Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Potencial de membrana de neurônio motor biossensível em embriões vivos de peixe-zebra

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A análise de componentes sistêmicos in vivo permite que os cientistas investigem o comportamento celular da maneira mais confiável. Isto é particularmente verdadeiro quando a atividade sob escrutínio é fortemente influenciada pelas interações célula-célula (dependentes de contato e não contato), como no sistema nervoso, onde as mudanças de tensão da membrana conduzem a comunicação entre células excitáveis. A compreensão das informações codificadas por esses sinais elétricos é a chave para entender o funcionamento do sistema nervoso em estados fisiológicos e de doenças.

Para estudar as propriedades elétricas das células nas condições fisiológicas mais não-invasivas, vários indicadores de voltagem codificados geneticamente foram desenvolvidos recentemente 1 . Ao contrário das gerações anteriores de sensores de tensão óptica (principalmente corantes sensíveis à voltagem) 2 , os GEVIs permitem análises in vivo do sistema neural intacto eSua expressão pode ser limitada a tipos ou populações específicas de células.

O embrião de peixe-zebra é o "substrato" in vivo de escolha para aproveitar o grande potencial atribuído aos GEVIs. De fato, graças à sua clareza óptica e seu sistema nervoso simplificado mas evolutivamente conservado, o modelo zebrafish permite a identificação e manipulação direta de cada componente celular em uma rede. De fato, o emprego da GEVI Mermaid 3 baseada em FRET levou à identificação de alterações pré-sintomáticas no comportamento do neurônio motor espinhal em um modelo de esclerose lateral amiotrófica (ALS) 4 .

O seguinte protocolo in vivo descreve como monitorar as propriedades elétricas dos neurônios motores da coluna vertebral em embriões de peixe-zebra intactos que expressam a Sereia de maneira específica neuronal. Além disso, demonstra como chan induzido farmacologicamenteEssas propriedades elétricas podem ser associadas a alterações na freqüência de bobinas espontâneas embrionárias, a atividade motriz estereotípica que caracteriza o comportamento do movimento do peixe zebra em estágios de desenvolvimento muito iniciais.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pHuC_Mermaid Plasmid Generation

NOTA: Mermaid é um biossensor desenvolvido emparelhando o domínio de detecção de tensão (VSD) do Ciona intestinalis (agora Ciona robusta ) 5 sensores de tensão contendo fosfatase (Ci-VSP) com os fluoróforos associados FRET Umi-Kinoko Green (mUKG: doador) e uma versão monomérica da proteína fluorescente emanada de laranja Kusabira Orange (mKOk: aceitadora). Para este biossensor, as mudanças conformacionais do domínio VSD, induzidas pela despolarização da membrana, aumentam a proximidade das proteínas fluorescentes doadoras e aceitadoras, aumentando assim a transferência de energia entre elas (aumentando a relação FRET) 3 . O VSD assegura a localização eficiente do biossensor na membrana plasmática. A expressão neuronal do biossensor (na medula espinhal, o sinal é detectável em interneurônios e neurônios motores) é conseguida pela clonagem da Mermaid opNa estrutura de leitura (ORF) sob o promotor pan-neural zebrafish HuC 6 .

  1. Amplificar através da reação em cadeia da polimerase (PCR) a ORF da sereia a partir do plasmídeo de sementes pCS4 + 3 com polimerase de DNA de Pfu (revisão) utilizando o iniciador de DNA T3 e o iniciador Mermaid Sma I (5'TATCCCGGGATTCGACGGTTCAGATTTTA) de modo a inserir um sítio de restrição Sma I a montante Da Sirena ORF.
    1. Utilize a seguinte mistura de PCR: 0,5 μL de polimerase de Pfu, 7,5 μL do tampão 10x específico, 1 μL de dNTP 10 mM, 2,5 μL de dimetilsulfóxido (DMSO), 0,5 μL (50 ng) da preparação do plasmídeo e 1 ΜL de soluções de estoque de 20 μM de cada iniciador num volume total de 50 μL.
    2. Aqueça a mistura de PCR durante 15 s a 95 ° C, prima-a durante 15 s a 50 ° C e alonge-a durante 4 minutos a 72 ° C durante um total de 35 ciclos.
  2. Gel-purifique o espancamento específicoProduto de PCR utilizando um kit comercial de purificação de gel, seguindo o protocolo do fabricante.
  3. Clone o fragmento de DNA no vetor macio pCMV-SC seguindo o protocolo do fabricante.
  4. Linearize o plasmídeo positivo da Sereia (chamado pCMV-SC_Mermaid) com a enzima de restrição Sma I para a seguinte inserção do promotor HuC.
    1. Configure a reação de restrição como se segue: 0,5 μL (10 U) de enzima de restrição Sma I, 2 μL do kit 10x tampão e 5 μg de DNA plasmídico num volume total de 20 μL. Incubar a reacção a 25 ° C durante 1 h.
  5. Gel-purificar o plasmídeo digerido usando um kit comercial de purificação de gel seguindo o protocolo do fabricante.
  6. PCR-amplificar o promotor de HuC (pHuC), com polimerase de ADN de Pfu e DNA genômico de peixe-zebra como modelo, usando um par de primers específicos de HuC (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA e HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) e abrangendo uma região de 3.150 pb a montante do ATG.
    1. Configure a mistura de PCR utilizando o seguinte esquema: 0,5 μL de polimerase de Pfu, 7,5 μL do tampão 10x específico, 1 μL de dNTP 10 mM, 2,5 μL de DMSO, 200 ng de ADN genómico e 1 μL de 20 μM Soluções de estoque de cada iniciador em um volume total de 50 μL.
    2. Após um passo inicial de 2 minutos a 95 ° C, aqueça a mistura de PCR durante 15 s a 95 ° C, prima-a durante 15 s a 50 ° C e alonge-a durante 4 min a 72 ° C durante um total de 35 ciclos .
  7. Gel-purifique o produto de PCR sem corte específico usando um kit comercial de purificação de gel seguindo o protocolo do fabricante.
  8. Ligar uma quantidade equimolar da pCMV-SC_Mermaid purificada (passo 1.5) e do ADN de pHuC (passo 1.7) utilizando 1 μL de ligase de ADN T4 e 1 μL do tampão específico 10X num volume total de 10 μL. Incube a reação por 16 h em4 ° C.
  9. Transforme uma alíquota de células competentes com 5 μL da reação de ligação (etapa 1.8) seguindo as instruções do fabricante.
  10. Selecione os clones pHuC-positivos (pHuC_Mermaid) com o promotor inserido na orientação apropriada por uma digestão dupla Sal I- Eco RV (o local de restrição Sal I foi inserido a montante do fragmento promotor no passo 1.6, enquanto o site de restrição Eco RV Está posicionado a jusante da região de poliadenilação, PolyA, do plasmídeo pCMV-SC).
    1. Configure a reação de restrição da seguinte maneira: 0,5 μL (10 U) das enzimas de restrição Sal I e Eco RV, 2 μL do tampão kit10X e 1 μg de DNA pHuC_Mermaid em um volume total de 20 μL. Incubar a reacção a 37 ° C durante 1 h. Execute as reações em um gel de agarose.

2. Microinjecção de embriões

  1. Transferir fertilizado, por exemplo,Gs obtidos de tipo selvagem (AB) ou peixe-zebra adulto Sod1-G93R 4 para uma placa de Petri de 10 mm usando uma pipeta de plástico.
  2. Enxaguar os embriões em água de peixe fria (4 ° C) e imediatamente microinjetá-los na gema com 200 pg de plasmídeo pHuC_Mermaid usando um microinjetor (para uma descrição geral e detalhada do procedimento de microinjeção, ver Referências 7 e 8).
  3. Usando uma pipeta de plástico, transfira os embriões para uma placa de Petri e incuba-os em água dos peixes a 28 ° C até atingir o estágio de desenvolvimento desejado (20-24 h pós-fertilização, hpf) para as seguintes análises.

3. Análise Espontânea de Coelagem

NOTA: Avalie o comportamento espontâneo do enrolamento da cauda em embriões de 20-24 hpf com ou sem a droga riluzol.

  1. Transfira um embrião para uma placa de Petri redonda de 90 mm, cheia de água de peixe contendo 0,2% de DMSO (veículo de riluzole) e remova-a manualmente usando doisPinça de joalheiro com pontas afiadas. Incubar o embrião durante 5 min.
  2. Detectar o enrolamento da cauda na RT durante uma gravação de vídeo de 1 min usando uma câmera digital montada em um estereomicroscópio. Adquira séries temporais em uma resolução de tempo de 30 quadros / s.
  3. Calcule a frequência das bobinas de cauda espontâneas contando o número de curvas (ambos contralateral e ipsilateral) por unidade de tempo.
  4. Para avaliar o efeito da droga riluzole, utilize com cuidado uma pipeta Pasteur de plástico para transferir o embrião para uma nova placa de Petri de 90 mm preenchida com água de peixe contendo 5 μM de riluzole.
    1. Incube o embrião durante 5 minutos antes de gravar um vídeo de 1 minuto e realizando a análise comportamental como acima.

4. Configuração de imagem para a Visualização de Biossens da Sereia em Embriões Vivos: Detecção Simultânea de Sinais do Doador e do Aceitador

  1. Monte os embriões de 20 a 24 hpf em 1% de agarose de baixo ponto de fusão em água de peixe em37 ° C dentro de um prato de imagem de fundo de vidro de 35 mm. Oriente os embriões em seus lados. Aguarde até que a agarose solidifique à temperatura ambiente.
  2. Transfira o prato de imagem para o estágio de um confocal invertido montado em um microscópio invertido. Identifique os neurônios motores que expressam o biossensor com um objetivo 20X (0,7 abertura numérica, NA) excitando o mUKG com a linha laser de argônio 488 nm e registrando sua emissão entre 495 e 525 nm.
  3. Para uma medição de FRET, excite mUKG, o doador do par de FRET, com a linha a laser de 488 nm. Detecta simultaneamente, com um scanner ressonante operando a 8.000 Hz no modo bidirecional, a fluorescência emitida pelo doador (entre 495 e 525 nm) e a fluorescência emitida pelo aceitador mKOk (entre 550 e 650 nm, canal FRET). Se disponível, use o laser de 473 nm.
    NOTA: A eficiência de excitação do doador será ligeiramente reduzida (85% em vez de 93% com 488 nm), mas a excitação cruzada do aceitador seráSeja reduzido também (de 17% com 488 nm a 9% com linha laser de 473 nm).
  4. Para reduzir a fototoxicidade e o branqueamento de fluoróforos, minimize a iluminação da amostra reduzindo a potência da linha laser (na janela do caminho do feixe do software de aquisição).
  5. Otimize a excitação para combinar os parâmetros de ganho e deslocamento que são definidos no início do experimento e mantidos constantes ao longo da sessão. Para definir o deslocamento, altere a cor da imagem para os valores de intensidade (usando a tabela de consulta Q) e, ao digitalizar com o laser desligado, gire o botão de deslocamento (deslocamento inteligente) para que os pixels de fundo tenham uma intensidade ligeiramente Superior a zero. Com a mesma tabela de pesquisa, ligue o laser enquanto estiver digitalizando, gire o botão de ganhos (ganhos inteligentes) para maximizar a relação sinal-ruído, com o cuidado de evitar pixels saturados.
  6. Usando um pinhole aberto (2 unidades arejadas), adquira imagens de 16 bits para fornecer um alcance dinâmico suficiente para quantitativE análises. Evite calcular a média para aumentar a velocidade de aquisição e para minimizar a fotovelagem.
  7. Na janela de aquisição de software, selecione um tamanho de campo de imagem de 512 x 64 pixels (tamanho de pixel: 605 nm) no menu suspenso.
  8. Na janela do modo de aquisição, selecione xyt (lapso de tempo em um único plano xy) do menu suspenso e registre as mudanças na tensão do neurônio da coluna vertebral embrionária ao adquirir um único plano xy, definindo os parâmetros de aquisição para gravar uma imagem a cada 30 Ms por 1 min.
  9. Para avaliar o efeito da administração de riluzol na despolarização da membrana no mesmo neurônio, adquira um novo conjunto de dados 5 min após a adição de água de peixe contendo 5 μM de riluzol.
  10. Para a análise de FRET, use a macro de ImageJ Biosensor_FRET (expressando biossensores de FRET de cadeia simples.
  11. Avalie a relação FRET da membrana basal de cada neurônio em t 1 como ((FRET mean - FRET background) / (Donor mean - Donor background)), onde FRET e DonOu intensidade média é a intensidade média de fluorescência calculada na mesma região de interesse (ROI) desenhada em torno da célula para cada canal adquirido e o fundo FRET e Donor é a intensidade média de fluorescência calculada em um ROI do campo de visão sem a amostra fluorescente.
    NOTA: Uma detalhada descrição passo a passo do uso do plugin pode ser encontrada no site www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Use um software gráfico para comparar a freqüência, amplitude e duração da despolarização entre diferentes paradigmas experimentais. Compare dois grupos usando um teste t de Student não compartilhado e considere os valores médios como estatisticamente diferentes quando P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Um vetor de expressão que transporta a sequência de codificação de biossensor Mermaid baseada em FRET sob o controle do promotor pan-neuronal pHuC, que conduz a síntese da proteína exclusivamente no sistema nervoso, foi entregue em ovos fertilizados de uma única célula por meio de uma microinjeção em Para obter embriões transgênicos transitórios ( Figura 1 , Painel esquerdo). Depois de dominar a técnica de microinjecção, a porcentagem de embriões positivos para sereia foi próxima de 100%. Entre estes, apenas os embriões que expressam a quantidade adequada de biossensor da sereia na membrana plasmática foram considerados para análise FRET / aquisição de imagem.

As bobinas espontâneas, as respostas motoras que consistem exclusivamente em uma contração completa do corpo, trazendo a ponta da cauda para a cabeça 9 , 10 , foram registradas na fase de 20-24 hpf em meio regular de peixe ( Figura 1 , painel central e Vídeo 1 ) e após incubação em 5 μM de riluzole ( Vídeo 2 ). As análises estatísticas das mudanças na freqüência das bobinas espontâneas da cauda desencadeadas pelo medicamento riluzol são relatadas em outro lugar 4 .

Para testar se as alterações na atividade elétrica dos neurônios motoras espinhais foram baseadas nas mudanças induzidas por riluzol na freqüência de enrolamento espontâneo, o potencial da membrana nos neurônios motores da coluna vertebral embrionária foi estudado de forma não invasiva, medindo a intensidade de fluorescência Proporção do par de FRET doador / aceitador do biossensor Mermaid (relação FRET: Figura 1 , painel direito). Os neurônios motores da coluna vertebral primária expressando o biossensor foram identificados ( Figura 2A ) e suas atividades basais de despolarização espontânea foram registradas ( Ng> Figura 2B e Vídeos 3 e 4 ). Juntamente com a redução da frequência dos movimentos da bobina da cauda, ​​a administração de riluzol reduziu a frequência dos eventos de despolarização espontânea ( Figura 2C ).

figura 1
Figura 1: Fluxograma do Procedimento Experimental. Os embriões de estágio celular são coletados e imediatamente microinjetados com o plasmídeo pHuC_Mermaid para expressar o biossensor de tensão FRET da Sereia de uma forma pan-neuronal. A 20-24 hpf com incubação a 28 ° C, os embriões simples são transferidos sob um estereomicroscópio e sua atividade espontânea da bobina da cauda, ​​com e sem a droga riluzole presente na água do peixe, é gravada e analisada por vídeo. Os mesmos embriões sofrem in vivo análise de FRET para medir mudanças no potencial da membrana do neurônio motor.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Análise FRET In Vivo para Medir Mudanças no Potencial da Membrana do Neurônio do Motor. ( A ) Embriões de peixe-zebra de tipo selvagem com a expressão em mosaico do biossensor de tensão baseado em FRET Sereia no neurônio da coluna vertebral. (A) A imagem do campo brilhante mostra a área do tronco do peixe-zebra identificado pela caixa preta (sc: medula espinal, ms: myoseptum; m: myotome). Ao superar (a) o sinal de fluorescência detectado (b), a expressão eficiente do biossensor em um neurônio motor principal da coluna vertebral (PM) pode ser visualizada claramente. O doador (c) e o canal FRET (d) detectado são mostrados com as respectivas tabelas de consulta verde e magenta (LUT)do lado direito. Todos os embriões são montados em uma orientação craniana a caudal. Barra de escala = 10 μm. ( B ) O mapa da relação FRET mostra a relação FRET calculada a cada 0,03 s no mesmo neurônio motor. Mostra a atividade basal de despolarização espontânea que a célula sofre. Para o biossensor da sereia, o aumento da relação FRET ocorre quando o potencial da membrana aumenta. Barra de escala = 10 μm. ( C ) Exemplo representativo de alterações da razão FRET média espontânea ocorrendo em um neurônio motor espinal de um embrião de peixe-zebra Sod1-G93R durante uma gravação de 1 min. A administração de Riluzole reduz a freqüência das despolarizações espontâneas. Clique aqui para ver uma versão maior dessa figura.

Filme 1
Filme 1:Bobina Espontânea de Cauda em Embriões de Controle de Tipo Selvão de 24 hpf . Gravação representativa que mostra o enrolamento espontâneo da cauda em um embrião de controle de tipo selvagem de 24 hpf incubado em água de peixe. Clique aqui para ver este vídeo. (Clique com o botão direito do mouse para baixar.)

Filme 2
Filme 2: Bobina espontânea da cauda em embriões tratados com riluzol de tipo selvagem de 24 hpf . Gravação representativa que mostra o enrolamento espontâneo da cauda em um embrião de controle de tipo selvagem de 24 hpf incubado em riluzole 5 μM (+ R). Em comparação com os controles, os embriões + R mostraram uma diminuição significativa na freqüência do comportamento espiral de cobalagem da cauda a 24 hpf. Clique aqui para ver este vídeo. (EquipamentoHt-clique para baixar.)

Filme 3
Filme 3: Atividade de depolarização espontânea basal de um neurônio motor primário na medula espinal de um embrião de peixe-zebra de tipo selvagem a 20 hpf. O biossensor da sereia é tão sensível que pode detectar as mudanças rápidas no potencial da membrana do neurônio motor na espinha dorsal dos embriões intactos. Clique aqui para ver este vídeo. (Clique com o botão direito do mouse para baixar.)

Filme 4
Filme 4: A atividade de despolarização espontânea é acoplada à contração muscular. Um neurônio motor secundário na medula espinal de um embrião de peixe-zebra de tipo selvagem a 20 hpf sofre despolarização espontânea. Nesse caso, cada um deA polarização está associada a uma contração dos músculos do peixe zebra, organizada em um sincronismo funcionalmente sincronizado nesta fase de desenvolvimento. Clique aqui para ver este vídeo. (Clique com o botão direito do mouse para baixar.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O protocolo aqui apresentado permitiu explorar a associação entre as propriedades elétricas dos neurônios motores da coluna vertebral do embrião zebra eo comportamento espiral espiral, a atividade motriz estereotípica mais antiga, que aparece em torno de 17 hpf de desenvolvimento embrionário e dura até 24 hpf 10 .

Nossa abordagem fornece aos pesquisadores uma ferramenta para estudar o sistema neural de embriões intactos, preservando plenamente a complexidade das interações entre células em uma rede funcional em desenvolvimento. A imagem in vivo de embriões de peixe-zebra foi realizada simplesmente imobilizando-os através da imersão em agarose de baixo ponto de fusão. O estudo das mudanças no potencial da membrana celular através do uso de um biossensor representa uma das principais vantagens desse método. Abordagens eletrofisiológicas canônicas, nas quais os neurônios devem ser acessados ​​fisicamente removendo os tecidos envolventes 11 , são procedentesEs que pode alterar as propriedades elétricas das células em exame. Além disso, a abordagem de biossensor baseada em FRET permite o estudo de propriedades elétricas celulares sem o uso de anestésicos ( isto é, Tricaine, um bloqueador de canais de sódio), evitando qualquer distúrbio potencial associado à administração de produtos químicos ( isto é, riluzole aqui), o que Pode ser crucial no plano experimental. Este método nos permitiu focar a modulação da atividade elétrica e da freqüência das bobinas de cauda espontâneas, uma resposta comportamental que evita, na maioria dos casos, gravações eletrofisiológicas sem a administração de anestesia. Finalmente, o emprego de GEVIs oferece o maior controle experimental temporal, pois permite trabalhar em estágio específico de desenvolvimento embrionário. Nossas sessões de imagem / gravação abrangeram uma janela de tempo muito limitada, permitindo comparar com precisão os estágios de desenvolvimento dos diferentes embriões em tempo real. TodosAs gravações eletrofisiológicas convencionais, pelo contrário, geralmente são conduzidas em períodos de tempo maiores e menos precisos.

Medir as mudanças de tensão por técnicas de imagem é, no entanto, intrinsecamente difícil por causa da natureza do próprio sinal, que pode variar na velocidade, na freqüência e no tamanho das mudanças no potencial da membrana. Um sensor de tensão ideal deve combinar rápida capacidade de resposta, alta sensibilidade e alta emissão de fótons. Para a maioria dos GEVI baseados em FRET, as mudanças de proporção variam em função das variações da tensão da membrana, mas a amplitude das mudanças da relação de fluorescência está fortemente associada à duração dos eventos de despolarização. Recentemente, novos GEVIs foram desenvolvidos e caracterizados, permitindo assim escolher a melhor sonda em relação ao tipo de problema experimental, modelo e dispositivo de imagem.

Biossensores de tensão são proteínas de membrana integral. Quando transfectadas em células cultivadas ou expressasD em organismos vivos, a fluorescência do sensor localizado na membrana plasmática será, até certo ponto, associada à fluorescência do sensor em outros compartimentos intracelulares - onde a proteína pode ser mal definida ou agregada - gerando assim um sinal de fundo. O nível de expressão e a localização adequada da membrana de cada construção devem ser monitorados em modelos experimentais simplificados ( isto é, transfectando linhas celulares ou culturas primárias) antes de usar os biossensores em organismos vivos.

Na configuração experimental atual, outro passo crítico potencial do protocolo pode ser representado pela eficiência do procedimento de transgênese. Se necessário, a percentagem de células plasmídeas positivas pode ser aumentada drasticamente empregando o sistema de transposão Tol2 12 . Um aspecto crucial adicional que deve ser considerado é a perda de emissão de fluorescência no fluoróforo doador e a perda em sig de FRETOcorrendo durante a sessão de imagem por causa da intensa iluminação. Isso deve ser evitado minimizando a iluminação da amostra, reduzindo a potência da linha laser utilizada. Da mesma forma, o ganho e o deslocamento dos fotomultiplicadores devem ser cuidadosamente sintonizados no início de cada sessão de gravação para obter a melhor relação sinal-ruído nas imagens adquiridas, bem como para evitar pixels saturados. Todos esses parâmetros podem variar de acordo com o tipo de célula examinada, as características do biossensor e os instrumentos utilizados para a aquisição de imagens (os microscópios de fluorescência de campo largo também podem ser usados, como descrito recentemente 13 ). O pesquisador deve sempre considerar, no entanto, que durante a imagem in vivo , o nível de ruído pode interferir com o sinal específico do sensor mais do que nas gravações in vitro . Finalmente, se disponível, as medidas de controle usando sondas mutantes, que não respondem à tensão, seriam uma maneira convenientePara avaliar o nível de ruído e / ou artefatos específicos do sistema.

O emprego de embriões de peixe-zebra representa uma característica fundamental desta abordagem, graças à sua capacidade de resposta à manipulação genética e à investigação microscópica. De fato, essas características tornam possível a transgênese transitória e a análise baseada em FRET de propriedades elétricas neuronais. Em nossa opinião, com as combinações de promotor e biossensor mais adequadas, seria potencialmente possível analisar seletivamente a atividade elétrica de qualquer tipo de interesse celular e paralelizar essa atividade com o fenótipo embrionário.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Potencial de membrana de neurônio motor biossensível em embriões vivos de peixe-zebra
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter