Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Поколение флуоресцентных слитых белков в doi: 10.3791/55333 Published: March 4, 2017

Summary

ПЦР-опосредованный модификация гена может быть использован для создания флуоресцентного белка слитые в видов Candida, что облегчает визуализацию и количественное определение дрожжевых клеток и белков. Здесь мы представляем стратегию построения флуоресцентного белка слияния (Eno1-FP) в Candida parapsilosis.

Abstract

Видов Candida, распространенных колонизаторами кишечника и мочеполового трактов, являются причиной большинства инвазивных грибковых инфекций у людей. Таким образом, молекулярные и генетические инструменты необходимы, чтобы облегчить изучение механизмов их патогенеза. ПЦР-опосредованный модификация гена является простой и быстрый подход к генерации эпитоп-меченных белков для облегчения их обнаружения. В частности, флуоресцентный белок (FP) расплавы являются мощными инструментами, которые позволяют визуализировать и количественно оценивать обоих дрожжевых клеток и белков с помощью флуоресцентной микроскопии и иммуноблотинга, соответственно. Плазмиды , содержащие кодирующие последовательности FP, наряду с питательными маркерные гены , которые облегчают превращение видов Candida, были получены с целью строительства FP и экспрессии в кандида. Здесь мы представляем стратегию построения фьюжн FP в видах Candida. Плазмиды, содержащие nourseothricin resistaсть гена трансформации маркера (NAT1) наряду с последовательностями либо зеленым, желтым или вишневого FPs (GFP, YFP, mCherry) используются наряду с использованием праймеров , которые включают в себя последовательность генов специфических в полимеразной цепной реакции (ПЦР) , чтобы создать кассету FP , Этот ген-специфический кассета имеет возможность интеграции в 3'-конце соответствующего локуса гена посредством гомологичной рекомбинации. Успешное в рамке считывания слияние последовательности FP в локус гена интереса проверяется генетически, с последующим анализом экспрессии слитого белка с помощью микроскопа и / или методов иммуно-обнаружения. Кроме того, для случая с высоким уровнем экспрессии белков, успешные слитые конструкции могут быть подвергнуты скринингу на в основном с помощью методов флуоресцентной томографии.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Виды Candida являются синантропных грибы , которые колонизируют кишечника и мочеполового трактов всех людей. В условиях иммунодефицитом, таких как , которые происходят с преждевременными родами или иммуносупрессивные эффекты от лечения рака, виды Candida может стать условно - патогенные возбудители. Из видов Candida, Candida Albicans является наиболее распространенным грибковым колонизатор и вызывает большинство инвазивных грибковых инфекций. Другие виды Candida , такие как C. glabrata, C. parapsilosis, C. tropicalis и C. kruseii также вызывают серьезные инфекции у пациентов с ослабленным иммунитетом, с некоторым проявляющего внутреннее сопротивление к часто используемым противогрибковые антибиотики , такие как флуконазол и амфотерицин В. Следовательно, инфекции с некоторыми из этих видов наблюдаются чаще, особенно у пациентов, проходящих лечение профилактически с противогрибковыми средствами. Даже при надлежащей и своевременной аNTI-грибковое лечение, инвазивные инфекции Candida по- прежнему связаны со значительной заболеваемостью и смертностью 1. Из - за важности видов Candida в состоянии здоровья людей, существует потребность в легко доступных молекулярных инструментов , которые позволяют исследование и выяснение механизмов их патогенеза.

Одним из важных инструментов, который позволяет исследователям визуализировать и количественно микробных клеток и белков, которые они выражают это технология слияния FP. Полимеразная цепная реакция (ПЦР) -опосредованного модификацию гена, как описано в данной работе, позволяет строить слитых конструкций , между ПС последовательностей и белок Кандида интерес последовательность кодирования на его геномного локуса. Стабильной интеграции конструкции облегчает анализ экспрессии белка, а также динамику локализации белков. Плазмиды , содержащие FP последовательности, оптимизированные для экспрессии в Candida Albicans и которые могут быть использованы в ПЦР-опосредованный гСтратегия модификации ена, которые были ранее построены 2, 3, 4, 5. Плазмиды содержат FP трансформация "кассеты": последовательность FP , связанный с питательной маркерного гена , который облегчает преобразование C. Albicans и С. parapsilosis 2, 3, 4, 5, 6, 7. Существующие в настоящее время Плазмиды содержат множество выбираемых питательных генов - маркеров (URA3, HIS1, arg4) для трансформации ауксотрофных штаммов, а также доминирующий устойчивости к лекарственному средству маркер (NAT1), что облегчает преобразование клинических штаммов , не имеющих auxotrophies. Кроме того, плазмиды содержат варианты до четырех различных последовательностей FP (зеленый [GFP], YelloW [YFP], циан [КФП], и вишня [mCherry]) и либо последовательность терминации ADH1 для построения карбоксиконец слитых белков, или последовательность промотора для построения аминоконца слитых белков. Праймеры конструируют с гомологией к плазмидной ДНК, окружающей кассету FP. Кроме того, праймеры также содержат 5'-удлинительные последовательности , несущие гомологию с геном дрожжей , представляющие интерес для быть помеченным, что облегчает интеграцию кассеты в геномную локус посредством гомологичной рекомбинации (рисунок 1). Гено-специфические FP кассеты генерируются с помощью ПЦР , а затем трансформировали в клетки Candida , сделанные компетентными для поглощения ДНК путем обработки ацетатом лития.

Рисунок 1
Рисунок 1: Схема , как слитые последовательности FP генерируются видов Candida. (А) плазмидной ДНК ВКЛЮЧАЕТэс последовательность FP и последовательности, кодирующей nourseothricin сопротивления (NAT1). Относительное расположение вперед (FWD) и обратном (REV) праймеров показаны с черными частями праймеров, обозначающих область гомологии с последовательностью плазмиды и фиолетовых участков, обозначающих геноспецифических область гомологии или удлинение праймера. (В) FP кассеты превращаются в Кандида и интегрировать в ENO1 геномного локуса посредством гомологичной рекомбинации (пунктирные линии). (C) результирующую последовательность слитого FP на 3'-ENO1. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Здесь мы приведем пример слитого белка (Eno1-FP) конструкций у видов Candida. Мы используем мечения плазмид , содержащих ген NAT1 преобразование маркера вместе с последовательностями , кодирующими GFP, YFP, илиmCherry (Рисунок 2). Эти плазмиды используются вместе с праймеров в ПЦР для генерации геноспецифических кассет , которые облегчают слияние РЗУ к 3'-концу ENO1, что приводит к экспрессии слитого с Eno1 FPs на его карбокси-конце.

фигура 2
Рисунок 2: Карты FP кассет , содержащих плазмид. Вперед (F) и обратный праймеры (R), которые используются для создания кассеты из плазмид показаны вместе с относительным расположением их гомологии с плазмидами. Последовательности праймеров, которые перечислены в таблице 1. F1 и R1 были также использованы для создания кассеты pYFP- NAT1. Плазмида , содержащая кассету YFP- NAT1 (pMG2263) идентичен pMG2120 за исключением YFP вместо последовательности GFP. Размеры кассеты: GFP-NAT1, 3,7 KBP; mCherry- NAT1, 3,2 т.п.н.; YFP- NAT1, 3.7 т.п.н.. Эта цифра была изменена из герами-Нежада и др. 4 Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Изолировать Шаблон Плазмиды из E.coli

  1. Grow E.coli , содержащий плазмиду шаблон в течение ночи в 10 мл лизогении бульона (LB) + 200 мг / л ампициллина (АМФ) при 37 ° C при встряхивании.
  2. Урожай клеток путем центрифугирования при 6000 мкг в течение 2 мин.
  3. Декантируют жидкость, выделения и очистки ДНК из E.coli клеток стандартным способом , как описано ранее в Ausubel с соавт. 8.
  4. ДНК Ресуспендируют в Трис-ЭДТА (ТЭ 10 мМ Трис, рН 8,0, 1 мМ ЭДТА, рН 8,0) при рабочей концентрации 50-100 нг / мл.

2. Дизайн Грунтовки

грунтовка Праймер Последовательность
F1 5 ' GGTGGTTCTAAAGGTGAAGAATTATT 3 '
R1 5 'GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC
GTAAAACGACGGCCAGTGAATTC 3 '
F2 5 'GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG
GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 '
R2 5 'GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC
ACTGGATGGCGGCGTTAGTATC 3 '

Таблица 1: Последовательности праймеров , используемые в данном исследовании. Жирный Курсив текст указывает гомологии к ENO1 геномного локуса, нормальных областей шрифта гомологичны плазмидной ДНК.

    <литий> Дизайн праймеров гомологичными плазмиде последовательности , граничащие кассеты, подлежащей амплификации , а также к 3'-концу гена - мишени , представляющего интерес (например , ENO1) для облегчения рекомбинации в геномную локусе гена (рис 2 и таблица 1) ,
    1. Убедитесь, что последовательности прямого праймера соответствуют последние 70 пар оснований (п.о.), из представляющего интерес гена, 5'- 3 ', минус стоп-кодон, для поддержания кадра кодирования, плюс первый приблизительно 30 пар оснований последовательности плазмиды быть усиливается. В записке, в GGTGGTGGTT каждого праймера представляет собой поли-глицина линкер, без FP гомологии. Следует отметить, что при отсутствии линкера, может быть прямым сплавлением функциональных доменов, которые теоретически могут привести к белковой неправильного сворачивания, низким выходом продукции белка, или ослабленным биоактивности.
    2. Убедитесь в том, что обратные последовательности праймеров 70 п.н. непосредственно ниже гена, 3'- 5 ', не включая любую последовательность гена, плюс последний APPROximately 30 п.н. питательного или устойчивости к лекарственному средству маркера, используемого в плазмиде.
    3. Используйте F1 и R1 для создания GFP- NAT1 и YFP- NAT1 кассеты с pMG2120 и pMG2263, соответственно и F2 и R2 для создания mCherry- NAT1 с pMG2343.

3. Сформировать FP Кассеты с помощью ПЦР (1 день)

  1. Подготовка реагентов для ПЦР. Делают основной смеси (500 мкл конечный объем) путем добавления следующих объемы и концентрации в 1,5 мл трубки: 50 мкл ПЦР-буфера (500 мМ хлорида калия, 100 мМ Трис, рН 8,0, в воде), 20 мкл дезоксинуклеотидов (дНТФ; запас смеси нуклеотидов в 10 мМ каждого), 40 мкл 25 мМ хлорида магния, 20 мкл плазмиды очищали (от ~ 50-100 нг / мкл исходного раствора), 10 мкл каждого вперед и обратного праймера (от 10 мМ растворов), 30 мкл Taq полимеразы (родовое, 5000 единиц / мл), и 320 мкл воды.
    1. Аликвоты 50 мкл основной смеси в каждую из 10 ПЦР-compatibле 0,5 мл пробирки.
  2. Поместите ПЦР-пробирки в амплификатор и выполните следующие действия: 1 цикл 5 мин при 94 ° С для денатурации дц; 40 циклов последовательно 45 сек при 94 ° С, 30 сек при 55 ° С, чтобы позволить праймеры отжечь с матричной ДНК плазмиды, и 4 мин при 68 ° С для расширения продуктов ДНК; и 1 окончательное удлинение цикла 15 мин при 72 ° С.
    Примечание: Мастер микс ПЦР и велосипедные параметры могут должны быть изменены на основе конкретного Taq полимеразы.
  3. Бассейн все продукты из 10 реакций ПЦР в 1,5 мл трубки.
    1. Предметные 5 мкл продукта ПЦР объединенном электрофорезу в агарозном геле, чтобы проверить размер ампликона и получить оценку концентрации продукта, основанный на сравнении с лестницей ДНК. Как правило, используют ~ 250 мкг кассетной ДНК в каждой последующей смеси трансформации.
    2. Осадить ДНК добавлением ацетата 50 мкл 3 М натрия, а затем 750 мкл 95% этанола к продуктам и инкубировать по меньшей мере, 30 минпри -20 ° С
    3. Урожай продуктов ПЦР при центрифугировании трубки при 16000 х г в течение 10 мин. Осторожно снимите и выбросьте супернатант и высушить осадок в течение ночи. Ресуспендируют высушенного кассетной ДНК гранул в 40 мкл ТЕ рН 8,0 и не хранить при комнатной температуре до момента использования.

4. Преобразовать Кандида клетки с ДНК FP кассетах

  1. На 1-й день, восстановить штамм дрожжей трансформироваться из 15% глицерина в замороженном состоянии (-80 ° C) запас штриховой разводкой несколько Царапины кристаллов на дрожжевой пептон декстроза с аденин (YPAD) агар и инкубировать при температуре 30 ° C. После восстановления роста колоний, прививают одну колонию в 2 мл жидкой среды YPAD в стеклянной трубке с культуральную воздухопроницаемой крышкой и инкубировать в течение ночи при 30 ° С при перемешивании.
  2. На 2 -й день, развести 300 мкл ночной культуры дрожжей в 50 мл свежего YPAD (до конечной OD 600 из ~ 0,2) в 125 мл колбу Эрленмейера с воздухопроницаемой крышкой. Встряска при 30 ° Cв течение ~ 3 ч (до конечной OD 600 ~ 0,6-0,8).
    1. Налейте Ночную культуру в коническую пробирку емкостью 50 мл, и в пробирке осадка клеток путем прядения в течение 5 мин при 1 500 мкг в настольную центрифугу.
    2. Слить и должным образом отбросить супернатант. Ресуспендируют осадок клеток в 5 мл воды. Повторное осаждения клеток центрифугированием снова в течение 5 мин при 1500 х г в настольную центрифугу.
    3. Слить и должным образом отбросить супернатант. Ресуспендируют клеток в 500 мкл ТЕ (TELiAc ацетат лития: 10 мМ Трис, рН 8,0, 1 мМ ЭДТА, рН 8,0, 0,1 М ацетата лития) при переходе к 1,5 мл трубки. Отцентрифугировать пробирку в течение 2 мин при 3000 х г в микроцентрифуге.
    4. Ресуспендируют клеток в 250 мкл TELiAc. Общий объем в том числе окатышей должна быть ~ 300 мкл.
  3. В чистую (другую , чем пробирке в разделе 4.2.4), добавьте по 5 мкл ДНК - носитель (10 мг / мл) и 150 мкл приготовленных клеток Candida (из 4.2.4). Это отрицательный контроль за тransformation.
    1. Для второй чистой пробирке, добавляют 5 мкл денатурированной ДНК-носителя (который кипячения при температуре 90 ° С в течение 10 мин и охлаждают до 4 & deg; С), все 40 мкл полученного продукта ПЦР (из раздела 3.3.1) и 150 мкл подготовленных клеток Candida (от 4.2.4).
    2. Инкубируйте две преобразованные смеси в течение 30 мин при комнатной температуре.
    3. В каждую пробирку смеси трансформации, добавьте 700 мкл PLATE смеси (10 мМ Трис, рН 8,0, 1 мМ ЭДТА, рН 8,0, 0,1 М ацетата лития в 50% полиэтиленгликоль 3350). Обратить трубы, чтобы смешать и инкубировать их в течение ночи при комнатной температуре.
  4. На 3-й день, инкубировать превращение смеси при 42 ° С в течение 1 ч (теплового шока).
    1. Центрифуга превращение смеси в течение 30 сек при 16000 мкг в микроцентрифуге. Удалить и надлежащим образом отбросить супернатант. Ресуспендируют каждый из гранул клеток в 150 мкл воды, осторожно пипеткой вверх и вниз таким образом, чтобы не повредить клетки.
    2. Для преобразований утilizing ауксотрофные маркерных генов (например , URA3), плиты каждый всю смесь с помощью пипетки решения на соответствующий селективной среде агара (например , отсутствие уридин) и распределите смесь равномерно , используя стерильные стеклянные шарики.
    3. Для преобразований , использующих nourseothricin ген устойчивости к маркере (NAT1), как описано здесь, преобразование пластина смешивает сначала на неселективного YPAD агар и инкубируют при температуре 30 ° C в течение 6-12 ч. Этот шаг способствует восстановлению клеток, пост теплового шока, перед nourseothricin стресс применяется.
    4. После частичного восстановления роста, реплики пластины клетки кандиды на YPAD , содержащий 400 мкг / мл nourseothricin. Для преобразований , использующих пищевые гены - маркеры (например , URA3), этот промежуточный этап покрытие не требуется , и клетки могут быть непосредственно высевали на селективные среды дрожжей (например , YPAD не хватает уридина) , как описано в разделе 4.4.2.
      Примечание: Если преобразование прошло успешно, Colonies должен появиться в течение от одного до трех дней (потенциально до пяти дней вырост для селекции на nourseothricin содержащих агар). Колонии не должны появляться на пластинах распространяются с трансформацией смесями, содержащими ДНК-носитель в одиночку (отрицательный контроль).
  5. Для ауксотрофной и nourseothricin маркера селекции, Штриховатост предполагаемыми трансформантов в виде отдельных колоний на свежий чашках с агаром селективную среду и инкубировали при 30 ° С для распространения дрожжевых клеток, которые могут быть подвергнуты скринингу для успешного строительства ПС слитых конструкций.
  6. Трансформанты экрана для правильной интеграции мечения кассеты (см Представитель результаты подробного примера). Если интерес ген экспрессируется в достаточном количестве, вся колония флуоресценция может происходить таким образом, что можно обнаружить потенциальные интегрантов-кандидатов с использованием системы формирования изображения Тарелка с возможностью детектирования флуоресценции.
    1. Проверьте предположительные интегрантов с помощью ПЦР с использованием праймеров, гомологичных последовательностей outsidе области интегрирования для подтверждения слияние с геном-мишенью.
    2. Кроме того, рассмотрим вестерн-блот анализ, чтобы определить экспрессию и размер гибридного белка, а также с помощью флуоресцентной микроскопии одиночных клеток для визуального подтверждения локализации белка, если оно известно.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В качестве примера, мы использовали протокол , описанный выше для построения GFP и mCherry слитые к Eno1 в С. parapsilosis лабораторного штамма. Каждый предполагаемый трансформант был первоначально пересевали штрихом для роста. В этом примере, поскольку полученный гибридный белок экспрессируется на высоком уровне (енолаза) и ФПС светлые, мы были в состоянии скрининга трансформантов с помощью флуоресцентной микроскопии перед проведением диагностической ПЦР (Рисунок 3) 6.

Рисунок 3
Рисунок 3: Colony флуоресценции выставлены Candida трансформантов. Типичные изображения роста дрожжей пластины получали с использованием лазерной сканирующей системы, оснащенной Cy3 фильтром для изображения mCherry экспрессирующих штамма и су2 фильтра к изображению YFP- и штаммов GFP-экспрессирующих. Левая панель в каждой паре, FP-Expressiнг штаммов; правая панель в каждой паре, нетрансформированных родительский штамм (4175), полученную с использованием того же фильтра, что и соответствующий FP-выражающего штаммом. После визуализации изображения переворачивали и яркость и контрастность были скорректированы одинаково для FP-выражения и контрольных штаммах. Эта цифра перепечатано с разрешения Гонии и др. 6 Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Геномную ДНК выделяли 9 из каждой из этих мнимых трансформантов и использовали в качестве ДНК - матрицы, наряду с праймеров , комплементарных последовательностей , фланкирующих сайты интеграции кассеты (т.е. последовательностей за пределами того, где F и R праймеры отжигают в течение предполагаемого геномного локуса , чтобы быть помечены) , в диагностических ДЗП для проверки правильности интеграции кассеты FP только прIOR до стоп-кодона гена. Следует отметить, что для ацетата лития преобразований с C. parapsilosis, мы наблюдали более низкую эффективность (~ 1-2% колоний экранированных содержали правильную интеграцию) по сравнению с нашим опытом с C. Albicans преобразований.

Для анализа локализации энолаза, мы наблюдали дрожжевых клеток, экспрессирующих Eno1-FP конструирует с помощью флуоресцентной микроскопии с использованием photomicroscope оснащенную 100 Вт ртутной лампой и эпифлуоресцентной подсветкой с GFP, YFP и наборы Texas Red фильтров. Зарядовой связью (ПЗС) , камера использовалась для сбора изображений , которые были обработаны с помощью программного обеспечения для анализа изображений (Рисунок 4A) 6. Кроме того, мы обнаружили , что различные цвета FP были полезны для визуально различить различные штаммы дрожжей в смеси (фиг.4В) 6. Поскольку энолаза высоко выражена и находится вбольшая часть дрожжевой клетки, FP - расплавы к нему могут быть использованы для создания флуоресцентных штаммов дрожжей , которые могут быть легко визуализированы, например, в анализах кандидозного -host взаимодействий.

Рисунок 4
Рисунок 4: Экспрессия и локализация Eno1-FP слитых с помощью флуоресцентной микроскопии. (A) флуоресценция (вверху) и дифференциального интерференционного контраста (DIC, снизу) изображения для штаммов Candida выражения Eno1-ФПС. Eno1-Рамочные у C. Albicans и С. parapsilosis имеют тенденцию концентрироваться в ядре, а также в цитоплазме, но в значительно меньшей степени. (Б) Микроскопические изображения смешанной культуры штаммов Candida , экспрессирующих Eno1-mCherry и Eno1-GFP. Правая панель, Texas красный фильтр; центральная панель, GFP фильтр; правая панель, слияние двух флуоресцентных панелей с изображением DIC. Шкала баров = 10 мкм. Эта цифра перепечатано с разрешения Гонии и др. 6 Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

FP слитые также облегчают анализ уровней экспрессии белка с помощью Вестерн-блоттинга. С помощью дрожжевых клеток , генерируемых протоколом , описанным выше, белки были выделены из лизатов клеток, разделенных додецилсульфатом натрия-электрофорез в полиакриламидном геле (SDS-PAGE) и переносили на поливинилидендифторидную (PVDF) мембрану 10. Eno1-FP - расплавы были обнаружены на блоттинга с использованием коммерчески доступных антител , как описано выше 6. В кратком изложении, мышиное анти-GFP (1: 2000 разведение), а затем конъюгированными с пероксидазой хрена козьими антителами против мышиного IgG (1: 10000) разведений антитела использовали зонд для GFP- и YFP-таgged энолаза. Кролик анти-mCherry (1: 2000 разведение) с последующим конъюгированного с пероксидазой хрена козьего антитела против IgG кролика (1: 10000 разведение) антитела использовали зонд для mCherry-меченого енолазы. Все слитые белки легко обнаружить из лизатов успешных трансформантов (рисунок 5, полос 2, 5, и 7) , 6 и были ожидаемого размера (~ 75 кДа) по сравнению со стандартом , белковый лестничного и стандарты C. Albicans энолаза-FP ( На рисунке 5, полосы 1 и 6) 6. Ни один сигнал не наблюдалось для немаркированной штамма родительского дрожжей (рисунок 5, дорожки 3 и 4) 6.

Рисунок 5
Рисунок 5: иммуноблот - клеточных лизатов из штаммов Candida. Дорожка 1, C. Albicans , содержащие ENO1 -mCherry слияние (J. Berman, Университет штата Миннесота)(Положительный контроль); дорожка 2, С. parapsilosis содержащий ENO1 -mCherry слияние; полосы 3 и 4, нетрансформированный С. parapsilosis родительский штамм 4175 11 (отрицательный контроль); полоса 5, С. parapsilosis содержащий ENO1 -YFP слияние; дорожка 6, C. Albicans , содержащие ENO1 -GFP слияние (J. Бермана, Университет Миннесоты) (положительный контроль); полоса 7, С. parapsilosis содержащий ENO1 -GFP слияние; полоса L, белок лестница с 98 и 64 белковых стандартов кД указанных. Дорожки 1-3, инкубировали с анти-антителом mCherry и Дорожки 4-7, инкубировали с анти-GFP антитела. Эта цифра перепечатано с разрешения Гонии и др. 6 Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Протокол Шаг / Пункт модификация Потенциал улучшения (предостережений)
Грунтовка дизайн Удлиняет праймеры, включив в более длинный область гомологии к геномного локуса интереса Повышение эффективности и связывания гомологичной рекомбинации (изменение длины праймера может изменить оптимальную температуру отжига)
ПЦР (качество ампликонов) Используйте более высокую точность воспроизведения Taq
Гель очищают ПЦР-продукт
Уменьшить введение ошибок в кассетные последовательностей для улучшения ориентации праймера генома последовательности и эффективности трансформации (очистка гель может уменьшить количество ампликона и, следовательно, эффективность преобразования)
ПЦР (количество ампликонов) Увеличение числа реакций ПЦР и пуллам повые число трансформированных клеток (слишком много ампликона может также привести к снижению эффективности трансформации)
Кассетный осадков Выполните центрифугирования при 4 ° С, держать все реагенты и пробирки на лед Увеличение урожайности ДНК и, следовательно, эффективность трансформации
Тепловой удар Сократить время Повышение жизнеспособности нагруженных клеток дрожжей (более короткое время теплового шока также может привести к снижению поглощения кассеты ДНК клетками)
Восстановление роста 1 Разрешить для более длительного восстановления на YPAD агар, прежде чем покрытие на агар, содержащий nourseothricin Подчеркнул клетки дрожжей может потребоваться более длительное время восстановления при воздействии nourseothricin (более длительное время инкубации также может увеличить загрязнителя и ложно-положительный рост трансформированный)
Колонии вырост 1,2 Инкубируйте пластины в течение более длительного времени (~ 5 г) улицаволосы погладила клетки дрожжей может потребоваться более длительное время инкубации для роста колоний (более длительное время инкубации также может увеличить загрязнителя и ложно-положительный рост трансформированный)
1 Конкретная преобразований с помощью выбора NAT1 маркер или 2 преобразования дрожжевых штаммов , содержащих генетические мутации , которые влияют на рост

Таблица 2: Руководство по поиску неисправностей и оптимизации.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Конструирование эпитопа помечено последовательностей в видов Candida с использованием ПЦР-опосредованный стратегии генной модификации , описанной выше , может быть охарактеризован как трехступенчатый процесс. Во-первых, кассета выполнена с помощью ПЦР, который кодирует и последовательности необходимых для интеграции и областей, гомологичных локус вставки в геном дрожжей. Во-вторых, клетки дрожжей, которые будут трансформированы изготовлены химически компетентны с ацетат лития и совместно инкубируют с кассетой. В-третьих, клетки высевают на селективную среду для восстановления трансформантов и полученные колонии тестируют на правильной интеграции кассеты в желаемом геномного локуса.

Есть несколько важных шагов в рамках этого протокола , чтобы улучшить показатель успешности получения флуоресцентного слитого белка в С. Albicans и С. parapsilosis. Во-первых, использование праймеров, которые очищают с помощью электрофореза в полиакриламидном геле (ПААГ, производителем) является весьма ЗАПмендуется. Без очистки, существует повышенная вероятность получения праймеров неправильных длины в конечном продукте, что может привести к снижению эффективности, с которой кассета встраивается в предполагаемой геномного локуса путем гомологичной рекомбинации. Во-вторых, мы рекомендуем проверить, что ПЦР-генерируемые мечения кассета имеет высокое качество, путем анализа ~ 5 мкл кассетной ДНК с помощью электрофореза в агарозном геле, чтобы обеспечить правильный размер продукта ПЦР. В-третьих, чтобы получить дрожжевых клеток, которые оптимизированы для трансформации, клетки должны быть в логарифмической фазе роста, с дрожжевыми бутонов очевидными с помощью микроскопии до их использования. В-четвертых, крайне важно использовать мягкий метод пипетирования во время рефиксацией трансформированных клеток дрожжей после теплового шока и перед металлизированный на селективной среде. В-пятых, для отбора трансформантов на nourseothricin, который является токсичным для клеток дрожжей, что позволяет больше времени для роста на YPAD агар, прежде чем тиражирование на nourseothricin среде, содержащей может быть beneficial содействовать восстановлению трансформантов. Последнее, неповрежденным плазмида и интеграция кассетного ПЦР за пределами предполагаемого местоположения геномной действительно имеет место при низких частотах в Кандида и также приведет к росту колонии. Таким образом, необходимо проанализировать все трансформированных колоний с помощью ПЦР с использованием праймеров, вне последовательности, используемой для интеграции. Для получения трансформантов, которые проверены с помощью ПЦР, но не проявляют флуоресценцию с помощью микроскопии, Вестерн-блот-анализ клеточных лизатов и секвенирование следует рассматривать для дальнейшего исследования причин для строительства или неудачи визуализации. В дополнение к этим критическим шагам, есть несколько шагов, в протоколе, которые могут быть изменены, в случае необходимости, для повышения эффективности трансформации и увеличить частоту правильной интеграции кассеты. Руководства по устранению неисправностей приведена в таблице 2.

Существуют потенциальные недостатки этого метода, которые могут быть оптимизированы для будущих приложений. lithiuМетод м ацетат используется для результатов трансформации ДНК приводит к более низкой эффективностью (~ 1-2% колоний экранированных содержали правильную интеграцию) для C. parapsilosis 12, по сравнению с C. Albicans. Электропорация является альтернативным подходом к трансформации ацетата лития , что может повысить эффективность преобразования 13. Использование терминатора ADH1, в то время как необходимо для универсального метода мечения, может изменить стабильность и / или регулирования генерируемой мРНК из того , что произошло бы с нативной последовательностью терминатора. Этот потенциальный вопрос должен быть рассмотрен, когда нативный функция белка имеет важное значение для конкретного вопроса исследования. Для флуоресцентных слитых белков, которые экспрессируются на низких уровнях, целая колония микроскопии для идентификации или экран для успешных трансформантов не может быть вариантом. В этом случае, ПЦР и западные анализы блот предоставит доказательства успешной слитого белка sequENCE / белковый строительство. Ограничением, общие для всех слитый белок конструкций, в том, что эпитоп теги могут помешать нативной функции белка, что приводит к непредвиденным мутантных фенотипов, в том числе аномальной локализации слитого белка. Рассмотрение этих вопросов имеет важное значение и соответствующие меры контроля должны быть включены, как указано.

Плазмиды , используемые для генерации эпитопа теги в Кандида с помощью этой ПЦР-опосредованный подход, в дополнение к тем , которые упомянуты здесь, которые ранее были сформированы нашими исследовательскими группами и доступны для исследователей через грибкового Genetics Stock Center (HTTP: //www.fgsc. сеть). Более подробную информацию о некоторых из этих плазмид, также можно найти на сайте (http://www6.tau.ac.il/berman/). Доступные плазмиды содержат множество комбинаций маркеров питания и наркотиков сопротивления, FP последовательности, чтобы создавать различные цветные дрожжи, другие варианты эпитоп тегов (HA, Мус, V5, HIS9) для создания белков, которые А.Р.е помечено либо на карбокси- или амино-конца, и последовательности промотора для конститутивной и регулируемом экспрессии белков. Плазмиды, содержащие маркеры устойчивости к медикаментам особенно полезны для области грибкового патогенеза, как этот инструмент позволяет для трансформации и изучения клинических штаммов дрожжей, которые прототрофного, что делает обычные пищевые маркеры непригодным для использования. Построение клинических штаммов Candida , которые флуоресцируют при различных длинах волн , будет полезен для различных клеточных биологических анализов , которые требуют способности визуализировать и дифференцироваться множество штаммов дрожжей в совместной культуре.

Инвазивные грибковые заболевания из - за видов Candida продолжает быть важным человеком проблемой здравоохранения , которая трудно поддается лечению и ассоциируется с высокими показателями заболеваемости и смертности, особенно у пациентов с иммунодефицитом 14, 15. Таким образом, молекулярные инструменты, которые позволяют исследованияERS более быстро и легко изучить Кандида видовой хост взаимодействия имеют жизненно важное значение для углубления нашего понимания биологии и патогенеза механизмов Candida.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Мы благодарим Н. Дина за предоставление исходной последовательности mCherry FP, М. герами-Неджад для построения плазмид, Б. Ларсон об оказании технической помощи, а также Т. Heisel за полезные советы в процессе разработки этого проекта. JB был поддержан Европейским Research Council Advanced Award 340087 (RAPLODAPT). Микроскопия и системы визуализации были предоставлены Университетом штата Миннесота Pediatrics Foundation и Университета Миннесоты Центра обработки изображений.

Materials

Name Company Catalog Number Comments
100 W mercury lamp CHIU Technical Corporation M-100T
95% Ethanol Any NA
Adenine Any NA
Ampicillin Any NA
Carrier DNA Ambion AM9680 Sheared Salmon Sperm DNA 10 mg/ml
CCD Camera Photometrics CoolSNAP HQ
Conical Tube Corning 430828 50 ml
Culture Tube Rotator New Brunswick 2013923 TC-8, or Any Culture Tube Rotator
Deoxynucleotides (dNTP) PCR Grade Any NA
Eppendorf Tubes Eppendorf 022363719, 022363212 0.5 ml, 1.5 ml
Erlenmeyer Flask Fisher Scientific 7250089 125 ml
Ethylenediaminetetraacetic Acid (EDTA) Any NA
Freezer (-80 °C) Thermo Electron Corporation ULT-1386-9-V Revco Ultima II
GFP, YFP and Texas Red Filter Sets Chroma Technology Corporation 49002, 86004v2, 49008
Glass culture tubes Fisher Scientific 1496126 75 mm
HRP goat anti-mouse antibody Santa Cruz Biotechnology SC-2005
HRP goat anti-rabbit antibody Santa Cruz Biotechnology SC-2301
Incubator (30 °C) Any NA
Lithium Acetate Any NA
Lysogeny Broth (LB) Media Any NA
Magnesium Chloride Any NA
Microcentrifuge Eppendorf 5415 D
Microscope Nikon E600 Nikon Eclipse E600
Microscope Image Analysis Software Universal Imaging Corporation 6.3r7 MetaMorph Software Series 6.3r7
Mouse anti-GFP antibody Roche 11814460001
Nourseothricin Fisher Scientific 50997939
PCR Thermocycler Applied Biosystems 9700 GeneAmp PCR System
PCR tubes BioExpress, GeneMate T-3035-1 0.2 ml
Polyethylene Glycol 3350 Any NA
Potassium Chloride Any NA
Rabbit anti-mCherry antibody BioVision 5993-100
Refrigerator (4 °C) Any NA
Sodium Acetate Any NA
Stereomicroscope Nikon SMZ1500
Table Top Centrifuge Labnet Z 400 Hermle Z 400
Taq DNA Polymerase Any NA
Tris(hydroxymethyl)aminomethane (Tris) Any NA
Vortex Mixer Scientific Industries SI-0236 Vortex Genie 2
Yeast Extract Peptone Dextrose (YPD) Media Any NA

DOWNLOAD MATERIALS LIST

References

  1. Bendel, C. M. Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis. Semin. Perinatol. 27, (5), 357-364 (2003).
  2. Gerami-Nejad, M., Berman, J., Gale, C. A. Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans. Yeast. 18, (9), 859-864 (2001).
  3. Gerami-Nejad, M., Dulmage, K., Berman, J. Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans. Yeast. 26, (7), 399-406 (2009).
  4. Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. Analysis of protein function in clinical C. albicans isolates. Yeast. 29, (8), 303-309 (2012).
  5. Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans. Yeast. 21, (5), 429-436 (2004).
  6. Gonia, S., Larson, B., Gale, C. A. PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis. Yeast. 33, (2), 63-69 (2016).
  7. Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance. Yeast. 28, (12), 833-841 (2011).
  8. Ausubel, F. M., et al. Current Protocols in Molecular Biology. Wiley. New York. (1995).
  9. Wilson, R. B., Davis, D., Mitchell, A. P. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181, (6), 1868-1874 (1999).
  10. Pulver, R., et al. Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans. Eukaryotic Cell. 12, (4), 482-495 (2013).
  11. Falgier, C., et al. Candida species differ in their interactions with immature human gastrointestinal epithelial cells. Pediatr. Res. 69, (5), 384-389 (2011).
  12. Nosek, J., et al. Genetic manipulation of the pathogenic yeast Candida parapsilosis. Curr. Genet. 42, (1), 27-35 (2002).
  13. Zemanova, J., Nosek, J., Tomaska, L. High-efficiency transformation of the pathogenic yeast Candida parapsilosis. Curr. Genet. 45, (3), 183-186 (2004).
  14. Benjamin, D. K., et al. Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months. Pediatrics. 117, (1), 84-92 (2006).
  15. Kullberg, B. J., Arendrup, M. C. Invasive Candidiasis. N Engl J Med. 373, (15), 1445-1456 (2015).
Поколение флуоресцентных слитых белков в<em&gt; Кандида</em&gt; Виды
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gonia, S., Berman, J., Gale, C. A. Generation of Fluorescent Protein Fusions in Candida Species. J. Vis. Exp. (121), e55333, doi:10.3791/55333 (2017).More

Gonia, S., Berman, J., Gale, C. A. Generation of Fluorescent Protein Fusions in Candida Species. J. Vis. Exp. (121), e55333, doi:10.3791/55333 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter