Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing Motor Neuron Membran Potensial i Live Zebrafish Embryoer

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

In vivo systemisk komponentanalyse tillater forskere å undersøke cellulær oppførsel på den mest pålitelige måten. Dette gjelder særlig når aktiviteten under kontroll er sterkt påvirket av celle-celle-interaksjoner (både kontakt- og ikke-berøringsavhengig), som i nervesystemet, hvor membranspenningsendringer driver kommunikasjonen mellom spennende celler. Forståelsen av informasjonen som kodes av disse elektriske signaler er nøkkelen til å forstå hvordan nervesystemet virker i både fysiologiske og sykdomstilstander.

For å studere celle elektriske egenskaper i de mest ikke-invasive fysiologiske forholdene, er flere genetisk kodede spenningsindikatorer nylig utviklet 1 . I motsetning til tidligere generasjoner av optiske spenningssensorer (hovedsakelig spenningsfølsomme farger) 2 , tillater GEVIs in vivo analyser av det intakte nevrale systemet, ogDeres uttrykk kan begrenses til bestemte celletyper eller populasjoner.

Zebrafish-embryoet er valget av in vivo "substrat" ​​for å dra nytte av det store potensialet som tilskrives GEVIs. Faktisk, takket være den optiske klarheten og det forenklede, men evolusjonært konserverte nervesystemet, tillater sebrafiskmodellen enkel identifisering og manipulering av hver mobilkomponent i et nettverk. Faktisk har ansettelsen av den FRET-baserte GEVI Mermaid 3 ført til identifisering av pre-symptomatiske endringer i spinalmotor-neuronadferd i en sebrafiskmodell av amyotrofisk lateralsklerose (ALS) 4 .

Følgende in vivo- protokoll beskriver hvordan man overvåker de elektriske egenskapene til spinalmotorneuroner i intakte zebrafiskembryoer som uttrykker havfrue på en nevron-spesifikk måte. Videre demonstrerer det hvordan farmakologisk indusert chanGes i slike elektriske egenskaper kan være forbundet med endringer i hyppigheten av embryonale spontane spoler, den stereotypiske motoraktiviteten som karakteriserer bevegelsesadferden til sebrafisken i svært tidlige utviklingsstadier.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plasmid Generation

MERK: Mermaid er en biosensor utviklet ved å kombinere spenningssensoren (VSD) av Ciona intestinalis (nå Ciona robusta ) 5 spenningssensor som inneholder fosfatase (Ci-VSP) med FRET-partneren fluorophores Umi-Kinoko Green (mUKG: donor) og en monomerversjon av det oransje-emitterende fluorescerende proteinet Kusabira Orange (mKOk: acceptor). For denne biosensoren, øker konformasjonelle endringer av VSD-domenet, fremkalt av membran depolarisering, nærheten til donor- og akseptor-fluorescerende proteiner, og øker dermed overføringen av energi mellom dem (øker FRET-forholdet) 3 . VSD sikrer effektiv lokalisering av biosensoren ved plasmamembranen. Nerveuttrykket av biosensoren (i ryggmargen, signalet er detekterbart i både interneuroner og motorneuroner) oppnås ved å klone havfruen opEn leseramme (ORF) under den zebrafisk-pan-neurale promotoren HuC 6 .

  1. Amplifiser ved hjelp av T3 Universal Primer og Mermaid Sma I primeren (5'TATCCCGGGATTCGACGGTTCAGATTTTA) ved polymerase kjedereaksjon (PCR) Mermaid ORF fra pCS4 + Mermaid plasmidet 3 med Pfu (korrekturlesende) DNA polymerase for å sette inn et Sma I restriksjonssted oppstrøms Av havfruen ORF.
    1. Bruk følgende PCR-blanding: 0,5 μl Pfu DNA-polymerase, 7,5 μl av den spesifikke 10x buffer, 1 μl 10 mM dNTP, 2,5 μl dimetylsulfoksid (DMSO), 0,5 μl (50 ng) av plasmidpreparatet og 1 ΜL 20 μM stamløsninger av hver primer i et totalt volum på 50 μl.
    2. Varm PCR-blandingen i 15 s ved 95 ° C, prik den i 15 s ved 50 ° C og forleng den i 4 minutter ved 72 ° C i totalt 35 sykluser.
  2. Gel-rense den spesifikke stumpenPCR-produkt ved bruk av et kommersielt gelrensingssett, etter produsentens protokoll.
  3. Klon DNA-fragmentet i pCMV-SC-stum vektoren i henhold til produsentens protokoll.
  4. Lineariserer havfrue-positive plasmidet (kalt pCMV-SC_Mermaid) med Sma I-restriksjonsenzymet for følgende innsetting av HuC-promotoren.
    1. Sett opp restriksjonsreaksjonen som følger: 0,5 μL (10 U) Sma I-restriksjonsenzym, 2 μl av kit 10x buffer og 5 μg plasmid-DNA i et totalt volum på 20 μl. Inkuber reaksjonen ved 25 ° C i 1 time.
  5. Gel-rense det fordøyede plasmidet ved hjelp av et kommersielt gelrensingssett etter produsentens protokoll.
  6. PCR-amplifiserer HuC-promotoren (pHuC), med Pfu DNA-polymerase og zebrafisk-genomisk DNA som mal, ved bruk av et par HuC-spesifikke primere (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA og HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) og spenner over en 3,150-bp-region oppstrøms for ATG.
    1. Sett opp PCR-blandingen ved hjelp av følgende skjema: 0,5 μl Pfu DNA-polymerase, 7,5 μl av den spesifikke 10x buffer, 1 μl 10 mM dNTP, 2,5 μl DMSO, 200 ng genomisk DNA og 1 μl 20 μM Lagerløsninger av hver primer i et totalt volum på 50 μl.
    2. Etter et første trinn på 2 minutter ved 95 ° C oppvarmes PCR-blandingen i 15 s ved 95 ° C, prime den i 15 s ved 50 ° C og forleng den i 4 minutter ved 72 ° C i totalt 35 sykluser .
  7. Gel-rens det spesifikke, stumpe PCR-produktet ved hjelp av et kommersielt gelrensingssett etter produsentens protokoll.
  8. Liger en ekvimolær mengde av den rensede pCMV-SC_Mermaid (trinn 1.5) og pHuC-DNA'et (trinn 1.7) ved bruk av 1 μl T4 DNA ligase og 1 μl av den spesifikke 10X buffer i et totalt volum på 10 μl. Inkuber reaksjonen i 16 timer ved4 ° C.
  9. Transform en alikvot av kompetente celler med 5 μl av ligeringsreaksjonen (trinn 1.8) etter produsentens instruksjoner.
  10. Velg de pHuC-positive klonene (pHuC_Mermaid) med promotoren satt inn i riktig orientering ved hjelp av en Sal I- Eco RV doble fordøyelse ( Sal I restriksjonsstedet er blitt satt inn oppstrøms for promotorfragmentet i trinn 1.6, mens Eco RV restriktionsstedet Er plassert nedstrøms for polyadenyleringsområdet, PolyA, av pCMV-SC-plasmidet).
    1. Sett opp restriksjonsreaksjonen som følger: 0,5 μL (10 U) av både Sal I- og Eco RV-restriksjonsenzymer, 2 μl av kit10X-bufferen og 1 μg pHuC_Mermaid DNA i et totalt volum på 20 μl. Inkuber reaksjonen ved 37 ° C i 1 time. Kjør reaksjonene på en agarosegel.

2. Embryo Microinjection

  1. Overfør den befruktede f.eksGs oppnådd fra villtype (AB-stamme) eller Sod1-G93R voksenzebrafisk 4 til en 10 mm petriskål med en plastpipett.
  2. Skyll embryoene i kaldt (4 ° C) fiskevann og umiddelbart mikroinjiser dem i eggeplommen med 200 pg pHuC_Mermaid plasmid ved hjelp av en mikroinjektor (for en samlet og detaljert beskrivelse av mikroinjeksjonsprosedyren, se Referanser 7 og 8).
  3. Bruk en plastpipett, overfør embryoer til en petriskål og inkuber dem i fiskevann ved 28 ° C til de når det ønskede utviklingsstadiet (20-24 timer etter befruktning, hpf) for følgende analyser.

3. Spontan haleanalyse

MERK: Evaluer den spontane halevekslingsadferdigheten i 20-24 hpf-embryoer med eller uten medikamentriluzol.

  1. Overfør et embryo til en 90 mm rund petriskål fylt med fiskevann inneholdende 0,2% DMSO (riluzole kjøretøy) og manuelt dechorionate det ved hjelp av toO gullsmeder med tynne tips. Inkubér embryoen i 5 minutter.
  2. Oppdag haleutviklingen ved RT under et 1 min videoopptak ved hjelp av et digitalkamera montert på et stereomikroskop. Oppnå tidsserier ved en tidsoppløsning på 30 bilder / s.
  3. Beregn frekvensen av spontane hale-spoler ved å telle antall bøyer (både kontralaterale og ipsilaterale) per tidsenhet.
  4. For å evaluere effekten av stoffet riluzole, bruk forsiktig en plast Pasteur pipette for å overføre embryoet til en ny 90 mm petriskål fylt med fiskevann inneholdende 5 μM riluzole.
    1. Inkubér embryoet i 5 minutter før du tar opp en 1 min-video og utfører atferdsanalysen som ovenfor.

4. Imaging Setup for Mermaid Biosensor Visualisering i Living Embryos: Samtidig Deteksjon av Donor og Acceptor Signaler

  1. Monter 20-24 hpf-embryoene i 1% lavmeltende agarose i fiskevann på37 ° C inne i en 35 mm glassbunnsbilledskål. Sett embryoer på deres sider. Vent til agarosen stivner ved romtemperatur.
  2. Overfør billedretten til scenen av en invertert konfokal montert på et invertert mikroskop. Identifiser motorneuroner som uttrykker biosensoren med et 20X objektiv (0,7 numerisk blenderåpning, NA) ved å spenne mUKG med 488 nm argonlaserlinjen og registrere opptaket mellom 495 og 525 nm.
  3. For en FRET-måling, beundre mUKG, giveren til FRET-paret, med 488 nm laserlinjen. Samtidig oppdager, med en resonansskanner som opererer ved 8000 Hz i toveismodus, fluorescensen som sendes ut av giveren (mellom 495 og 525 nm) og fluorescensen som utløses av mKOk-akseptoren (mellom 550 og 650 nm, FRET-kanalen). Hvis tilgjengelig, bruk 473 nm laseren.
    MERK: Spenningsvirkningsgraden av giveren vil bli litt redusert (85% i stedet for 93% med 488 nm), men kryss-excitasjonen av akseptoren vilOgså redusert (fra 17% med 488 nm til 9% med 473 nm laserlinje).
  4. For å redusere fototoksisitet og fluoroforeblegning, minimere belysningen av prøven ved å redusere laserkraften (på strålebanevinduet i oppkjøpsprogramvaren).
  5. Optimaliser eksitering for å matche gevinst og forskyvningsparametere som er angitt i begynnelsen av eksperimentet og holdt konstant gjennom hele økten. For å angi forskyvningen, endrer du fargene på bildet til intensitetsverdiene (ved hjelp av Q oppslagstabellen) og, mens du skanner med laseren, setter du offsetknappen (smart offset) slik at bakgrunnspikslene har en intensitet litt Høyere enn null. Med samme oppslagstabell, ved å bytte laseren på mens du skanner, snu forsterkningsknappen (smart forsterkning) for å maksimere signal / støyforholdet, vær forsiktig så du unngår mettede piksler.
  6. Ved å bruke et åpent tapphull (2 luftige enheter), kjøp 16-biters bilder for å gi et tilstrekkelig dynamisk område for kvantitativE analyser. Unngå gjennomsnittsnivå for å øke oppkjøpshastigheten og for å minimere fotoblekking.
  7. Velg en bildefeltstørrelse på 512 x 64 piksler (pikselstørrelse: 605 nm) i rullegardinmenyen i programvareoppkjøpsvinduet.
  8. Fra oppkjøpsmodusvinduet, velg xyt (tidsforløp på et enkelt xy-plan) f rom rullegardinmenyen og registrer endringene i embryo-spinalnervespenning ved å anskaffe et enkelt xy-plan, og angi oppkjøpsparametrene for å ta opp ett bilde hver 30 Ms i 1 min.
  9. For å evaluere effekten av riluzoladministrasjon på membran depolarisering i samme neuron, oppkjøp et nytt datasett 5 min etter tilsetning av fiskvann inneholdende 5 μM riluzole.
  10. For FRET analyse, bruk ImageJ makro Biosensor_FRET (uttrykke single-chain FRET biosensorer.
  11. Evaluer basalmembran-FRET-forholdet for hver neuron ved t 1 som ((FRET-middel - FRET-bakgrunn) / (Donormiddel - Donorbakgrunn)), hvor FRET og DonEller gjennomsnittlig intensitet er den gjennomsnittlige fluorescensintensiteten beregnet i samme region av interesse (ROI) trukket rundt cellen for hver kanal som er ervervet, og FRET og Donor-bakgrunnen er den gjennomsnittlige fluorescensintensiteten beregnet i et ROI i synsfeltet uten fluorescensprøven.
    MERK: En detaljert trinnvis beskrivelse av bruken av pluginet finner du på www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret nettsiden.
  12. Bruk en grafisk programvare for å sammenligne frekvens, amplitud og varighet av depolarisering mellom ulike eksperimentelle paradigmer. Sammenlign to grupper ved hjelp av en uparget Student's t- test og vurder middelverdiene som statistisk forskjellig når P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En ekspresjonsvektor som bærer den FRET-baserte Mermaid-biosensorkoding sekvensen under kontroll av pHuC pan-neuronal promoteren, som driver syntesen av proteinet utelukkende i nervesystemet, ble levert inn i enkeltcellede befruktede egg ved hjelp av en mikroinjeksjon i For å få transiente transgene embryoer ( figur 1 , Venstre panel). Etter mastering av mikroinjeksjonsteknikken var prosentandelen av havfrue-positive embryoer nær 100%. Blant disse ble bare embryoene som uttrykte riktig mengde Mermaid biosensor ved plasmamembranen vurdert for FRET analyse / bildeoppkjøp.

Spontane spoler, motorresponser som utelukkende består av en full body sammentrekning som bringer spissen av halen til hodet 9 , 10 , ble registrert på scenen på 20-24 hpf i vanlig fiskemedium ( Figur 1 , senterpanel og Video 1 ) og etter inkubering i 5 μM riluzole ( Video 2 ). De statistiske analysene av endringene i frekvensen av spontane hale-spoler som utløses av stoffet riluzol, rapporteres andre steder 4 .

For å teste om endringer i den elektriske aktiviteten til spinalmotorneuronene var på grunnlag av de riluzol-induserte forandringene i den spontane spiralfrekvensen, ble membranpotensialet i embryo-spinalmotorneuroner studert på en ikke-invasiv måte, måling av fluorescensintensiteten Forholdet mellom donor / akseptor FRET-paret av Mermaid biosensoren (FRET-forholdet: Figur 1 , høyre panel). Primær spinalmotorneuroner som uttrykker biosensoren, ble identifisert ( figur 2A ) og deres basale spontane depolariseringsaktiviteter ble registrert ( Ng> Figur 2B og Video 3 og 4 ). Sammen med reduksjonen i frekvensen av halevekslingsbevegelser, reduserte riluzoladministrasjonen frekvensen av spontane depolariseringshendelser ( figur 2C ).

Figur 1
Figur 1: Flytdiagram av eksperimentell prosedyre. Enkeltcelle-stadige embryoer samles og umiddelbart mikroinjiseres med pHuC_Mermaid-plasmidet for å uttrykke Mermaid FRET-spenningsbiosensoren på en pan-neuronal måte. Ved 20-24 hpf med inkubering ved 28 ° C overføres enkelte embryoer under et stereomikroskop, og deres spontane hale-spoleaktivitet, med og uten medikamentriluzol tilstede i fiskevannet, blir videoopptatt og analysert. De samme embryoer gjennomgår in vivo FRET-analyse for å måle endringer i motorneuronmembranpotensial.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2
Figur 2: In vivo FRET analyse for å måle endringer i motor neuron membran potensial. ( A ) Wild-type zebrafiskembryoer med mosaikkuttrykket av FRET-basert spenningsbiosensor Mermaid i spinalnervene. (A) Det lyse feltbildet viser området til zebrafiskstammen identifisert av den svarte boksen (sc: ryggmargen, ms: myoseptum, m: myotom). Ved å superimposere på (a) fluorescenssignalet detektert (b), kan det effektive uttrykket av biosensoren i en primær spinalmotorneuron (PM) tydeligvis visualiseres. Donoren (c) og FRET (d) kanalen oppdaget vises med de respektive grønne og magenta oppslagstabellene (LUT)på høyre side. Alle embryoer er montert i kranial-til-caudal orientering. Skalbjelke = 10 μm. ( B ) FRET-forholdskartet viser FRET-forholdet beregnet hver 0.03 s i samme motorneuron. Det viser den basale spontane depolariseringsaktiviteten som cellen gjennomgår. For Mermaid biosensoren oppstår økningen i FRET-forholdet når membranpotensialet øker. Skalbjelke = 10 μm. ( C ) Representativt eksempel på spontane gjennomsnittlige FRET-forholdsendringer som forekommer i en spinalmotorneuron av et Sod1-G93R sebrafiskembryo i løpet av 1 mins opptak. Riluzole-administrasjon reduserer frekvensen av spontane depolariseringer. Vennligst klikk her for å se en større versjon av denne figuren.

Film 1
Film 1:Spontan Tail Coiling i 24-hpf Wild-type kontrollembryoer. Representativ opptak som viser spontan haleutvikling i et 24 hpf villtype kontrollembryo inkubert i fiskevann. Vennligst klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

Film 2
Film 2: Spontan haleutvikling i 24-hpf Wild-type riluzole-behandlede embryoer. Representativ opptak som viser spontan haleutvikling i et 24 hpf vildtype kontrollembryo inkubert i 5 μM riluzole (+ R). Sammenlignet med kontroller viste + R-embryoer en signifikant reduksjon i frekvensen av spontan hale-spoleadferanse ved 24 hpf. Vennligst klikk her for å se denne videoen. (RigHt-klikk for å laste ned.)

Film 3
Film 3: Basal Spontan Depolariseringsaktivitet av en Primær Motor Neuron i ryggraden av en Wild-type Zebrafish Embryo på 20 hpf. Mermaid biosensoren er så følsom at den kan oppdage de raske endringene i motorneuronmembranpotensialet i spinalkablene av intakte embryoer. Vennligst klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

Film 4
Film 4: Spontan depolarisasjonsaktivitet er koblet til muskelkontraksjon. En sekundær motorneuron i ryggmargen til et wild-type zebrafiskembryo ved 20 hpf gjennomgår spontan depolarisering. I dette tilfellet, hver dePolarisering er assosiert med en sammentrekning av zebrafiskmusklene, organisert i et funksjonelt synkronisert syncytium på dette utviklingsstadiet. Vennligst klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollen presentert her tillot oss å undersøke sammenhengen mellom de elektriske egenskapene til sebrafisk-embryo-spinalmotorneuroner og den spontane spiralbehandlingen, den tidligste stereotypiske motoraktiviteten, som fremgår rundt 17 hkf av embryonisk utvikling og varer til 24 hkf 10 .

Vår tilnærming gir forskere et verktøy for å studere nevrale systemet av intakte embryoer, og fullt ut bevare kompleksiteten av samspillet mellom celler i et utviklende funksjonelt nettverk. In vivo avbildning av zebrafiskembryoer har blitt utført ved ganske enkelt å immobilisere dem gjennom nedsenking i lavmeltende agarose. Studien av endringer i cellemembranpotensialet ved bruk av en biosensor representerer en av hovedfordelene ved denne metoden. Kanoniske elektrofysiologiske tilnærminger, der nevroner må være fysisk tilgjengelige ved å fjerne de innhyllende vevene 11 , er prosedyrenEs som kan endre de elektriske egenskapene til cellene som undersøkes. Videre tillater den FRET-baserte biosensor-tilnærmingen at man studerer cellelektriske egenskaper uten bruk av anestetika ( dvs. Tricaine, en natriumkanalblokker), og unngår potensiell forstyrrelse forbundet med administrering av kjemikalier ( dvs. riluzole her), som Kan være avgjørende i den eksperimentelle planen. Denne metoden tillot oss å fokusere på moduleringen av både den elektriske aktiviteten og frekvensen av spontane hale-spoler, en atferdsrespons som i de fleste tilfeller forhindrer elektrofysiologiske opptak uten administrering av anestetika. Til slutt tilbyr ansettelsen av GEVIs den høyeste temporal eksperimentelle kontrollen fordi den tillater arbeid på et bestemt embryonisk utviklingsstadium. Våre bilde- / innspillingssessioner spenner over et svært begrenset tidsvindu, slik at vi nøyaktig kan sammenligne utviklingsstadiene av de forskjellige embryoer i sanntid. AlleDe konvensjonelle elektrofysiologiske opptakene, derimot, utføres vanligvis i større og mindre presise tidsforløp.

Måling av spenningsendringer ved avbildningsteknikker er imidlertid iboende vanskelig på grunn av selve signalet, som kan variere i hastighet, i frekvens og i størrelsen på endringene i membranpotensialet. En ideell spenningssensor bør kombinere rask respons, høy følsomhet og høy fotonutslipp. For de fleste FRET-baserte GEVIer varierer forholdsendringene som en funksjon av membranspenningsvariasjoner, men amplitude av fluorescensforholdet endres er tett forbundet med varigheten av depolariseringshendelsene. Nylig ble nye GEVIer utviklet og karakterisert, og dermed gjort det mulig å velge den beste sonden i forhold til typen eksperimentell problem, modell og bildebehandling.

Spenningsbiosensorer er integrerte membranproteiner. Når transfekteres inn i dyrkede celler eller uttrykkerD i levende organismer vil fluorescensen av den plasmamembran-lokaliserte sensoren til en viss grad være assosiert med sensorens fluorescens i andre intracellulære rom - hvor proteinet kan mislokaliseres eller aggregeres, og dermed generere et bakgrunnssignal. Ekspressnivået og den riktige membranlokaliseringen av hver konstruksjon skal overvåkes i forenklede eksperimentelle modeller ( dvs. transfeksjon av cellelinjer eller primære kulturer) før bruk av biosensorer i levende organismer.

I foreliggende eksperimentelle oppsett kan et annet potensielt kritisk trinn i protokollen bli representert ved effektiviteten av transgeneseprosedyren. Om nødvendig kan prosentdelen av plasmid-positive celler økes drastisk ved bruk av Tol2 transposonsystemet 12 . Et ytterligere viktig aspekt som må vurderes er tap av fluorescensutslipp i donorfluorforen og tapet i FRET sigNal som forekommer under bildesesjonen på grunn av den intense belysningen. Dette bør unngås ved å minimere belysningen av prøven, og redusere effekten av den benyttede laserlinjen. Tilsvarende må forsterkningen og offseten til fotomultiplikatorene nøye innstilles i begynnelsen av hver opptaksøkt for å oppnå det beste signal-støyforholdet i de oppkjøpte bildene, så vel som å unngå mettede piksler. Alle disse parametrene kan variere avhengig av typen av undersøkt celle, egenskapene til biosensoren, og instrumentene som brukes til bildeoppkjøp (brede feltfluorescensmikroskoper kan også brukes, som nylig beskrevet 13 ). Forskeren bør imidlertid alltid vurdere at under in vivo avbildning, kan støynivået interferere med sensorens spesifikke signal mer enn i in vitro- opptak. Til slutt vil kontrollmålinger ved bruk av mutantprober, som ikke reagerer på spenning, være en praktisk måte hvis det er tilgjengeligÅ evaluere nivået av systemspesifikke støy og / eller artefakter.

Sysselsetting av sebrafiskembryoer representerer et sentralt element i denne tilnærmingen takket være deres respons på genetisk manipulasjon og mikroskopisk undersøkelse. Faktisk gjør disse karakteristikkene forbigående transgenese og den FRET-baserte analysen av neuronelle elektriske egenskaper gjennomførbare. Etter vår mening, med de best egnet promotor- og biosensorkombinasjonene, ville det potensielt være mulig å selektivt analysere den elektriske aktiviteten av en hvilken som helst celletype av interesse og parallell slik aktivitet med den embryonale fenotypen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing Motor Neuron Membran Potensial i Live Zebrafish Embryoer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter