKOk (tra 550 e 650 nm, canale FRET). Se disponibile, utilizzare il laser da 473 nm.
    NOTA: L'efficienza di eccitazione del donatore sarà leggermente ridotta (85% invece del 93% con 488 nm), ma la eccitazione incrociata dell'acceptore(Dal 17% con il 488 nm al 9% con linea laser 473 nm).
  4. Per ridurre la fototossicità e lo sbiancamento dei fluorofori, minimizzare l'illuminazione del campione riducendo la potenza della linea laser (sulla finestra del fascio del software di acquisizione).
  5. Ottimizzare l'eccitazione per abbinare i parametri di guadagno e di offset impostati all'inizio dell'esperimento e mantenuti costanti durante la sessione. Per impostare l'offset, modificare il colore dell'immagine ai valori di intensità (utilizzando la tabella di ricerca Q) e, durante la scansione con il laser spento, ruotare la manopola offset (smart offset) in modo che i pixel di sfondo abbiano un'intensità leggermente Superiore a zero. Con la stessa tabella di ricerca, attivando il laser durante la scansione, ruotare la manopola di guadagno (guadagno intelligente) per ottimizzare il rapporto segnale / rumore, facendo attenzione a evitare pixel saturi.
  6. Utilizzando un foro aperto (2 unità ariose), acquisire immagini a 16 bit per fornire una gamma dinamica sufficiente per il quantitativoE analizza. Evitate di aumentare la velocità di acquisizione e ridurre al minimo la fotopolimerizzazione.
  7. Nella finestra Acquisizione software, selezionare una dimensione del campo immagine di 512 x 64 pixel (dimensione pixel: 605 nm) dal menu a discesa.
  8. Dalla finestra del modo di acquisizione, selezionare xyt (tempo trascorso su un solo piano xy) f rom dal menu a discesa e registrare le variazioni della tensione neuronale spinale embrionale acquisendo un solo piano xy, impostando i parametri di acquisizione per registrare un'immagine ogni 30 Ms per 1 min.
  9. Per valutare l'effetto della somministrazione del riluzolo sulla depolarizzazione della membrana nello stesso neurone, acquisire un nuovo set di dati 5 min dopo l'aggiunta di acqua di pesce contenente 5 μM riluzolo.
  10. Per l'analisi FRET, utilizzare la macro ImageJ Biosensor_FRET (esprimendo biosensori FRET a catena singola.
  11. Valutare il rapporto FRET di membrana basale di ogni neurone a t 1 come ((FRET background - FRET background) / (Donatore medio - Donator background)), dove FRET e DonO l'intensità media è l'intensità media di fluorescenza calcolata nella stessa regione di interesse (ROI) attirata intorno alla cella per ogni canale acquisito e lo sfondo FRET e Donatore è l'intensità media di fluorescenza calcolata in un ROI del campo visivo senza il campione fluorescente.
    NOTA: Una descrizione dettagliata dettagliata dell'utilizzo del plugin può essere trovata sul sito www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Utilizza un software di grafica per confrontare la frequenza, l'ampiezza e la durata della depolarizzazione tra diversi paradigmi sperimentali. Confronti due gruppi usando un t- test di Student unpaired e considerate i valori medi statisticamente diversi quando P <0.05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Un vettore di espressione che trasporta la sequenza di codifica biosensore di Mermaid a base FRET sotto il controllo del promotore pan-neuronale di pHuC, che guida la sintesi della proteina esclusivamente nel sistema nervoso, è stata consegnata in uova fecondate a cellule singole mediante una microinezione in Per ottenere embrioni transgenici transitori ( Figura 1 , Pannello sinistro). Dopo aver masterizzato la tecnica di microinjection, la percentuale di embrioni positive di sirena era quasi al 100%. Tra questi, sono stati considerati solo gli embrioni che esprimevano la giusta quantità di biosensore di Mermaid alla membrana plasmatica per l'analisi FRET / acquisizione di immagini.

Le bobine spontanee, le risposte del motore che consistono esclusivamente in una contrazione completa del corpo che portano la punta della coda alla testa 9 , 10 , sono state registrate nella fase di 20-24 hpf nel mezzo di pesce regolare ( Figura 1 , pannello centrale e Video 1 ) e successiva incubazione in 5 μM riluzole ( Video 2 ). Le analisi statistiche delle variazioni nella frequenza delle spire spontanee di coda innescate dal riluzolo di droga sono riportate altrove 4 .

Per verificare se le alterazioni dell'attività elettrica dei neuroni del motore spinale erano alla base dei cambiamenti indotti dal riluzolo nella frequenza di coilazione spontanea, il potenziale di membrana nei neuroni motori spinali embrionali è stato studiato in modo non invasivo, misurando l'intensità di fluorescenza Rapporto del donatore / accettore FRET coppia del biosensore Mermaid (rapporto FRET: Figura 1 , pannello destro). Sono stati identificati i neuroni del motore spinale primario che esprimono il biosensore ( Figura 2A ) e sono state registrate le loro attività basali di depolarizzazione spontanea ( Ng> Figura 2B e Video 3 e 4 ). Insieme alla riduzione della frequenza dei movimenti di avvolgimento della coda, l'amministrazione riluzole ha ridotto la frequenza degli eventi di depolarizzazione spontanea ( Figura 2C ).

Figura 1
Figura 1: Diagramma di flusso della procedura sperimentale. Gli embrioni a fase singola vengono raccolti e immediatamente microinettati con il plasmide di pHuC_Mermaid per esprimere il biosensore di FRET a sirena in modo pan-neuronale. A 20-24 CVf con incubazione a 28 ° C, singoli embrioni vengono trasferiti sotto uno stereomicroscopio e la loro attività di coil spontanea della coda, con e senza il riluzolo della droga presenti nell'acqua di pesce, viene registrata e analizzata. Gli stessi embrioni sono sottoposti ad analisi FRET in vivo per misurare i cambiamenti nel potenziale dei motori neuronali.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Fare clic qui per visualizzare una versione più grande di questa figura.

figura 2
Figura 2: Analisi in vivo FRET per misurare i cambiamenti nel potenziale dei membrani del neurone motore. ( A ) Embrioni di tipo selvaggio di zebrafish con l'espressione mosaica del biosensore di tensione FRET-based Mermaid nel neurone spinale. (A) L'immagine del campo luminoso mostra l'area del tronco dello zebra identificato dalla scatola nera (sc: midollo spinale; ms: myoseptum; m: myotome). Superando (a) il segnale di fluorescenza rilevato (b), l'espressione efficace del biosensore in un neurone del motore spinale primario (PM) può essere chiaramente visualizzata. Il donatore (c) e il canale FRET (d) rilevati sono mostrati con le rispettive tavole di ricerca verde e magenta (LUT)dal lato giusto. Tutti gli embrioni sono montati in un orientamento cranico-caudale. Barra di scala = 10 μm. ( B ) La mappa del rapporto FRET visualizza il rapporto FRET calcolato ogni 0,03 s nello stesso neurone del motore. Essa mostra l'attività di depolarizzazione spontanea basale che la cellula subisce. Per il biosensore di sirena, l'aumento del rapporto FRET si verifica quando il potenziale della membrana aumenta. Barra di scala = 10 μm. ( C ) Esempio rappresentativo delle variazioni di rapporto FRET medio spontaneo che si verificano in un neurone del motore spinale di un embrione di zebrafish di Sod1-G93R durante una registrazione di 1 min. La somministrazione di Riluzole riduce la frequenza delle depolarizzazioni spontanee. Clicca qui per visualizzare una versione più grande di questa figura.

Film 1
Movie 1:Coda spontanea avvolgente in 24-hpf Wild-type control Embrioni. Registrazione rappresentativa che mostra cofanatura spontanea di coda in un embrione di controllo di tipo selvaggio da 24 hpf incubato nell'acqua di pesce. Clicca qui per visualizzare questo video. (Fare clic con il pulsante destro del mouse per scaricare.)

Film 2
Film 2: Coda spontanea della coda in embrioni trattati con riluzole Wild-type a 24-hpf . La registrazione rappresentativa che mostra la coonatura spontanea di coda in un embryo di controllo di tipo selvatico a 24 hpf incubato in riluzolo (+ R) di 5 μM. Rispetto ai controlli, gli embrioni + R hanno mostrato una significativa diminuzione della frequenza di comportamento coil spontaneo di coda a 24 hpf. Clicca qui per visualizzare questo video. (RigHt-click per scaricare.)

Film 3
Film 3: attività basale di depolarizzazione spontanea di un neurone motore primario nel midollo spinale di un tipo di selvaggio zebrafish embryo a 20 hpf. Il biosensore di sirena è così sensibile che può rilevare i rapidi cambiamenti nel potenziale di membrana dei motori neuronali nelle corde spinali di embrioni intatti. Clicca qui per visualizzare questo video. (Fare clic con il pulsante destro del mouse per scaricare.)

Film 4
Film 4: L'attività di depolarizzazione spontanea è accoppiata alla contrazione muscolare. Un neurone del motore secondario nel midollo spinale di un embrione zebrafish a tipo selvatico a 20 hpf subisce depolarizzazione spontanea. In questo caso, ogni deLa polarizzazione è associata a una contrazione dei muscoli dello zebrafish, organizzata in un sincitio sincronizzato funzionalmente in questa fase di sviluppo. Clicca qui per visualizzare questo video. (Fare clic con il pulsante destro del mouse per scaricare.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il protocollo qui presentato ci ha consentito di esplorare l'associazione tra le proprietà elettriche dei neuroni dei motori spinali embrionali zebrafish e il comportamento spintaneo di avvolgimento, la prima attività motoria stereotipica, che si presenta intorno a 17 hpf di sviluppo embrionale e dura fino a 24 hpf 10 .

Il nostro approccio offre ai ricercatori uno strumento per studiare il sistema neurale di embrioni intatti, mantenendo pienamente la complessità delle interazioni tra le cellule in una rete funzionale in via di sviluppo. L'imaging in vivo degli embrioni zebrafish è stato eseguito semplicemente immobilizzandoli attraverso l'immersione in agarosio a bassa percentuale di fusione. Lo studio dei cambiamenti nel potenziale della membrana cellulare attraverso l'uso di un biosensore rappresenta uno dei principali vantaggi di questo metodo. Gli approcci elettrofisiologici canonici, dove i neuroni devono essere accessibili fisicamente rimuovendo i tessuti avvolgenti 11 , sono procedureChe potrebbero alterare le proprietà elettriche delle cellule in esame. Inoltre, l'approccio biosensore basato su FRET consente di studiare le proprietà elettriche delle cellule senza l'uso di anestetici ( cioè Tricaine, un bloccatore di canali di sodio), evitando ogni potenziale disturbo associato alla somministrazione di sostanze chimiche ( ovvero riluzole qui) Potrebbe essere cruciale nel piano sperimentale. Questo metodo ci ha consentito di concentrarsi sulla modulazione sia dell'attività elettrica che della frequenza delle spire spontanee di coda, una risposta comportamentale che impedisce, nella maggior parte dei casi, registrazioni elettrofisiologiche senza la somministrazione di anestetici. Infine, l'impiego di GEVI offre il più alto controllo sperimentale temporale perché consente di lavorare in una fase specifica di sviluppo embrionale. Le nostre sessioni di imaging / registrazione hanno spianato una finestra temporale molto limitata, che ci permette di confrontare con precisione le fasi di sviluppo dei vari embrioni in tempo reale. TuttiLe registrazioni elettrofisiologiche convenzionali, al contrario, sono di solito condotte in tempi più grandi e meno precisi.

La misurazione delle variazioni di tensione tramite tecniche di imaging è però intrinsecamente difficile a causa della natura del segnale stesso, che può variare in velocità, frequenza e dimensioni delle variazioni nel potenziale della membrana. Un sensore di tensione ideale dovrebbe combinare la risposta veloce, l'alta sensibilità e l'emissione di fotoni elevati. Per la maggior parte dei GEVI a base di FRET, i cambi di rapporto variano in funzione delle variazioni di tensione della membrana, ma l'ampiezza dei cambi di rapporto di fluorescenza è strettamente associata alla durata degli eventi di depolarizzazione. Recentemente, sono stati sviluppati e caratterizzati nuovi GEVI, consentendo così di scegliere la migliore sonda rispetto al tipo di dispositivo sperimentale, modello e imaging.

I biosensori di tensione sono proteine ​​integrali a membrana. Quando si trasfetta in cellule colte o si esprimeD in organismi viventi, la fluorescenza del sensore localizzato a membrana plasmatica sarà in una certa misura associata alla fluorescenza del sensore in altri compartimenti intracellulari dove la proteina può essere mislocalizzata o aggregata generando così un segnale di fondo. Il livello di espressione e la corretta localizzazione della membrana di ciascun costrutto dovrebbero essere monitorati in modelli sperimentali semplificati ( cioè transfettando linee cellulari o colture primarie) prima di utilizzare i biosensori negli organismi viventi.

Nell'attuale configurazione sperimentale, un'altra potenziale fase critica del protocollo potrebbe essere rappresentata dall'efficienza della procedura di transgenesi. Se necessario, la percentuale di cellule plasmide positive può essere drasticamente aumentata impiegando il sistema di trasposone Tol2. Un ulteriore aspetto cruciale che deve essere considerato è la perdita di emissione di fluorescenza nel fluoroforo donatore e la perdita di FRET sigNal durante la sessione di imaging a causa dell'intensa illuminazione. Questo dovrebbe essere evitato minimizzando l'illuminazione del campione riducendo la potenza della linea laser utilizzata. Allo stesso modo, il guadagno e l'offset dei fotomoltiplicatori devono essere accuratamente sintonizzati all'inizio di ogni sessione di registrazione per ottenere il miglior rapporto segnale-rumore nelle immagini acquisite oltre che per evitare pixel saturi. Tutti questi parametri possono variare a seconda del tipo di cellula esaminata, delle caratteristiche del biosensore e degli strumenti utilizzati per l'acquisizione di immagini (possono anche essere utilizzati microscopi a fluorescenza ad ampio campo, come descritto di recente 13 ). Il ricercatore deve sempre considerare che durante l' imaging in vivo il livello di rumore potrebbe interferire con il segnale specifico del sensore più che con le in vitro registrazioni. Infine, se disponibili, le misure di controllo usando sonde mutanti, che non rispondono alla tensione, sarebbero un modo convenientePer valutare il livello di rumore e / o artefatti specifici del sistema.

L'impiego di embrioni di zebrafish rappresenta una caratteristica fondamentale di questo approccio grazie alla loro risposta alla manipolazione genetica e all'indagine microscopica. In effetti, queste caratteristiche rendono possibile transgenesi transitoria e l'analisi FRET-based delle proprietà elettriche neuronali. A nostro avviso, con le migliori combinazioni di promozionali e biosensori, sarebbe potenzialmente possibile analizzare in modo selettivo l'attività elettrica di qualsiasi tipo di interesse cellulare e parallela a tale attività con il fenotipo embrionale.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing potenziale del membrane del neurone del motore in embrioni di Zebrafish in tensione
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter