Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Potencial de membrana de la neurona motora de Biosensing en los embriones vivos de pez cebra

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

El análisis in vivo del componente sistémico permite a los científicos investigar el comportamiento celular de la manera más confiable. Esto es particularmente cierto cuando la actividad bajo escrutinio está fuertemente influenciada por las interacciones célula-célula (tanto contacto como no contacto), como en el sistema nervioso, donde los cambios de voltaje de la membrana impulsan la comunicación entre las células excitables. La comprensión de la información codificada por estas señales eléctricas es la clave para entender la forma en que el sistema nervioso funciona tanto en estados fisiológicos como en estados de enfermedad.

Con el fin de estudiar las propiedades eléctricas de las células en las condiciones fisiológicas más no invasivas, varios indicadores de voltaje genéticamente codificados se han desarrollado recientemente 1 . A diferencia de las generaciones anteriores de sensores de voltaje óptico (principalmente sensibles a la tensión) 2 , las GEVI permiten análisis in vivo del sistema neural intacto, ySu expresión puede limitarse a tipos o poblaciones de células específicas.

El embrión de pez cebra es el "sustrato" in vivo de elección para aprovechar el gran potencial atribuido a los GEVI. De hecho, gracias a su claridad óptica y su sistema nervioso simplificado pero evolutivamente conservado, el modelo de pez cebra permite la identificación y manipulación directa de cada componente celular en una red. De hecho, el empleo de la GEVI basada en FRET Mermaid 3 condujo a la identificación de las alteraciones pre-sintomáticas en el comportamiento de la neurona motora espinal en un modelo de pez cebra de esclerosis lateral amiotrófica (ALS) [ 4] .

El siguiente protocolo in vivo describe cómo monitorear las propiedades eléctricas de las neuronas motoras espinales en embriones intactos de pez cebra que expresan Mermaid de una manera neuronal específica. Por otra parte, se demuestra cómo farmacológicamente inducida chanEstas propiedades eléctricas pueden asociarse con alteraciones en la frecuencia de las bobinas espontáneas embrionarias, la actividad motora estereotípica que caracteriza el comportamiento del movimiento del pez cebra en etapas muy tempranas de desarrollo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plásmido Generación

NOTA: Mermaid es un biosensor desarrollado mediante el acoplamiento del dominio de detección de voltaje (VSD) de la Ciona intestinalis (ahora Ciona robusta ) que contiene fosfatasa (Ci-VSP) con los fluoróforos del socio FRET Umi-Kinoko Green (mUKG: donante) y una versión monomérica de la proteína fluorescente emisora ​​de naranja Kusabira Orange (mKOk: acceptor). Para este biosensor, los cambios conformacionales del dominio VSD, inducidos por la despolarización de la membrana, aumentan la proximidad de las proteínas fluorescentes dadoras y aceptoras, aumentando así la transferencia de energía entre ellas (aumentando la relación FRET) 3 . El VSD asegura la localización eficiente del biosensor en la membrana plasmática. La expresión neuronal del biosensor (en la médula espinal, la señal es detectable tanto en interneuronas como en neuronas motoras) se logra clonando la sirena opEn marco de lectura (ORF) bajo el pez cebra pan-neuronal promotor HuC [ 6] .

  1. Se amplifica mediante la reacción en cadena de la polimerasa (PCR) el ORF Mermaid del plásmido 3 de la sirena pCS4 + con la polimerasa de ADN Pfu (corrección) utilizando el cebador T3 Universal y el cebador Mermaid Sma I (5'TATCCCGGGATTCGACGGTTCAGATTTTA) para insertar un sitio de restricción SmaI aguas arriba De la Sirena ORF.
    1. Utilizar la siguiente mezcla de PCR: 0,5 μl de DNA polimerasa Pfu, 7,5 μl del tampón 10x específico, 1 μl de dNTP 10 mM, 2,5 μl de dimetilsulfóxido (DMSO), 0,5 μl (50 ng) de la preparación de plásmido y 1 Μl de soluciones madre de 20 μM de cada cebador en un volumen total de 50 μl.
    2. Calentar la mezcla de PCR durante 15 s a 95 ° C, cebar durante 15 s a 50 ° C, y alargar durante 4 min a 72 ° C durante un total de 35 ciclos.
  2. Gel-purificar el concreto específicoPCR usando un kit comercial de purificación de gel, siguiendo el protocolo del fabricante.
  3. Clonar el fragmento de ADN en el vector blunt pCMV-SC siguiendo el protocolo del fabricante.
  4. Linearizar el plásmido positivo Mermaid (denominado pCMV-SC_Mermaid) con la enzima de restricción Sma I para la siguiente inserción del promotor HuC.
    1. Establecer la reacción de restricción de la siguiente manera: 0,5 μ l (10 U) de la enzima de restricción Sma I, 2 μ l del kit 10 x tampón, y 5 μ g de ADN plasmídico en un volumen total de 20 μ l. Incubar la reacción a 25 ° C durante 1 h.
  5. Gel-purificar el plásmido digerido utilizando un kit comercial de purificación de gel siguiendo el protocolo del fabricante.
  6. PCR-amplificar el promotor HuC (pHuC), con Pfu ADN polimerasa y zebrafish ADN genómico como plantilla, utilizando un par de HuC-primers específicos (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA y HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) y abarcando una región de 3.150 pb aguas arriba del ATG.
    1. Se preparó la mezcla de PCR usando el siguiente esquema: 0,5 μl de DNA polimerasa Pfu, 7,5 μl del tampón 10x específico, 1 μl de dNTP 10 mM, 2,5 μl de DMSO, 200 ng de ADN genómico y 1 μl de 20 μM Stock de cada cebador en un volumen total de 50 μl.
    2. Después de un paso inicial de 2 min a 95 ° C, calentar la mezcla de PCR durante 15 s a 95 ° C, cebar durante 15 s a 50 ° C, y alargarla durante 4 min a 72 ° C durante un total de 35 ciclos .
  7. Purificar con gel el producto de PCR blunt específico usando un kit comercial de purificación de gel siguiendo el protocolo del fabricante.
  8. Ligar una cantidad equimolar del pCMV-SC_Mermaid purificado (etapa 1.5) y del ADN de pHuC (etapa 1.7) usando 1 μl de T4 DNA ligasa y 1 μl del tampón 10X específico en un volumen total de 10 μl. Incubar la reacción durante 16 h a4ºC.
  9. Transformar una alícuota de células competentes con 5 μl de la reacción de ligación (paso 1.8) siguiendo las instrucciones del fabricante.
  10. Seleccionar los clones pHuC positivos (pHuC_Mermaid) con el promotor insertado en la orientación apropiada por una doble digestión Sal I- Eco RV (el sitio de restricción Sal I se ha insertado antes del fragmento promotor en la etapa 1.6, mientras que el sitio de restricción Eco RV Se sitúa aguas abajo de la región de poliadenilación, PolyA, del plásmido pCMV-SC).
    1. Establecer la reacción de restricción de la siguiente manera: 0,5 μ l (10 U) de ambos Sal I y Eco RV enzimas de restricción, 2 μ l del kit10X buffer, y 1 μ g de pHuC_Mermaid ADN en un volumen total de 20 μL. Incubar la reacción a 37 ° C durante 1 h. Ejecutar las reacciones sobre un gel de agarosa.

2. Microinyección de embriones

  1. Transferir el fertilizado por ejemploGs obtenido de cebra salvaje de tipo salvaje (cepa AB) o Sod1-G93R adulto 4 a una placa de Petri de 10 mm usando una pipeta de plástico.
  2. Enjuague los embriones en agua de pescado fría (4 ° C) e inmediatamente microinyúdalos en la yema con 200 μg de plásmido pHuC_Mermaid usando un microinyector (para una descripción general y detallada del procedimiento de microinyección, ver Referencias 7 y 8).
  3. Utilizando una pipeta de plástico, transfiera los embriones a una placa de Petri y los incube en agua de pescado a 28 ° C hasta que alcancen la etapa de desarrollo deseada (20-24 h después de la fertilización, hpf) para los siguientes análisis.

3. Análisis espontáneo de la cola de cola

NOTA: Evaluar el comportamiento espontáneo de enrollamiento de la cola en embriones de 20-24 hpf con o sin el riluzol del fármaco.

  1. Transferir un embrión a una placa de Petri redonda de 90 mm llena de agua de pescado que contenga 0,2% de DMSO (vehículo riluzol) y descomprímala manualmente usando twO pinzas de joyería con puntas afiladas. Incubar el embrión durante 5 min.
  2. Detectar el enrollamiento de cola a RT durante una grabación de vídeo de 1 minuto usando una cámara digital montada en un estereomicroscopio. Adquiera series temporales con una resolución de 30 fotogramas por segundo.
  3. Calcule la frecuencia de las bobinas espontáneas de la cola contando el número de curvas (tanto contralateral como ipsilateral) por unidad de tiempo.
  4. Para evaluar el efecto del fármaco riluzol, utilice suavemente una pipeta Pasteur de plástico para transferir el embrión a una nueva placa de Petri de 90 mm llena de agua de pescado que contenga riluzol 5 μM.
    1. Incubar el embrión durante 5 minutos antes de grabar un video de 1 minuto y realizar el análisis de comportamiento como el anterior.

4. Configuración de imágenes para la visualización de biosensores de sirena en embriones vivos: detección simultánea de señales de donantes y aceptoras

  1. Montar los embriones de 20 - 24 hpf en 1% de agarosa de bajo punto de fusión en agua de pescado al37 ° C dentro de un plato de imagen de fondo de vidrio de 35 mm. Oriente los embriones en sus lados. Espere hasta que la agarosa se solidifique a temperatura ambiente.
  2. Transferir el plato de imagen a la etapa de un confocal invertido montado en un microscopio invertido. Identificar las neuronas motrices que expresan el biosensor con un objetivo 20X (0.7 apertura numérica, NA) mediante la excitación de la mUKG con la línea de 488 nm de láser de argón y el registro de su emisión entre 495 y 525 nm.
  3. Para una medición de FRET, excite mUKG, el donante del par FRET, con la línea láser de 488 nm. Detecta simultáneamente, con un escáner resonante que opera a 8.000 Hz en el modo bidireccional, la fluorescencia emitida por el donante (entre 495 y 525 nm) y la fluorescencia emitida por el receptor mKOk (entre 550 y 650 nm, canal FRET). Si está disponible, utilice el láser de 473 nm.
    NOTA: La eficiencia de excitación del donante se reducirá ligeramente (85% en lugar de 93% con 488 nm), pero la excitación cruzada del aceptor será(Del 17% con el 488 nm al 9% con línea láser de 473 nm).
  4. Para reducir la fototoxicidad y el blanqueo con fluoróforos, minimice la iluminación de la muestra reduciendo la potencia de la línea láser (en la ventana de la trayectoria del haz del software de adquisición).
  5. Optimice la excitación para que coincida con los parámetros de ganancia y compensación que se establecen al comienzo del experimento y se mantienen constantes durante toda la sesión. Para ajustar el offset, cambie el color de la imagen a los valores de intensidad (usando la tabla de búsqueda Q) y, mientras escanea con el láser apagado, gire la perilla de desplazamiento (offset inteligente) para que los píxeles de fondo tengan una intensidad ligeramente Mayor que cero. Con la misma tabla de consulta, encendiendo el láser durante la exploración, gire la perilla de ganancia (ganancia inteligente) para maximizar la relación señal-ruido, teniendo cuidado de evitar píxeles saturados.
  6. Usando un agujero abierto (2 unidades aireadas), adquiera imágenes de 16 bits para proporcionar un rango dinámico suficiente para el cuantitativoE análisis. Evite promediar para aumentar la velocidad de adquisición y para minimizar el fotoblanqueo.
  7. En la ventana de adquisición de software, seleccione un tamaño de campo de imagen de 512 x 64 píxeles (tamaño de píxel: 605 nm) en el menú desplegable.
  8. Desde la ventana del modo de adquisición, seleccione xyt (lapso de tiempo en un solo plano xy) desde el menú desplegable y registre los cambios en el voltaje de la neurona espinal embrionaria mediante la adquisición de un solo plano xy, estableciendo los parámetros de adquisición para grabar una imagen cada 30 Ms durante 1 min.
  9. Para evaluar el efecto de la administración de riluzol en la despolarización de la membrana en la misma neurona, adquirir un nuevo conjunto de datos 5 min después de la adición de agua de pescado que contiene 5 μ M riluzol.
  10. Para el análisis FRET, utilice la macro ImageJ Biosensor_FRET (que expresa biosensores FRET de cadena sencilla.
  11. Evaluar la relación de FRET de membrana basal de cada neurona en t 1 como ((FRET media - FRET fondo) / (Donante medio - Donante de fondo)), donde FRET y DonO intensidad media es la intensidad media de fluorescencia calculada en la misma región de interés (ROI) dibujada alrededor de la célula para cada canal adquirido y FRET y donante de fondo es la intensidad de fluorescencia media calculada en un ROI del campo de visión sin la muestra fluorescente.
    NOTA: Una descripción detallada paso a paso del uso del plugin se puede encontrar en el sitio web www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Utilice un software gráfico para comparar la frecuencia, amplitud y duración de la despolarización entre diferentes paradigmas experimentales. Comparar dos grupos usando un test t de Student no pareado y considerar los valores medios como estadísticamente diferentes cuando P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Un vector de expresión que portaba la secuencia codificante de biosensor Mermaid basada en FRET bajo el control del promotor pan-neuronal pHuC, que impulsa la síntesis de la proteína exclusivamente en el sistema nervioso, se suministró en huevos fertilizados de una sola célula por medio de una microinyección en Con el fin de obtener embriones transgénicos transitorios ( Figura 1 , Panel izquierdo). Después de dominar la técnica de microinyección, el porcentaje de embriones Mermaid-positivos fue cercano al 100%. Entre ellos, sólo los embriones que expresan la cantidad adecuada de biosensor Mermaid en la membrana plasmática se consideraron para el análisis de FRET / adquisición de imágenes.

Las bobinas espontáneas, las respuestas motrices que consisten exclusivamente en una contracción total del cuerpo que lleva la punta de la cola a la cabeza 9 , 10 , se registraron en la etapa de 20-24 hpf en medio regular de pescado ( Figura 1 , panel central y Video 1 ) y después de la incubación en 5 μ M riluzol ( Video 2 ). El análisis estadístico de los cambios en la frecuencia de la cola espontánea coilings desencadenado por el riluzol drogas se informan en otro lugar [ 4] .

Para probar si las alteraciones en la actividad eléctrica de las neuronas motoras espinales estaban en la base de los cambios inducidos por el riluzol en la frecuencia de bobinado espontáneo, se estudió el potencial de membrana en las neuronas motoras espinales embrionarias de una manera no invasiva, midiendo la intensidad de fluorescencia Del par de FRET de donante / aceptor del biosensor Mermaid (relación FRET: Figura 1 , panel derecho). Se identificaron las neuronas motoras espinales primarias que expresaban el biosensor ( Figura 2A ) y se registraron sus actividades de despolarización espontánea basal ( Ng> Figura 2B y Videos 3 y 4 ). Junto con la reducción de la frecuencia de los movimientos de enrollamiento de la cola, la administración de riluzol redujo la frecuencia de los eventos de despolarización espontánea ( Figura 2C ).

Figura 1
Figura 1: Diagrama de Flujo del Procedimiento Experimental. Se recogen embriones de una sola etapa celular y se microinyectan inmediatamente con el plásmido pHuC_Mermaid para expresar el biosensor de tensión Mermaid FRET de una manera pan-neuronal. A 20-24 hpf con incubación a 28 ° C, los embriones individuales se transfieren bajo un estereomicroscopio y su actividad espontánea de enrollamiento de la cola, con y sin riluzol del fármaco presente en el agua de los peces, es grabada y analizada. Los mismos embriones experimentan un análisis FRET in vivo para medir los cambios en el potencial de la membrana motora neuronal.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Análisis de FRET in vivo para medir los cambios en el potencial de la membrana neuronal del motor. ( A ) embriones de pez cebra de tipo salvaje con la expresión en mosaico de la sonda de biosensor de voltaje basado en FRET en la neurona espinal. (A) La imagen de campo brillante muestra el área del tronco del pez cebra identificado por la caja negra (sc: médula espinal, ms: myoseptum, m: miotoma). Al superponer (a) la señal de fluorescencia detectada (b), se puede visualizar claramente la expresión eficiente del biosensor en una neurona motora espinal primaria (PM). El canal donante (c) y el canal FRET (d) detectado se muestran con las respectivas tablas de búsqueda verde y magenta (LUT)en el lado derecho. Todos los embriones están montados en una orientación craneal a caudal. Barra de escala = 10 μm. ( B ) El mapa de relaciones FRET muestra la relación FRET calculada cada 0,03 s en la misma neurona motora. Muestra la actividad de despolarización espontánea basal que experimenta la célula. Para el biosensor Mermaid, el aumento en la relación FRET ocurre cuando aumenta el potencial de membrana. Barra de escala = 10 μm. ( C ) Ejemplo representativo de cambios en la relación media de FRET espontánea que ocurren en una neurona motora espinal de un embrión de pez cebra Sod1-G93R durante un registro de 1 minuto. La administración de riluzol reduce la frecuencia de las despolarizaciones espontáneas. Haga clic aquí para ver una versión más grande de esta figura.

Película 1
Película 1:Cola espontánea en 24 hpf de tipo salvaje Embriones. Representativo de grabación mostrando bobina espontánea cola en un 24 hpf de tipo salvaje embrión de control incubado en agua de peces. Haga clic aquí para ver este video. (Haga clic derecho para descargar.)

Película 2
Película 2: Cola espontánea enrollada en embriones tratados con riluzol de tipo salvaje de 24 hpf . Representativo de grabación mostrando bobina espontánea cola en un 24 hpf de tipo salvaje embrión de control incubado en 5 μ M riluzol (+ R). En comparación con los controles, + R embriones mostró una disminución significativa en la frecuencia de espontánea cola coil comportamiento a 24 hpf. Haga clic aquí para ver este video. (AparejoHt-click para descargar.)

Película 3
Película 3: Actividad de despolarización espontánea basal de una neurona motora primaria en la médula espinal de un embrión de pez cebra de tipo salvaje a 20 hpf. El biosensor de la sirena es tan sensible que puede detectar los cambios rápidos en el potencial de la membrana de la neurona del motor en las médulas espinales de embriones intactos. Haga clic aquí para ver este video. (Haga clic derecho para descargar.)

Película 4
Película 4: La actividad espontánea de despolarización se une a la contracción muscular. Una neurona motora secundaria en la médula espinal de un embrión salvaje de pez cebra a 20 hpf sufre despolarización espontánea. En este caso, cadaLa polarización está asociada a una contracción de los músculos del pez cebra, organizados en un sincicio funcionalmente sincronizado en esta etapa de desarrollo. Haga clic aquí para ver este video. (Haga clic derecho para descargar.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El protocolo presentado aquí nos permitió explorar la asociación entre las propiedades eléctricas de las neuronas motoras espinales embrionarias del pez cebra y el comportamiento de bobinado espontáneo, la primera actividad motora estereotípica, que aparece alrededor de 17 hpf de desarrollo embrionario y dura hasta 24 hpf 10 .

Nuestro enfoque proporciona a los investigadores una herramienta para estudiar el sistema neural de embriones intactos, preservando completamente la complejidad de las interacciones entre las células en una red funcional en desarrollo. La formación de imágenes in vivo de embriones de pez cebra se ha realizado simplemente inmovilizando a través de inmersión en bajo punto de fusión de agarosa. El estudio de los cambios en el potencial de la membrana celular mediante el uso de un biosensor representa una de las principales ventajas de este método. Los enfoques electrofisiológicos canónicos, en los que se debe acceder físicamente a las neuronas mediante la eliminación de los tejidos envolventes 11 , son procedimientosEs que podría alterar las propiedades eléctricas de las células en estudio. Además, el enfoque biosensor basado en FRET permite el estudio de propiedades eléctricas celulares sin el uso de anestésicos ( es decir, Tricaine, un bloqueador de canales de sodio), evitando cualquier perturbación potencial asociada con la administración de productos químicos ( es decir, riluzol aquí), que Podría ser crucial en el plan experimental. Este método nos permitió enfocarnos en la modulación tanto de la actividad eléctrica como de la frecuencia de los coilings espontáneos de la cola, una respuesta conductual que evita, en la mayoría de los casos, registros electrofisiológicos sin la administración de anestésicos. Finalmente, el empleo de GEVIs ofrece el control experimental temporal más alto porque permite el trabajo en una etapa embrionaria específica del desarrollo. Nuestras sesiones de imágenes / grabación abarcó una ventana de tiempo muy limitada, lo que nos permite comparar con precisión las etapas de desarrollo de los diferentes embriones en tiempo real. TodasLas grabaciones electrofisiológicas convencionales, por el contrario, se llevan a cabo habitualmente en intervalos de tiempo mayores y menos precisos.

Sin embargo, la medición de los cambios de tensión mediante técnicas de formación de imágenes es intrínsecamente difícil debido a la naturaleza de la propia señal, que puede variar en velocidad, frecuencia y tamaño de los cambios en el potencial de membrana. Un sensor de voltaje ideal debe combinar una respuesta rápida, alta sensibilidad y alta emisión de fotones. Para la mayoría de los GEVI basados ​​en FRET, los cambios de relación varían en función de las variaciones de voltaje de la membrana, pero la amplitud de los cambios de la relación de fluorescencia está estrechamente asociada con la duración de los eventos de despolarización. Recientemente, se desarrollaron y caracterizaron nuevos GEVIs, permitiendo así elegir la mejor sonda en relación al tipo de problema experimental, modelo y dispositivo de imagen.

Los biosensores de voltaje son proteínas integrales de membrana. Cuando se transfectan en células cultivadas o expresseD en los organismos vivos, la fluorescencia del sensor localizado en la membrana plasmática estará, en cierta medida, asociada con la fluorescencia del sensor en otros compartimentos intracelulares -donde la proteína puede ser localizada o agregada- generando así una señal de fondo. El nivel de expresión y la correcta localización de la membrana de cada constructo deben ser monitoreados en modelos experimentales simplificados ( es decir transfectando líneas celulares o cultivos primarios) antes de usar los biosensores en organismos vivos.

En la configuración experimental presente, otro paso crítico potencial del protocolo podría estar representado por la eficacia del procedimiento de transgénesis. Si es necesario, el porcentaje de células positivas al plásmido puede aumentarse drásticamente empleando el sistema de transposón Tol2. Un aspecto crucial adicional que debe tenerse en cuenta es la pérdida de la emisión de fluorescencia en el fluoróforo donante y la pérdida de FRET sigNal durante la sesión de formación de imágenes debido a la intensa iluminación. Esto se debe evitar minimizando la iluminación de la muestra, reduciendo la potencia de la línea láser utilizada. De manera similar, la ganancia y el desplazamiento de los fotomultiplicadores se deben ajustar cuidadosamente al comienzo de cada sesión de grabación para conseguir la mejor relación señal / ruido en las imágenes adquiridas, así como para evitar píxeles saturados. Todos estos parámetros pueden variar dependiendo del tipo de célula examinada, las características del biosensor y los instrumentos utilizados para la adquisición de imágenes (también se pueden utilizar microscopios de fluorescencia de campo ancho, como se ha descrito recientemente 13 ). Sin embargo, el investigador debe considerar siempre que durante la formación de imágenes in vivo , el nivel de ruido podría interferir con la señal específica del sensor más que en las grabaciones in vitro . Finalmente, si está disponible, las mediciones de control usando sondas mutantes, que no responden al voltaje, sería una manera convenientePara evaluar el nivel de ruido y / o artefactos específicos del sistema.

El empleo de embriones de pez cebra representa una característica clave de este enfoque gracias a su capacidad de respuesta a la manipulación genética y la investigación microscópica. De hecho, estas características hacen posible la transgénesis transitoria y el análisis basado en FRET de las propiedades eléctricas neuronales. En nuestra opinión, con las combinaciones de promotor y biosensor más adecuadas, sería potencialmente posible analizar selectivamente la actividad eléctrica de cualquier tipo de interés celular y paralelizar dicha actividad con el fenotipo embrionario.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Potencial de membrana de la neurona motora de Biosensing en los embriones vivos de pez cebra
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter