Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

सुव्यवस्थित एकल कोशिका TCR अलगाव और सिंड्रम वैक्टर के लिए पीढ़ी के लिए इन विट्रो और Vivo में मानव TCRs की अभिव्यक्ति

doi: 10.3791/55379 Published: September 10, 2017

Summary

वर्तमान प्रोटोकॉल एकल सेल युग्मित मानव TCR अल्फा और बीटा श्रृंखला sequencing सिंड्रम वैक्टर के साथ संगत इन विट्रो में और vivo TCR अभिव्यक्ति की सुव्यवस्थित पीढ़ी के साथ जोड़ती है ।

Abstract

हालांकि, एकल टी कोशिकाओं से जोड़ा टी सेल रिसेप्टर (TCR) अल्फा और बीटा जंजीरों के अनुक्रमण के लिए कई तरीके विकसित किया गया है, कोई भी अब तक vivo में बहाव के लिए अनुकूल है TCR heterodimers के कार्यात्मक विश्लेषण । हम एक दो कदम मल्टीप्लेक्स-नेस्टेड पीसीआर पर आधारित एक बेहतर प्रोटोकॉल विकसित किया है, जो एक पीसीआर उत्पाद है कि एक मानव TCR अल्फा और बीटा श्रृंखला के पूरे चर क्षेत्रों में फैले परिणाम है । अद्वितीय प्रतिबंध साइटों की पहचान करने और उन्हें पीसीआर प्राइमरों में शामिल करके, हम पीसीआर सिंड्रम वेक्टर टेम्पलेट में सीधे उप-क्लोनिंग के साथ संगत उत्पाद बना दिया है । परिणामी सिंड्रम constructs एक chimeric मानव/माउस TCR के साथ एक माउस intracellular डोमेन, जो माउस के कक्षों में या में vivo माउस मॉडल में कार्यशील है । कुल मिलाकर, यहां वर्णित प्रोटोकॉल मानव एकल कोशिका युग्मित TCR अल्फा और सिंड्रम वैक्टर के सुव्यवस्थित पीढ़ी के साथ बीटा श्रृंखला पहचान को जोड़ती है इन विट्रो में के लिए आसानी से अनुकूलनीय और vivo TCR अभिव्यक्ति में । विडियो और साथ वाली सामग्री सिंगल सेल पीसीआर का बेहद विस्तृत विवरण देने के लिए तैयार किया गया है, ताकि महत्वपूर्ण कदमों का पीछा किया जा सके और संभावित नुकसान से बचा जा सके । इसके अतिरिक्त, हम क्लोनिंग अभिव्यक्ति वेक्टर उत्पंन करने के लिए आवश्यक कदम का एक विस्तृत विवरण प्रदान करते हैं । एक बार महारत हासिल करने के बाद, एक TCR अभिव्यक्ति के लिए छंटाई कक्ष से पूरी प्रक्रिया एक छोटी दो सप्ताह की अवधि में किया जा सकता है ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

टी सेल रिसेप्टर (TCR) विकास के दौरान टी सेल भाग्य निर्णय हुक्म, स्थिर राज्य/homeostasis, और प्रतिजनी उत्तेजना परिधि में1,2,3. गहरी अनुक्रमण प्रौद्योगिकियों के हाल के विस्तार प्रतिजन विशिष्ट टी सेल प्रतिक्रियाओं के भीतर एक पहले से सराहना की TCR विविधता खुला है । TCR विविधता कार्यात्मक व्यापक टी सेल प्रतिक्रियाओं के लिए एक संभावित पता चलता है । आदेश में TCR कार्यात्मक परख के साथ TCR अनुक्रम प्रदर्शनों की कार्यक्षमताओं विश्लेषण को एकीकृत करने के लिए, अनुक्रमण दृष्टिकोण प्रयोगात्मक प्रणालियों के साथ संगत होने के लिए डिज़ाइन किया जाना चाहिए और का चयन के बाद कार्यात्मक विश्लेषण के लिए उपयोग vivo मॉडल में TCRs । हम मानव TCR अनुक्रम अलगाव के लिए एक कुशल दृष्टिकोण विकसित की है और सुव्यवस्थित उप एक chimeric मानव में क्लोनिंग/TCR टेंपलेट वेक्टर एचएलए में TCR अभिव्यक्ति के साथ संगत-मानव चूहों4। इसी अल्फा और heterodimeric TCRs के बीटा श्रृंखला का अलगाव एक ही सेल से दोनों श्रृंखलाओं के पीसीआर प्रवर्धन की आवश्यकता है । हालांकि, कई एकल सेल TCR क्लोनिंग प्रोटोकॉल विकसित और उपयोग किया गया है, कोई भी अब तक आसानी से उच्च प्रवाह के साथ संगत कर दिया गया है अज्ञात Vα/Vβ TCRs के सिंड्रम वैक्टर में पुनः के लिए आवश्यक के प्रत्यक्ष क्लोनिंग-अभिव्यक्ति vivo में 4,5,6,7. पिछले अध्ययनों से दो प्रमुख दृष्टिकोण का उपयोग किया है, या तो चुनिंदा को अनुक्रम एक्सट्रपलेशन पर्याप्त TCR के एक सीमित भाग बढ़ाना, या पूरे TCR अनुक्रम बढ़ाना4,5,6 , 7. TCR अनुक्रम के बहाव कार्यात्मक विश्लेषण पहले दृष्टिकोण के माध्यम से प्राप्त की silico विधानसभा और TCR के de नोवो निर्माण में महंगाई की आवश्यकता है । जबकि दूसरा दृष्टिकोण पूरा TCR अनुक्रम प्रदान करता है, मानव निरंतर क्षेत्र के साथ संगत नहीं है vivo अभिव्यक्ति में माउस मॉडल में क्लोन TCRs. हमारे दृष्टिकोण विशेष रूप से माउस मॉडल में TCRs के vivo कार्यात्मक विश्लेषण में के साथ संगत होना करने के लिए डिज़ाइन किया गया है । हम एक कुशल और सुव्यवस्थित एकल सेल पीसीआर प्रोटोकॉल है कि प्रत्यक्ष उप के लिए अनुमति देता है विकसित-पीसीआर टुकड़े के टेंपलेट अभिव्यक्ति वेक्टर में क्लोनिंग ।

हमारे दृष्टिकोण एक अति संवेदनशील मल्टीप्लेक्स नेस्टेड पीसीआर प्रतिक्रिया है कि दो चरणों में किया जाता है का उपयोग । पहले मल्टीप्लेक्स प्रतिक्रिया कदम में सभी वी बीटा श्रृंखला के लिए विशिष्ट ४० प्राइमरों के एक पूल और ४४ प्राइमरों के एक पूल सभी के लिए विशिष्ट वी-अल्फा चेन अनुक्रम (तालिका 1) के पूर्व ज्ञान के बिना TCR-अल्फा या TCR-बीटा बढ़ाना इस्तेमाल कर रहे हैं. फॉरवर्ड प्राइमर एक अनुकूलक अनुक्रम है, जो पीसीआर उत्पाद के 5 ' में शामिल किया गया है । रिवर्स प्राइमर TCR के लगातार क्षेत्र पर आधारित है । हम अद्वितीय प्रतिबंध साइटों है कि मानव चर या जंक्शन TCR क्षेत्रों से अनुपस्थित रहे है की पहचान की है, और नए बदल दिया TCRα और TCRβ प्राइमरों में इन शामिल (चित्रा 1) । दूसरी नेस्टेड प्रतिक्रिया में, एक पुस्तक अनुकूलक अनुक्रम के लिए विशिष्ट और निरंतर क्षेत्र के भीतर एक नेस्टेड रिवर्स प्राइमर आगे वृद्धि की विशिष्टता के साथ TCR श्रृंखला बढ़ाना (तालिका 1, चित्रा 1) का उपयोग किया जाता है । एकल कोशिका अलगाव के बाद, पीसीआर के दो दौर (दोनों Vα और Vβ प्राइमरों के एक पूल के साथ पहली प्रतिक्रिया है, और दूसरा अनुकूलक प्राइमरों के साथ) एक पीसीआर उत्पाद है कि सीधे उप हो सकता है सिंड्रम वेक्टर टेंपलेट में क्लोन में परिणाम । अंतिम TCR निर्माण सांकेतिक शब्दों में बदलना होगा, एक खुला पढ़ने के फ्रेम में (ओआरएफ), मानव चर लगातार ' स्वयं से जुड़े क्षेत्रों के साथ संयुक्त क्षेत्र-सट ' प्रोटीन अनुक्रम, P2A (hVα-mCα-P2A-hVβ-mCβ)8। P2A अनुक्रम कई प्रणालियों में इस्तेमाल किया गया है, और बड़े पैमाने पर TCRs की अभिव्यक्ति के लिए विशेष रूप से परीक्षण किया गया है8,9,10,11. हालांकि, P2A अनुक्रम का सबसे अनुवाद के बाद सी से जुड़ा हुआ है अल्फा श्रृंखला के एक लचीला linker द्वारा जुड़े टर्मिनस, जबकि बीटा श्रृंखला संकेत अनुक्रम एक अतिरिक्त रूपरेखा है, इस संशोधन TCR समारोह पर कोई हानिकारक प्रभाव है । माउस लगातार क्षेत्र का निर्माण में प्रयोग किया जाता है के बजाय मानव के बहाव संकेत घटक के साथ संभावित बदल बातचीत से बचने के लिए जब पुनः माउस कोशिकाओं में व्यक्त की । एकल ओआरएफ अल्फा और बीटा श्रृंखला9,11के stoichiometric अलग अभिव्यक्ति में परिणाम होगा । वर्तमान प्रोटोकॉल है कि व्यापक रूप से उपलब्ध हैं, और एक सुव्यवस्थित और कुशल फैशन में प्रदर्शन किया जा करने के लिए बनाया गया है कि एजेंट और दृष्टिकोण पर आधारित है । यद्यपि हम विशेष रूप से परख TCRs के लिए इस तकनीक का इस्तेमाल किया है स्वयं से प्रतिक्रियाशील टी स्व-प्रतिरक्षित मधुमेह में फंसा कोशिकाओं, हमें आशा है कि इस प्रोटोकॉल व्यापक रूप से पहचान और कार्यात्मक मानव TCRs के लिए विशिष्ट मूल्यांकन के लिए लागू किया जा सकता है स्व-प्रतिरक्षित epitopes, कैंसर epitopes, या प्रतिक्रिया रोगजनकों और टीकों के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here
< p class = "jove_title" > 1. प् याज की टी सेल जनसंख् या को पहचानें ।

< p class = "jove_content" > नोट: antigen विशिष्ट प्रसार सेल डिवीजन डाई (जैसे Carboxyfluorescein succinimidyl एस्टर, CFSE) के साथ संयोजन में प्रतिजनी उत्तेजना के जवाब में उनके प्रसार के आधार पर टी कोशिकाओं को अलग करने के लिए इस्तेमाल किया जा सकता है । यदि PBMCs से प्रारंभ कर रहा है, एक 7-दिन इन विट्रो विस्तार में एक antigen विशिष्ट की पहचान करने के लिए पर्याप्त होना चाहिए CFSE कम जनसंख्या < सुप वर्ग = "xref" > १२ .

  1. मिश्रण PBMCs 1:1 के साथ MHC-मिलान फीडर कोशिकाओं, और लेबल के साथ 5 & #181; मी CFSE सेल डिवीजन डाई.
  2. प्लेट 2-2.5 x 10 5 कोशिकाओं के प्रति अच्छी तरह से एक ९६-अच्छी तरह से गोल नीचे कल्चर प्लेट में २०० & #181; L 10% FCS पूरा RPMI मिडिया.
    नोट: पूरा RPMI शामिल 2 मिमी एल-glutamine, 1 मिमी सोडियम पाइरूवेट, १०० & #181; M मेम अति आवश्यक अमीनो एसिड, 5 एमएम HEPES, ५.५ & #215; 10 & #8722; 5 यूनिट्स ऑफ 2-mercaptoethanol, १०० U मब & #8722; 1 पेनिसिलिन तथा १०० & #181; g मब & #8722; 1 streptomycin
  3. 25 & #181; M पेप्टाइड प्रतिजन के साथ कोशिकाओं को उत्तेजित.
  4. संस्कृति के चौथे दिन पर
  5. , जतन से निकालें और स्थ १०० & #181; मीडिया के एल.
    नोट: antigen-विशिष्ट T कक्ष पहचान के लिए एक अधिक इष्टतम approach पेप्टाइड-एचएलए का उपयोग है tetramers < सुप वर्ग = "xref" > १३ . Tetramer धुंधला प्रतिजन विशिष्टता के एक साथ मूल्यांकन के लिए अनुमति देता है, साथ ही साथ एचएलए-प्रतिबंध ।
< p class = "jove_title" > 2. एकल कक्ष सॉर्ट सेट करें ।

  1. एक डाकू या एक निर्दिष्ट क्षेत्र में प्रवर्धित टेंपलेट से मुक्त सभी प्रक्रियाओं का प्रदर्शन । Aliquot संदूषण से बचने के लिए, सभी काम सतहों को साफ और, यदि संभव हो, पीसीआर सेटअप करने से पहले 10% ब्लीच के साथ उपकरण । सभी पीसीआर और वेक्टर क्लोनिंग स्टेप्स में फिल्टर टिप्स, RNAse और DNAse फ्री रिएजेंट्स और प्लास्टिक का इस्तेमाल करें । कुंजी रिएजेंट सामग्री के तालिका में पाया जा सकता है .
    नोट: मल्टीप्लेक्स पीसीआर प्रतिक्रिया अत्यधिक संवेदनशील है, और प्रदूषण के कम स्तर प्रवर्धित उत्पाद में परिणाम कर सकते हैं ।
  2. 10x आरटी प्रतिक्रिया बफर के संयोजन से रिवर्स प्रतिलेखन मास्टर मिश्रण उत्पंन, 25X DNTPs, 9 यू आरटी एंजाइम, ०.०१% ट्राइटन-एक्स, ०.७ यू RNAse अवरोधक, और प्रत्येक आरटी-TCR प्राइमर के ३८३ एनएम ( तालिका 1 में सूचीबद्ध) एक बाँझ pipetting जलाशय में । प्रत्येक ९६ के लिए अच्छी तरह से थाली, 10 अतिरिक्त प्रतिक्रियाओं के लिए पर्याप्त मास्टर मिश्रण बनाने (कुल १०६), pipetting के दौरान तरल के नुकसान के लिए क्षतिपूर्ति करने के लिए. अच्छी तरह से प्रति प्रतिक्रिया घटकों और मात्रा के लिए तालिका 2 देखें.
  3. pipetting 6 & #181 द्वारा छंटाई सेल के लिए एक ९६-well पीसीआर संग्रह प्लेट तैयार; एक मल्टीचैनल पिपेट के साथ अच्छी तरह से प्रति रिवर्स प्रतिलेखन मास्टर मिश्रण के एल । बर्फ पर या कोल्ड ब्लॉक में प्लेट रखें ।
  4. कक्ष सतह मार्करों के लिए एंटीबॉडी के साथ लेबल कोशिकाओं (जैसे सीडी और CD3, या सीडी और CD3, प्रत्येक पर 2 & #181; g/एमएल, सेल डिवीजन डाई या tetramer धुंधला के साथ संयोजन में).
  5. एक सेल में सॉर्ट टी कोशिकाओं को अच्छी तरह से, बारहवीं पंक्ति है, जो एक नकारात्मक नियंत्रण के रूप में काम करेगा लंघन ।
    नोट: प्रकार की दक्षता प्लेट धारक के भीतर सटीक संग्रह प्लेट संरेखण पर निर्भर करेगा, साथ ही सीडीएनए प्रतिक्रिया करने से पहले एक कम तापमान पर कोशिकाओं और प्लेटों को बनाए रखने के रूप में. संग्रह प्लेटें हर समय बर्फ पर रखा जाना चाहिए, छंटाई के दौरान छोड़कर, जब वे ठंडा प्लेट के भीतर तय कर रहे हैं । नहीं सभी मीडियाकर्मी एक तापमान विनियमित प्लेट धारक के साथ सुसज्जित हैं; हालांकि, एक का उपयोग दृढ़ता से सिफारिश की है । के बाद से क्रमबद्ध आमतौर पर प्लेट प्रति 10-15 मिनट के बारे में लेता है, वहां आरएनए गिरावट के लिए एक वृद्धि की क्षमता है अगर प्लेट एक कम तापमान पर नहीं रखा है ।
  6. एक सकारात्मक नियंत्रण के रूप में, इस स्तर पर एक कुओं में से एक के लिए पिपेट के साथ मैन्युअल रूप से कोशिकाओं की एक बड़ी संख्या (१०० कोशिकाओं) जोड़ें. वैकल्पिक रूप से, पहले से पृथक आरएनए परित कोशिकाओं से 10 पर एक सकारात्मक नियंत्रण के रूप में इस्तेमाल किया जा सकता एनजी अच्छी तरह से प्रति ।
    नोट: पिपेट शुद्धता और देखभाल के साथ शुद्ध नियंत्रण आरएनए अन्य कुओं और झूठी सकारात्मक परिणाम के पार संदूषण से बचने के लिए ।
  7. चिपकने वाली फिल्म के साथ प्लेट सील, और 5 मिनट के लिए १००० x g पर नीचे स्पिन 4 & #176; C.
  8. तुरंत आरएनए 25 & #176 पर थाली मशीन द्वारा सीडीएनए के लिए टाइप करें, 10 मिनट के लिए सी, ३७ & #176; c के लिए ४५ मिनट, और ८५ & #176 के लिए c 10 min.
    के लिए नोट: कुशल पीसीआर प्रतिक्रिया सुनिश्चित करने के लिए, यह सिफारिश की है कि पहली पीसीआर प्रतिक्रिया एक ही दिन प्रदर्शन किया जाएगा । वैकल्पिक रूप से, प्रतिलिखित प्लेटों को 2 महीने तक के लिए-८० & #176; C में रखा जा सकता है.
< p class = "jove_title" > 3. प्रदर्शन मल्टीप्लेक्स-नेस्टेड पीसीआर

< p class = "jove_content" > नोट: संदूषण से बचने के लिए एक साफ टेम्पलेट-मुक्त क्षेत्र में सभी मास्टर घोला जा सकता है तैयार करें ।

  1. पुनर्गठित प्रत्येक चर क्षेत्र प्राइमरी ते १०० & #181; मी विथ DNAse आणि RNAse फ्री एच हे. अगला, गठबंधन 20 & #181; ४४ प्राइमरों में से प्रत्येक के एल वी अल्फा प्राइमर पूल उत्पंन । वी-बीटा प्राइमरी पूल को पैदा करने के लिए गठबंधन 20 & #181; प्रत्येक के ४० वी-बीटा प्राइमरी प्लस ८० & #181; l च्या DNAse व RNAse नि H 2 O. प्राइमरी जुगाड़ टेबल 1 में सूचीबद्ध हैं । एक बार परित, मिश्रण में प्रत्येक प्राइमरी की एकाग्रता २.३ & #181; M.
  2. के लिए लगातार क्षेत्र प्राइमरों का पुनर्गठन १०० & #181; मी स्टॉक सॉल्यूशन विथ DNAse एण्ड RNAse फ्री एच 2 ओ. पतला क्षेत्र प्राइमरों को 10 & #181; मी काम समाधान और aliquot उपयोग के लिए.
  3. TCR-अल्फा और TCR बीटा प्रवर्धन के लिए दो अलग मास्टर घोला जा सकता तैयार करते हैं । 5x बफर के संयोजन से मास्टर घोला जा सकता उत्पन्न, ८० & #181; m dNTPs, 3% DMSO, 2 & #181; मी प्राइमरी पूल (प्रत्येक प्राइमरी के लिए ४६ एनएम के अंतिम एकाग्रता), २०० एनएम TCR-लगातार क्षेत्र रिवर्स प्राइमर, 1 यू डीएनए पोलीमरेज़, और DNAse और RNAse फ्री एच 2 ओ ( टेबल 2 < /strong >). प्रत्येक ९६ के लिए अच्छी तरह से थाली, 10 अतिरिक्त प्रतिक्रियाओं के लिए पर्याप्त मास्टर मिश्रण बनाने (कुल १०६), pipetting.
    के दौरान तरल के नुकसान के लिए क्षतिपूर्ति करने के लिए नोट: गणना 25 & #181 के अंतिम पीसीआर वॉल्यूम पर आधारित है; l प्रति कुआं, जहां २२.५ & #181; l मास्टर पीसीआर मिक्स २.५ & #181; l सीडीएनए टेम्पलेट के साथ संयुक्त है.
  4. को बर्फ या ठंडे ब्लॉक में सीडीएनए के साथ प्लेट रखें । एक मल्टीचैनल का प्रयोग करें पिपेट २२.५ & #181; TCR के एल-बीटा एक नया ९६-खैर पीसीआर प्लेट में प्रतिक्रिया । फिर पीसीआर प्लेट में सीडीएनए के २.५ & #181; L को ट्रांसफर करने के लिए एक मल्टीचैनल का प्रयोग करें ।
  5. का उपयोग एक मल्टीचैनल को पिपेट २२.५ & #181; TCR-अल्फा प्रतिक्रिया के एल सीधे सीडीएनए के शेष युक्त प्लेट में.
  6. चिपकने वाला, धीरे भंवर के साथ प्लेटें सील, और स्पिन १००० x g पर 5 मिनट के लिए 4 & #176; C.
  7. निंनलिखित चक्र के साथ मल्टीप्लेक्स पीसीआर प्रतिक्रिया चलाने के लिए: 5 min at ९५ & #176; c द्वारा फ़ॉलो किया गया 20 s के ३४ चक्रों में ९५ & #176; c, 30 s at ५४ & #176; c, और 1 min at ७२ & #176; c, पर 7 min के बाद ७२ & #176; c.
  8. 25 & #181 के एक अंतिम खंड में नेस्टेड पीसीआर प्रतिक्रिया ले, एल, २.५ का उपयोग कर & #181; एल के रूप में मल्टीप्लेक्स पीसीआर मिश्रण के टेंपलेट के रूप में ।
    1. के आं और अनुकूलक प्राइमरों को १०० & #181; m के साथ DNAse और RNAse इव H 2 ओ. मेक 10 & #181; मी aliquots फॉर वर्किंग स्टॉक.
    2. TCR-अल्फा और TCR बीटा ampl के लिए दो अलग मास्टर घोला जा सकता तैयारification । मिक्स 5x बफर, 25X DNTP, 3% DMSO, २०० एनएम फॉरवर्ड अनुकूलक प्राइमर, २०० एनएम रिवर्स नेस्टेड प्राइमर, 1 यू डीएनए पोलीमरेज़, और डीएनए पोलीमरेज़ और nuclease-मुक्त एच 2 हे एक अंतिम मात्रा के लिए २२.५ & #181; L ( Table 2 ). प्रत्येक ९६ के लिए अच्छी तरह से थाली, 10 अतिरिक्त प्रतिक्रियाओं के लिए पर्याप्त मास्टर मिश्रण बनाने (कुल १०६), pipetting.
      के दौरान तरल के नुकसान के लिए क्षतिपूर्ति करने के लिए नोट: दूसरी पीसीआर प्रतिक्रिया में 5x पीसीआर बफर लोड हो रहा है डाई युक्त agarose जेल लदान की सुविधा के लिए उपयोग करें ।
    3. एक मल्टीचैनल का उपयोग कर, पिपेट के लिए मास्टर घोला जा सकता है TCR-अल्फा और TCR बीटा प्रतिक्रियाओं पर २२.५ & #181; एल प्रति अच्छी तरह से दो नए ९६ में अच्छी तरह से पीसीआर प्लेटों ।
    4. में मल्टीप्लेक्स पीसीआर रिएक्शन टेम्पलेट जोड़ें २.५ & #181; L प्रत कुआं.
      नोट: शेष प्रथम पीसीआर रिएक्शन सील किया जाना चाहिए, और संग्रहित-20 & #176; C अतिरिक्त टेम्पलेट के स्रोत के रूप में कार्य करने के लिए, यदि यह आवश्यक हो जाता है ( चरण ४.३ नोट देखें).
    5. सील प्लेटें, धीरे भंवर, और स्पिन १००० x g पर 5 मिनट के लिए 4 & #176; C.
    6. निम्न चक्र के साथ नेस्टेड पीसीआर प्रतिक्रिया चलाएँ: 5 min at ९५ & #176; c द्वारा फ़ॉलो किया गया 20 s के ३४ चक्रों में ९५ & #176; c, 30 s at ५६ & #176; c, और 1 min at ७२ & #176; c, पर 7 min के बाद ७२ & #176; c.
    7. रन 5 & #181; ethidium ब्रोमाइड युक्त एक 1% agarose जेल पर बाहर अंतिम प्रतिक्रिया के एल (नकारात्मक और सकारात्मक नियंत्रण कुओं सहित).
      नोट: अपेक्षित बैंड लगभग ५०० bp आकार पर चलाना चाहिए । एक उदाहरण प्रतिक्रिया में दिखाया गया है < सबल वर्ग = "xfig" > चित्रा २
      .
    8. दूसरी प्रतिक्रिया के शेष को शुद्ध करें (20 & #181; L) एक ९६ का उपयोग कर अच्छी तरह से प्रारूप पीसीआर शुद्धि किट, elute के साथ 15 & #181; L के ७० & #176; सी एच 2 ओ प्रति ठीक है, और प्रदर्शन सैंज अनुक्रमण । sequencing ( तालिका 1 ) के लिए उपयुक्त TCR-अल्फा या TCR-बीटा एडेप्टर आगे प्राइमर का उपयोग करें ।
      नोट: जुगाड़ ऑनलाइन उपलब्ध immunogenetics सॉफ्टवेयर के साथ विश्लेषण किया जा सकता है ।
< p class = "jove_title" > 4. उप क्लोनिंग अल्फा और बीटा पीसीआर चेन ।

< p class = "jove_content" > नोट: फॉरवर्ड प्राइमरों के पूल पहली प्रतिक्रिया में उपयोग किया, और दूसरी पीसीआर प्रतिक्रिया में रिवर्स प्राइमरों प्रतिबंध साइटों को शामिल करने के लिए इस्तेमाल कर रहे हैं. इसलिए, प्राप्त अल्फा और बीटा चेन पीसीआर उत्पादों के लिए तैयार कर रहे है क्रमिक रूप से टेंपलेट में उप क्लोन सिंड्रम वेक्टर (< मजबूत वर्ग = "xfig" > चित्रा 1 ) ।

  1. BstbI और MfeI ( तालिका 3 ) के साथ बीटा नेस्टेड प्रतिक्रिया से शुद्ध पीसीआर उत्पादों को पचाने.
    नोट: 5 & से अधिक न हो #181; g insert.
  2. समानांतर में
  3. , BstbI और MfeI ( तालिका 3 ) के साथ सदिश टेम्पलेट को पचाने में । का प्रयोग करें 1-2 & #181; TCR प्रति टेम्पलेट वेक्टर का g. एक agarose जेल पर पचा वेक्टर भागो, और बड़ा बैंड (~ ७५०० बीपी) को अलग । एक जेल डीएनए शोधन किट के साथ वेक्टर शुद्ध ।
    नोट: प्रतिबंध एंजाइम डाइजेस्ट के दौरान, टेम्पलेट murine TCR-बीटा चर क्षेत्र, मानव TCR बीटा चर क्षेत्र के अलावा के लिए अनुमति देता है निकाल दिया गया है ।
  4. एक पीसीआर शोधन किट का उपयोग कर पच पीसीआर उत्पादों को शुद्ध ।
    नोट: किट में शामिल स्तंभों की डीएनए शोधन क्षमता सत्यापित करें; यदि आवश्यक हो तो कई स्तंभों का उपयोग करें । एक शुद्ध एक सफल बंधाव प्रतिक्रिया के लिए आवश्यक डालने की ंयूनतम राशि ५० एनजी 10 एनजी के एक ंयूनतम एकाग्रता पर है/& #181; L एक सफल बंधाव के लिए शुद्ध सम्मिलित राशि पर्याप्त नहीं है, तो दूसरी पीसीआर प्रतिक्रिया दोहराया जा सकता है ।
  5. 1 के लिए 10 U CIP एंजाइम के साथ वेक्टर टेंपलेट का इलाज ३७ & #176; c स्व-बंधाव को रोकने के लिए, गर्मी निष्क्रियता के बाद 10 मिनट के लिए ७५ & #176; c. डीएनए को पीसीआर शुद्धिकरण किट ( Table 3 ) के साथ शुद्ध करें ।
  6. Ligate TCR-बीटा डालने और वेक्टर का प्रयोग डीएनए ligase में एक 20 & #181; एल कुल मात्रा में 6 दाढ़ पर 30 मिनट के लिए डालने के अतिरिक्त कमरे के तापमान ।
    नोट: कुल में, बंधाव प्रतिक्रिया के बारे में शामिल होना चाहिए १५० डीएनए के एनजी ( तालिका 3 ).
  7. के लिए, मिश्रण 8 & #181; L के साथ बंधाव प्रतिक्रिया के ८० & #181; L के रासायनिक सक्षम ई. कोलाई DH5 & #945; कोशिकाएं ( सामग्री की मेज) और 30 मिनट के लिए बर्फ पर मशीन । ४२ & #176 पर हीट शॉक & के लिए C ४५ s. Add ५०० & #181; L सुपर Catabolite दमन के साथ इष्टतम शोरबा (S.O.C.) मध्यम और शेक के लिए १.५ ज पर ३७ & #176; ग.
  8. प्लेट आउट २५० & #181; Lysogeny शोरबा (पौंड) आगर प्लेट युक्त एक एम्पीसिलीन पर बैक्टीरियल संस्कृति के एल । रात भर थाली मशीन (~ 16 ज) पर ३७ & #176; ग.
  9. अगले दिन बैक्टीरियल कालोनियों उठाओ, और उंहें विकसित 3 मिलीलीटर पौंड में एम्पीसिलीन युक्त मध्यम रातोंरात । डीएनए प्लाज्मिड शुद्धि किट का उपयोग कर प्लाज्मिड डीएनए को अलग.
  10. एक छोटे पैमाने पर परीक्षण द्वारा बीटा श्रृंखला के सफल सम्मिलन की पुष्टि-प्रतिबंध एंजाइमों BstbI और MfeI के साथ डाइजेस्ट. म a 12 & #181; l कुल अभिक्रिया आयतन, जुडा 200-500 & #181; छ प्लाज्मिड डीएनए, ०.२५ & #181; l येक एंजाइम, और 10x एंजाइम बफर ( Table 3 ). ethidium ब्रोमाइड युक्त 1% agarose जेल पर प्रतिक्रिया बाहर चलाने के लिए डालने के बैंड के आकार की पुष्टि करने के लिए (~ ५०० bp).
  11. की उपस्थिति की पुष्टि करने के बाद, अनुक्रम TCR-बीटा खंड वेक्टर का उपयोग कर आयरेस रिवर्स प्राइमर ( तालिका 1 ).
  12. निम्न अनुक्रम TCR-बीटा सम्मिलित की पुष्टि, अल्फ़ा चर क्षेत्र की प्रविष्टि के लिए एक समान प्रक्रिया निष्पादित करें । अल्फा नेस्टेड प्रतिक्रिया से शुद्ध पीसीआर उत्पादों को पचाने, और नए उत्पन्न TCR-बीटा डालने वेक्टर युक्त, SnaBI और SacII.
    के साथ नोट: प्रतिबंध एंजाइम डाइजेस्ट के दौरान, टेम्पलेट murine TCR-अल्फा चर क्षेत्र, मानव TCR अल्फा चर क्षेत्र के अलावा के लिए अनुमति देता है हटा दिया जाता है.
  13. Ligate अल्फा आवेषण TCR वैक्टर इसी बीटा चर क्षेत्र एंकोडिंग में डीएनए ligase का उपयोग कर एक 20 & #181; L कुल मात्रा पर 6 दाढ़ के लिए सम्मिलित करें 30 मिनट में कमरे के तापमान पर अधिक.
    नोट: कुल में, बंधाव प्रतिक्रिया के बारे में शामिल होना चाहिए १५० डीएनए के एनजी ( तालिका 3 ).
  14. के लिए, मिश्रण 8 & #181; L के साथ बंधाव प्रतिक्रिया के ८० & #181; L के रासायनिक सक्षम ई. कोलाई DH5 & #945; कोशिकाएं ( सामग्री की मेज) और 30 मिनट के लिए बर्फ पर मशीन । ४२ & #176 पर हीट शॉक & के लिए C ४५ s. Add ५०० & #181; L S.O.C. मध्यम और शेक के लिए १.५ ज पर ३७ & #176; ग.
  15. प्लेट आउट २५० & #181; Lysogeny शोरबा (पौंड) आगर प्लेट युक्त एक एम्पीसिलीन पर बैक्टीरियल संस्कृति के एल । रात भर थाली मशीन (~ 16 ज) पर ३७ & #176; ग.
  16. अगले दिन बैक्टीरियल कालोनियों उठाओ, और उंहें विकसित 3 मिलीलीटर पौंड में एम्पीसिलीन युक्त मध्यम रातोंरात । डीएनए प्लाज्मिड शुद्धि किट का उपयोग कर प्लाज्मिड डीएनए को अलग.
  17. प्रतिबंध एंजाइमों SnaBI और SacII के साथ एक छोटे पैमाने पर परीक्षण-डाइजेस्ट द्वारा अल्फा श्रृंखला के सफल सम्मिलन की पुष्टि करें. म a 12 & #181; l कुल प्रतिक्रिया खंड गठबंधन 200-500 & #181; छ प्लाज्मिड डीएनए, ०.२५ & #181; l प्रत्येक एंजाइम, और 10x एंजाइम बफर ( Table 3 ). ethidium ब्रोमाइड युक्त 1% agarose जेल पर प्रतिक्रिया बाहर चलाने के लिए डालने के बैंड के आकार की पुष्टि करने के लिए (~ ५०० bp).
  18. की उपस्थिति की पुष्टि करने के बाद, अनुक्रम TCR-अल्फा खंड के सदिश का उपयोग कर MSCV2-आगे प्राइमर ( तालिका 1 ).
  19. अल्फा श्रृंखला अनुक्रम मान्य है एक बार, TCR-बीटा-रिवर्स और आयरेस-रिवर्स प्राइमर ( तालिका 1 ) के साथ अनुक्रमण द्वारा पूरा TCR डालने की जाँच करें.
< p class = "jove_title" > 5. TCR सेल सतह अभिव्यक्ति और विशिष्टता की जांच करें ।

< p class = "jove_content" > नोट: HEK293T कोशिकाओं सफल TCR चेन परी का परीक्षण करने के लिए उपयोग किया जाता हैएनजी और सेल भूतल अभिव्यक्ति (< सबल वर्ग = "xfig" > चित्रा 3 ए ) < सुप वर्ग = "xref" > 8 . पेप्टाइड-MHC tetramer धुंधला भी transfected HEK293T कोशिकाओं पर किया जा सकता है प्रतिजनी विशिष्टता पोस्ट TCR जीन अलगाव की अवधारण के लिए परीक्षण करने के लिए (< मजबूत वर्ग = "xfig" > चित्र बी ).

  1. प्लेट आउट HEK293T कोशिकाओं में 12-well टिशू कल्चर प्लेट्स में 1 x 10 5 कोशिकाओं में प्रति अच्छी तरह से 1 मिलीलीटर पूरा DMEM 5% FCS युक्त मीडिया, और संस्कृति रातोंरात ३७ & #176; C. थाली बाहर पर्याप्त कोशिकाओं को प्रत्येक नए TCR के लिए अलग कुओं नामित किया है , नियंत्रण टेम्पलेट TCR वेक्टर, CD3 वेक्टर केवल, नियंत्रण TCR वेक्टर, और एक गैर-transfected अच्छी तरह से ।
    नोट: पूरी तरह से माउस टेम्पलेट के साथ अभिकर्मक TCR वेक्टर (mTCR-pMIA) के साथ संयोजन में mCD3 & #949; & #947; & #948; & #950;-pMIG वेक्टर, mTCR-pMIA वेक्टर अलोन, व mCD3 & #949; & #947; & #948; & #950;-pMIG वेक्टर अकेले सकारात्मक और नकारात्मक नियंत्रण के रूप में उपयोग किया जाता है ।
    नोट: पूर्ण DMEM शामिल 2 मिमी एल-glutamine, 1 मिमी सोडियम पाइरूवेट, १०० & #181; एम गैर-आवश्यक अमीनो एसिड, 5 मिमी HEPES बफर, ५.५ एक्स 10 -5 इकाइयों की 2-mercaptoethanol, १०० U/एमएल पेनिसिलिन/Streptomycin.
  2. अगले दिन, transfect के साथ कोशिकाओं को 1 & #181; g chimeric h/mTCR-pMIA वेक्टर, 1 & #181; g माउस CD3 & #949; & #947; & #948; & #950;-pMSCVII-GFP (pMIG) वेक्टर, और एक liposome-आधारित अभिकर्मक एजेंट निम्न निर्माता निर्देश.
  3. प्रत्येक TCR के लिए
  4. 6 & #181; l अभिकर्मक रिएजेंट को १०० & #181; l कमरे का तापमान, सीरम मुक्त DMEM. संक्षेप भंवर, और 15 मिनट के लिए कमरे के तापमान पर मशीन
  5. अलग १.५ मिलीलीटर ट्यूबों में गठबंधन 1 & #181; छ TCR-pMIA वेक्टर के साथ 1 & #181; g माउस CD3 & #949; & #947; & #948; & #950;-pMSCVII-GFP (pMIG) वेक्टर, या 1 & #181; g प्रत्येक वेक्टर के नियंत्रण के लिए अलग से ।
  6. Dropwise, वेक्टर डीएनए युक्त ट्यूबों के लिए अभिकर्मक रिएजेंट/DMEM समाधान जोड़ें । 15 min.
  7. के लिए कमरे के तापमान पर मशीन
  8. Dropwise, HEK293T कोशिकाओं के लिए अभिकर्मक रिएजेंट/DMEM/डीएनए समाधान जोड़ें । धीरे मिश्रण करने के लिए थाली नल । ३७ पर मशीन & #176; ग के लिए 24 ज.
  9. के बाद 24 घंटे मीडिया की जगह है, और अतिरिक्त 24 घंटे के लिए संस्कृति में कोशिकाओं को रखने के लिए
  10. प्लेट से जोरदार pipetting करके कोशिकाओं को हटा दें, और एंटी-माउस CD3 एंटीबॉडी (२.५ & #181; g/mL) की सतह की अभिव्यक्ति की पुष्टि करने के लिए, chimeric-TCR द्वारा प्रवाह cytometry.
  11. क्रम में कोशिकाओं है कि एक समान स्तर पर transfected थे के बीच CD3 अभिव्यक्ति की तुलना करने के लिए, गेट फ्लोरोसेंट रिपोर्टर अणुओं की एक समान उच्च स्तर व्यक्त कोशिकाओं पर विश्लेषण (GFP CD3 के लिए जटिल है, और Ametrine अभिव्यक्ति वेक्टर के लिए) । इष्टतम, विश्लेषण GFP + Ametrine + कोशिकाओं पर gated होना चाहिए 10 4 के भीतर 10 5 फ्लोरोसेंट तीव्रता (< मजबूत वर्ग = "xfig" > चित्रा 3 ए ).
    नोट: chimeric निर्माण के साथ transfected कक्षों में CD3 व्यंजक का स्तर नियंत्रण माउस (मूल टेम्पलेट) वेक्टर से तुलनीय होना चाहिए (< सशक्त वर्ग = "xfig" > चित्र 3 ए ). जनरेटेड TCR सिंड्रम वैक्टर vivo एक्सप्रेशन सिस्टम में के साथ संगत है जैसा कि पहले बताया गया < सुप क्लास = "xref" > 4 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

मल्टीप्लेक्स-नेस्टेड पीसीआर रिएक्शन की दक्षता चरण 3.2.7 में जांच की जाती है (चित्रा 2) एक agarose जेल पर दूसरी प्रतिक्रिया के 5 µ l को चलाकर । औसत पर TCR की क्षमता-बीटा प्रवर्धन ८०% के आसपास होने की उंमीद है, जबकि TCR अल्फा प्रतिक्रिया की क्षमता आमतौर पर कम है, लगभग ५०%4पर । केवल युग्मित TCR-अल्फा और TCR-बीटा जंजीरों TCR अभिव्यक्ति के लिए इस्तेमाल किया जा सकता; हालांकि, सभी पीसीआर उत्पादों को TCR अनुक्रम और प्रदर्शनों की जानकारी प्राप्त करने के लिए अनुक्रम किया जा सकता है ।

जीन मुंह केवल एक एकल TCR बीटा श्रृंखला की अनुमति दी टी सेल में व्यक्त किया जाएगा । हालांकि, एक टी सेल एक दूसरे TCR-अल्फा श्रृंखला उलटफेर करने में सक्षम है, और टी कोशिकाओं के बारे में 25% एक दूसरे में फ्रेम TCR-अल्फा श्रृंखला 14व्यक्त करेंगे । यह उंमीद है कि अलग TCR के कुछ अनुपात-अल्फा श्रृंखला माध्यमिक अल्फा के बजाय "सही" अल्फा श्रृंखला होगी । माध्यमिक अल्फा श्रृंखला अक्सर TCR-बीटा श्रृंखला के साथ एक इष्टतम बाध्यकारी भागीदार नहीं है; नतीजतन, यह उंमीद है कि नहीं सभी क्लोन TCRs एक स्थिर परिसर और सेल सतह पर व्यक्त करेंगे फार्म । इसलिए, उचित TCR श्रृंखला बाँधना और सेल सतह अभिव्यक्ति transfecting HEK293T कोशिकाओं (चित्रा 3) द्वारा पुष्टि की जानी है ।

Figure 1
चित्र 1 . सुव्यवस्थित मल्टीप्लेक्स-नेस्टेड पीसीआर और सिंड्रम एकल टी कोशिकाओं से विकास का निर्माण । पीसीआर के दो दौर इसी TCR अल्फा और बीटा जंजीरों के प्रवर्धन में परिणाम । प्रतिबंध प्राइमरों में एंबेडेड साइटों को सुव्यवस्थित उप-क्लोनिंग और मानव की पीढ़ी की अनुमति माउस कोशिकाओं में अभिव्यक्ति के लिए/ माउस वेक्टर टेंपलेट को आसानी से मानव के लिए बाहर स्विच चर माउस क्षेत्रों में इस्तेमाल किया जा सकता है, एक chimeric मानव सृजन/माउस TCR सिंड्रम वेक्टर माउस कोशिकाओं में अभिव्यक्ति के साथ संगत । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 . सिंगल सेल पीसीआर का उदाहरण । मल्टीप्लेक्स एक मानव टी कोशिकाओं से टी सेल रिसेप्टर बीटा और अल्फा श्रृंखला के नेस्टेड पीसीआर प्रवर्धन १ ९६-अच्छी तरह से थाली में हल । दिखाया इसी (ऊपर और नीचे) मानव PBMCs. नेकां से एकल कोशिका प्रवर्धित TCR बीटा और TCR अल्फा चेन से पीसीआर उत्पादों-कोई टेम्पलेट नियंत्रण, पीसी-सकारात्मक नियंत्रण. एक agarose जेल (5 µ एल) पर प्रतिक्रिया का एक छोटा सा हिस्सा चल रहा है, एकल सेल अल्फा और बीटा चेन पीसीआर प्रतिक्रियाओं की दक्षता पीसीआर उत्पाद अनुक्रमण करने से पहले की पुष्टि की है कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3 . कोशिका सतह chimeric TCR अभिव्यक्ति और विशिष्टता का सत्यापन । () HEK293T कक्ष माउस TCR या माउस TCR के साथ संयोजन में एक मानव/माउस chimeric CD3εγδζ के साथ transfected थे. एंटी-mCD3ε एंटीबॉडी के साथ कक्ष सतह TCR व्यंजक मापा गया था । गेटिंग रणनीति: सबसे पहले, विश्लेषण Ametrine और GFP डबल सकारात्मक कोशिकाओं (G2) पर gated है । एकल वेक्टर नियंत्रण के मामले में गेटिंग को सिंगल प्रतिदीप्ति (G1) पर आधारित होना चाहिए । दूसरा, G1 और G2 से कोशिकाओं CD3ε अभिव्यक्ति के स्तर के लिए विश्लेषण कर रहे हैं । () TCR विशिष्टता DRB1 * 0401 के साथ 293T कोशिकाओं के दाग tetramer द्वारा पुष्टि की है: GAD115-127 tetramer । विश्लेषण GFP + Ametrine + CD3ε + कोशिकाओं पर gated है, जैसा कि (A) में दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

लक्ष्य जीन प्राइमरी ओरिएंटेशन अनुक्रम
रिवर्स प्रतिलेखन
TRAC सीडीएनए AGCTGGACCACAGCCG
TRBC1 सीडीएनए GAAATCCTTTCTCTTGACCATG
TRBC2 सीडीएनए GCCTCTGGAATCCTTTCTCT
TCR अल्फा पीसीआर रिएक्शन 1
TRAV1-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 आगे CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 आगे CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 आगे CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 आगे CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 आगे CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 आगे CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 आगे CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 आगे CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
टीडी > TRAV17 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 आगे CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 आगे CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 आगे CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 आगे CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 आगे CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 आगे CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 आगे CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 आगे CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 आगे CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 आगे CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 आगे CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 आगे CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC बाहरी रिवर्स CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta पीसीआर रिएक्शन 1 TRBV2 आगे CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 आगे CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 आगे CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 आगे CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 आगे CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 आगे CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 आगे CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 आगे CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 आगे CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 आगे CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 आगे CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 आगे CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 आगे CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 आगे CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 आगे CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 आगे CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 आगे CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 आगे CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 आगे CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 आगे CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 आगे CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 आगे CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 आगे CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >आगे CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 आगे CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 आगे CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 आगे CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 आगे CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 आगे CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 आगे CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 आगे CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 आगे CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 आगे CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC बाहरी रिवर्स GTGGCCAGGCACACCAGTGTG TCR अल्फा पीसीआर प्रतिक्रिया 2 TRAC आन्तरिक रिवर्स CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV अनुकूलक आगे CGGTTCAGCAGGAATGCCtacgtaATG TCR बीटा पीसीआर प्रतिक्रिया 2 TRBC आन्तरिक रिवर्स CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV एडेप्टर आगे CAGAAGACGGCATACGAGATcaattgATG अनुक्रमण प्राइमर pMSCV-II आगे CCTCCTCTTCCTCCATCCGCC TCRbeta रिवर्स GCCAAGCACACGAGGGTAGCC आयरेस रिवर्स AACGCACACCGGCCTTATTCC * प्राइमर दृश्यों के भीतर कम मामले पत्र शामिल प्रतिबंध एंजाइम कटौती साइटों का संकेत

तालिका 1: उल्टा प्रतिलेखन, पीसीआर, और अनुक्रमण प्राइमरों ।

कदम २.२ प्रति कुआं मात्रा
RT-पीसीआर रिएक्शन (6μL) μl)
10x बफर ०.६
2x dNTP ०.२४
10% ट्राइटन X ०.०६
3 TCR-विशिष्ट प्राइमर (10 मिमी ईए.) ०.२३ ea. (x 3 = ०.६९)
एंजाइम ०.१८
Rnase अवरोधक ०.२८
NF (nuclease-मुक्त)-H2O ३.९५
कदम ३.१
एक पीसीआर रिएक्शन 1 (25μL) μl) बी पीसीआर रिएक्शन 1 (25μL) μl)
5x बफर 5 5x बफर 5
dNTP (10 मिमी) 1 dNTP (10 मिमी) 1
dmso ०.७५ DMSO (3%) ०.७५
एक पूल (एफ प्राइमर) (२.३ माइक्रोन) ०.३ बी पूल (एफ प्राइमर) (२.३ माइक्रोन) ०.५
एक बाहरी आर प्राइमर (10uM) ०.६ बी बाहरी आर प्राइमर (10μM) 1
डीएनए पोलीमरेज़ ०.२ गो Taq पोलीमरेज़ ०.२
RT-पीसीआर सीडीएनए २.५ RT-पीसीआर सीडीएनए २.५
NF-H2O १४.६५ NF-H2O १४.०५
कदम ३.८
पीसीआर रिएक्शन 2-एक और बी के लिए एक ही (25μL) μl)
5x बफर 5
dNTP (10 मिमी) 1
dmso ०.७५
अनुकूलक एफ प्राइमर (10μM) 1
आंतरिक आर प्राइमर (10μM) 1
डीएनए पोलीमरेज़ ०.२
पीसीआर rxn 1 प्रोडक्ट २.५
NF-H2O १३.५५

तालिका 2. प्रतिलेखन और पीसीआर प्रतिक्रियाओं रिवर्स ।

चरण ४.२ और ४.३
TRBV डाइजेस्ट रिएक्शन (५० μl) μl) mTCR-pMIA वेक्टर डाइजेस्ट (५०० μl) μl)
डीएनए (~ 20μg) डीएनए (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10x बफर 5 10x बफर ५०
H2O H2O
कदम ४.४
CIP रिएक्शन (१०० μl) μl) डीएनए (~ 1.5 मिलीग्राम)
> पच & #38; शुद्ध वेक्टर डीएनए ८४ 10x बफर 10 CIP एंजाइम 6 कदम ४.५ बंधाव अभिक्रिया (20μL) μl) पच/CIPed वेक्टर डीएनए (कुल डालने और वेक्टर राशि ~ 150ng है) डीएनए डालें (वेक्टर के लिए 6 दाढ़ एक्सेस) 2x Ligase बफर 10 Ligase एंजाइम 1 H2O कदम ४.९ टेस्ट डाइजेस्ट रिएक्शन (12μL) μl) डीएनए (100-300ng) 1 MfeI ०.२५ BstbI ०.२५ 10x बफर १.२ H2O ९.३ कदम ४.११ TRAV डाइजेस्ट प्रतिक्रिया (६० μl) μl) बीटा युक्त-mTCR-pMIA वेक्टर डाइजेस्ट (१२० μl) डीएनए (~ 1.5 μg) डीएनए (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10x बफर 6 10x बफर 10 H2O H2O

तालिका 3. वेक्टर क्लोनिंग प्रतिक्रियाओं ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

वर्तमान प्रोटोकॉल में, हम एक सेल TCR प्रवर्धन और बाद में उप-युग्मित TCR अल्फा और बीटा जंजीरों के एक टेंपलेट सिंड्रम अभिव्यक्ति वेक्टर में क्लोनिंग के लिए एक कुशल विधि का वर्णन । हालांकि, कई एकल सेल पीसीआर प्रोटोकॉल विकसित किया गया है, कोई भी अब तक तत्काल उप के साथ संगत किया गया है एक अभिव्यक्ति वेक्टर में क्लोनिंग । अधिकांश मामलों में, उच्च चर CDR3 क्षेत्रों को शामिल एक आंशिक अनुक्रम चर क्षेत्र एक्सट्रपलेशन करने के लिए पर्याप्त अनुक्रम के साथ, परिलक्षित होता है । इस छोटे पीसीआर उत्पाद आकार उच्च पीसीआर दक्षता का समर्थन करता है, लेकिन कार्यात्मक अध्ययन के लिए आवश्यक de नोवो TCR जीन संश्लेषण. वर्तमान प्रोटोकॉल पहले से प्रकाशित CDR3-केंद्रित एकल कोशिका TCR अनुक्रमण प्रोटोकॉल की दक्षता का कहना है, जबकि एक ही समय में एक लंबी क्लोनिंग के लिए उपयुक्त पूरे चर क्षेत्र युक्त amplicon उपज । इसलिए, प्रणाली वर्णित एक मात्रात्मक अनुक्रम देने में एक वृद्धि हुई लचीलापन है, साथ ही कार्यात्मक उत्पादन ।

वैज्ञानिक सवाल पर निर्भर करते हुए संबोधित किया, स्रोत और टी कोशिकाओं का विश्लेषण की विशिष्टता भिंन हो सकते हैं । हालांकि, यदि प्रोजेक्ट का अंतिम लक्ष्य vivo TCR फ़ंक्शन में विश्लेषण है, तो पृथक टी कोशिकाओं के एचएलए प्रतिबंध को जानना आवश्यक है । वर्तमान प्रोटोकॉल विशेष रूप से एचएलए-मानवतावादी चूहों में vivo TCR अभिव्यक्ति में के साथ संगत होना करने के लिए डिज़ाइन किया गया है. इनमें से कई चूहे उत्पन्न हो चुके हैं और अब व्यावसायिक रूप से उपलब्ध हैं, जिनमें एचएलए-A 2.1, एचएलए-DQ8 (एचएलए-DQA1 * 301, एचएलए-DQB1 * ३०२), एचएलए-DQ6 (DQA1 * 0102, HLADQB1 * 0602), एचएलए-DR4 (DRB1 * 0401), एचएलए-DR1 (डॅा * ०१०१, DRB1 * ०१०१), एचएलए-A11 (अ * ११:०१/K), एचएलए-B2705, एचएलए-A24, र एचएलए-ब * 0702 ट्रांसजेनिक संवेदनहीन । इस प्रोटोकॉल को सफलतापूर्वक मानव TCRs4,15,16के सिंड्रम मध्यस्थता अस्थि मज्जा स्टेम सेल अभिव्यक्ति के लिए पहले से प्रकाशित प्रोटोकॉल के साथ संयुक्त किया जा सकता है । हमें उंमीद है कि मानव TCR retrogenic प्रणाली लागू हो जाएगा और विभिंन स्व-प्रतिरक्षित, कैंसर, और संक्रामक मॉडल में मानव TCRs के कार्यात्मक विश्लेषण के लिए अत्यधिक उपयोगी है ।

मौजूदा एकल सेल पीसीआर प्रोटोकॉल महत्वपूर्ण कदम का वर्णन करता है और युग्मित TCR-अल्फा और TCR-बीटा दृश्यों के सफल प्रवर्धन के लिए आवश्यक सुझाव देता है । पहला महत्वपूर्ण कदम सीडीएनए प्रतिलेखन का समय पर प्रदर्शन, और बाद में मल्टीप्लेक्स पीसीआर के पहले दौर है । सभी शामिल कदम एक समय पर ढंग से प्रदर्शन किया जाना चाहिए, और सभी रिएजेंट और कोशिकाओं को आरएनए और सीडीएनए क्षरण को रोकने के लिए बर्फ पर रखा । दूसरे, क्योंकि प्रोटोकॉल टेंपलेट के निंन स्तर के लिए अत्यधिक संवेदनशील होना करने के लिए डिज़ाइन किया गया है, यह अत्यधिक प्रदूषित करने के लिए अतिसंवेदनशील है । इसलिए, यह एक टेंपलेट मुक्त क्षेत्र में काम करने के लिए आवश्यक है, दूर प्रवर्धित पीसीआर उत्पादों या TCR वेक्टर क्लोनिंग से । एक अलग कमरे या डाकू सीडीएनए और पीसीआर प्रतिक्रियाओं की स्थापना के लिए इस्तेमाल किया जाना चाहिए । पहले पीसीआर से टेंपलेट एक अलग क्षेत्र में जहां पीसीआर की स्थापना की है की प्रतिक्रिया जोड़ा जाना चाहिए । यह सलाह दी जाती है कि सिंगल सेल पीसीआर प्रयोगों के लिए aliquoted रिएजेंट्स का एक अलग सेट इस्तेमाल किया जाए ।

इस प्रोटोकॉल को विशेष रूप से सामग्री की तालिकामें सूचीबद्ध रिएजेंट का उपयोग कर ऑप्टिमाइज़ किया गया है, और रिएजेंट में किसी भी प्रतिस्थापन अतिरिक्त ऑप्टिमाइज़ेशन की आवश्यकता होगी । antigen-विशिष्ट कक्षों की प्रारंभिक पहचान पेप्टाइड-MHC tetramers का उपयोग करने के लिए संशोधित किया जा सकता है । Tetramer धुंधला प्रतिजन विशिष्टता के एक साथ मूल्यांकन के लिए अनुमति देता है, साथ ही साथ एचएलए-प्रतिबंध । antigen जेट का पता लगाने के लिए वैकल्पिक विधियों, जैसे जल्दी सक्रियण मार्करों या भड़काऊ साइटोकिंस के स्राव के नियमन tetramer रिएजेंट के अभाव में माना जा सकता है । उदाहरण के लिए, दोहरी विशिष्टता फ्यूजन एंटीबॉडी एक टी सेल प्रतिजन के लिए विशिष्ट और IFNγ चुंबकीय मनका अलगाव के साथ जोड़ा जा सकता है प्रतिजन प्रतिक्रियाशील IFNγ कोशिकाओं के उत्पादन के लिए समृद्ध ।

जबकि chimeric मानव/माउस हमारे प्रोटोकॉल में वर्णित निर्माण माउस कोशिकाओं के साथ संगतता सुनिश्चित करता है, मानव CD3 परिसर के साथ अपनी संगतता के स्तर अज्ञात है । हालांकि औपचारिक रूप से हमारे द्वारा परीक्षण नहीं, दूसरों को पता चला है कि chimeric TCR murine निरंतर क्षेत्रों के साथ निर्माण मानव लिम्फोसाइटों17की सतह पर व्यक्त किया जा सकता है । यह इंगित करता है कि murine TCR स्थिरांक क्षेत्र मानव CD3 संकेतन जटिल के साथ सहभागिता का समर्थन कर सकते हैं । हालांकि, अगर लक्ष्य को मानव प्राथमिक कोशिकाओं या मानव कोशिका लाइनों, जैसे Jurkat कोशिकाओं, एक अधिक इष्टतम दृष्टिकोण में पहचान TCRs व्यक्त करने के लिए एक पूरी तरह से मानव निर्माण का उपयोग हो सकता है । यह मानव निरंतर क्षेत्रों के साथ वेक्टर के भीतर murine लगातार क्षेत्रों गमागमन द्वारा पूरा किया जा सकता है ।

यदि एक की पहचान की TCR चर क्षेत्र प्रतिबंध क्लोनिंग के लिए इस्तेमाल किया साइटों में से एक है, TCR एक शटल में डाला जाना चाहिए सदिश और बाद में एक साइट का उपयोग mutagenesis किट निर्देशित करने के लिए प्रतिबंध के भीतर एक मूक न्यूक्लियोटाइड परिवर्तन प्रेरित कट साइट । एक वैकल्पिक तरीका अवांछित प्रतिबंध साइट को छोड़ने के लिए संशोधित ब्याज की TCR चर क्षेत्र का de नोवो संश्लेषण है ।

इस तकनीक का मुख्य सीमा माध्यमिक ' cytoplasmic ' अल्फा श्रृंखला के प्रवर्धन को खत्म करने में असमर्थता है । TCR-अल्फा जीन TCR-बीटा जीन की तरह allelic अपवर्जन के माध्यम से जाना नहीं है, इस प्रकार टी कोशिकाओं का एक महत्वपूर्ण अनुपात एक माध्यमिक ' cytoplasmic अल्फा श्रृंखला14व्यक्त करेंगे । वर्णित पीसीआर प्रोटोकॉल केवल एक TCR अल्फा श्रृंखला के प्रवर्धन में परिणाम है, लेकिन अगर प्रवर्धित अल्फा श्रृंखला है ' cytoplasmic ' अल्फा श्रृंखला यह प्रवर्धित बीटा श्रृंखला के साथ जोड़ी नहीं हो सकता है । इसलिए, यह HEK293T कोशिकाओं में TCR सेल सतह अभिव्यक्ति सफल श्रृंखला बाँधना सुनिश्चित करने के लिए परीक्षण करने के लिए आवश्यक है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

इस अध्ययन JDRF द्वारा वित्त पोषित किया गया था 1-FAC-2014-243-A-N, एडीए 7-14-JF-07, NIH 5 P30 DK079638-05 पायलट PJ, और रॉबर्ट और जेनिस McNair फाउंडेशन.

हम रोगी भर्ती के लिए सैंड्रा पेना और Andrene मैकडॉनल्ड्स धंयवाद, तकनीकी सहायता के लिए शमूएल ब्लम, डॉ जॉर्ज Makedonas एंटीबॉडी और नियंत्रण डीएनए के उपहार के लिए पीसीआर अनुकूलन के लिए इस्तेमाल किया ।

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
सुव्यवस्थित एकल कोशिका TCR अलगाव और सिंड्रम वैक्टर के लिए पीढ़ी के लिए <em>इन विट्रो </em>और <em>Vivo में</em> मानव TCRs की अभिव्यक्ति
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter