Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Aerodinámico unicelular TCR aislamiento y generación de vectores retrovirales para In Vitro y In Vivo expresión de TCR humana

doi: 10.3791/55379 Published: September 10, 2017

Summary

El actual combina protocolo célula emparejados humano TCR alfa y beta cadena secuenciación con optimiza generación de vectores retrovirales compatibles con expresión de TCR in vitro e in vivo .

Abstract

Aunque se han desarrollado varios métodos para la secuencia de pares T cell receptor (TCR) alfa y beta las cadenas de las células T, ninguno hasta ahora han sido propicias para abajo en vivo análisis funcional de TCR heterodímeros. Hemos desarrollado un protocolo mejorado basado en una PCR multiplex nested dos pasos, que se traduce en un producto PCR que se extiende por toda las regiones variables de un humano cadenas alfa y beta TCR. Por identificación de sitios de restricción únicos e incorporarlos en los iniciadores PCR, hemos hecho el producto PCR compatible con directa sub clonación en el vector retroviral de la plantilla. El constructo retroviral resultante codifica un quimérico humano/ratón TCR con un dominio intracelular de ratón, que es funcional en células de ratón o en modelos de ratón en vivo . En general, el protocolo descrito aquí combina humano unicelular emparejado TCR alfa y beta cadena identificación con generación optimizada de vectores retrovirales fácilmente adaptables para la expresión de TCR in vitro e in vivo . El video y el material que lo acompaña están diseñados para dar una descripción muy detallada de la célula PCR, para que los pasos críticos pueden ser seguidos y potenciales peligros evitar. Además, ofrecemos una descripción detallada de las medidas clonaje necesarias para generar el vector de expresión. Una vez dominado, todo el procedimiento de célula clasificación a expresión de TCR puede realizarse en un corto período de dos semanas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El receptor T (TCR) dicta decisión de destino de la célula de T durante el desarrollo, homeostasis de estado estacionario y estimulación antigénica en la periferia1,2,3. La reciente expansión de tecnologías de secuenciación profunda ha descubierto una diversidad TCR anteriormente subestimada en las respuestas de células T específicas de antígeno. Diversidad de los TCR sugiere un potencial de respuestas de células T funcionalmente amplia. Para integrar el análisis de repertorio TCR secuencia con análisis funcionales de TCR, los métodos de secuenciación deben ser diseñados para ser compatible con sistemas experimentales y en vivo los modelos utilizados para el posterior análisis funcional de selección TCR. Hemos desarrollado un enfoque eficiente para el aislamiento de secuencia TCR humano y racionalizar el clonación en un vector de plantilla TCR quimérico humano/ratón compatible con la expresión del TCR en ratones humanizados HLA4. Aislamiento de cadenas alfa y beta correspondientes de heterodiméricos TCRs requiere amplificación por PCR de dos cadenas de una sola célula. Aunque, varios protocolos de clonación de TCR unicelulares han sido elaborados y utilizados, ninguno hasta ahora han sido fácilmente compatible con alto rendimiento aerodinámico directa clonación de desconocido/Vβ Vα TCRs en vectores retrovirales necesarios para re-expresión en vivo 4,5,6,7. Estudios previos han utilizado dos enfoques principales, ya sea para amplificar selectivamente una porción limitada del TCR suficiente para extrapolar la secuencia, o para amplificar el TCR toda secuencia4,5,6 , 7. río abajo el análisis funcional de TCR secuencias obtenidas mediante la primera aproximación requiere costosas en silico Asamblea y novo de construcción del TCR. Mientras que el segundo enfoque proporciona la secuencia completa del TCR, la región constante humana no es compatible con la expresión en vivo de los TCRs clonadas en modelos de ratón. Nuestro enfoque está específicamente diseñado para ser compatible con en vivo análisis funcional de TCR en modelos de ratón. Hemos desarrollado una eficiente y ágil sola célula protocolo PCR que permite la directa sub clonación de fragmentos PCR en el vector de expresión de la plantilla.

Nuestro enfoque utiliza una muy sensible multiplex nested PCR reacción que se realiza en dos pasos. En la primera reacción multiplex paso una piscina de 40 cebadores específicos para todas las cadenas de beta V y una piscina de 44 cartillas específicas para todas las cadenas alfa de V se utilizan para amplificar la alfa de TCR o TCR-beta sin el conocimiento previo de la secuencia (tabla 1). El primer avance tiene una secuencia de adaptador, que se incorpora a los 5' del producto PCR. El primer revés se basa en la región constante del TCR. Se han identificado sitios de restricción únicos que están ausente de variable humana o regiones de la ensambladura TCR e incorporado en el nuevo y rediseñado TCRα y TCRβ primers (figura 1). En la segunda reacción anidada, una cartilla específica para la secuencia del adaptador y una cartilla reversa anidada dentro de la región constante se utilizan para amplificar más lejos las cadenas TCR con mayor especificidad (tabla 1, figura 1). Después de aislamiento de células individuales, dos rondas de PCR (reacción primera con un grupo de iniciadores Vα y Vβ y la segunda con las cartillas de adaptador) resultan en un producto PCR que puede ser directamente los clonados en el vector retroviral de la plantilla. La construcción final del TCR a codificar, en un marco de solo lectura abierta (ORF), regiones variables humanos combinados con regiones constantes del ratón conectadas por el 'Self-Hendedoras' secuencia de la proteína, P2A (hVα-mCα-P2A-hVβ-mCβ)8. La secuencia de P2A se ha utilizado en múltiples sistemas y ha sido extensivamente probada específicamente para la expresión de TCR8,9,10,11. Aunque, después traducción en al mayoría de los restos de la secuencia de P2A el c-terminal de la cadena alfa conectada por un linker flexible, mientras que la secuencia de la señal de cadena beta tiene una prolina adicional, esta modificación no tiene ningún efecto perjudicial sobre la función TCR. La región constante del ratón se utiliza en la construcción en lugar de humanos para evitar potenciales interacciones alteradas con componentes de señalización corriente abajo cuando vuelva a expresado en células de ratón. El ORF solo resultará en expresión estequiométrica separado de las cadenas alfa y beta9,11. El protocolo actual se basa en los reactivos y los enfoques que están ampliamente disponibles y está diseñado para realizarse de manera ágil y eficiente. Aunque específicamente hemos utilizado esta técnica para análisis TCR de las células T auto reactivas implicadas en la diabetes autoinmune, Anticipamos que este protocolo puede ser extensamente aplicable para la identificación y evaluación funcional de TCR humano específico para epitopos autoinmune, cáncer epitopos o respuestas a patógenos y vacunas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identificar la población de la célula de T de interés.

Nota: antígeno de proliferación específica en combinación con el tinte de la división celular (como éster de succinimidyl Carboxyfluorescein, CFSE) puede utilizarse para aislar las células de T se basa en su proliferación en respuesta a la estimulación antigénica. Si a partir de PBMCs, una expansión de 7 días en vitro debe ser suficiente para identificar un antígeno específico CFSE población bajo 12.

  1. PBMCs de mezcla 1:1 con las células de alimentador MHC-emparejado y etiqueta con tinte 5 de división de célula de la CFSE del μm.
  2. Placa 2-2.5 x 10 5 células por pocillo en un fondo redondo 96 pocillos placa en 200 μl 10% FCS completo RPMI medios de la cultura.
    Nota: RPMI completo contiene l-glutamina 2 mM, piruvato de sodio 1 m m, 100 μm MEM aminoácidos no esenciales, 5 mM HEPES, 5,5 × 10 − 5 unidades de 2-Mercaptoetanol, 100 U mL − 1 penicilina y 100 μg mL − 1 estreptomicina.
  3. Estimular células con antígeno de péptido de 25 μm.
  4. En el cuarto día de la cultura, retire con cuidado y vuelva a colocar 100 μl de los medios de comunicación.
    Nota: Un enfoque más óptimo para la identificación de células de T específicas de antígeno es el uso de péptido-HLA tetrámeros 13. La tinción de tetrámero permite la evaluación simultánea de la especificidad del antígeno, así como restricción HLA.

2. Configurar el tipo de celular solo.

  1. Realizar todos los procedimientos en una campana o un área libre de plantilla amplificado. Alícuota los reactivos para evitar la contaminación, limpie todas las superficies de trabajo y, si es posible, equipo con el 10% lejía antes de la instalación de la polimerización en cadena. Use puntas de filtro, reactivos libres de RNasa y DNasa y plásticos en todas las PCR y vector de clonación pasos. Reactivos claves pueden encontrarse en la Tabla de materiales.
    Nota: La reacción de polimerización en cadena múltiplex es muy sensible, y bajos niveles de contaminación pueden resultar en el producto amplificado.
  2. Generar la mezcla principal de transcripción reversa combinando 10 x reacción de RT del almacenador intermediario, 25 X DNTPs, enzima U RT 9 0.01% Triton-X, 0,7 inhibidor de Rnasa de la U y 383 nM de cada cartilla de RT-TCR (enumerada en la tabla 1) en un depósito de pipetas estéril. Para cada placa de 96 pocillos, constituyen suficiente mix master para 10 reacciones adicionales (total 106), para compensar la pérdida de líquido durante el pipeteo. Consulte la tabla 2 para los componentes de reacción y cantidades por bien.
  3. Preparar una colección de PCR de 96 pocillos placa para celular clasificación por pipeteo 6 μl de la mezcla principal de reversa de la transcripción por pozo con una pipeta multicanal. Mantenga la placa en hielo o en un bloque frío.
  4. Etiqueta de células con anticuerpos a la célula marcadores de superficie (por ejemplo CD4 y CD3, o CD8 y CD3, cada uno a 2 μg/mL, en combinación con tinte de división celular o la tinción de tetrámero).
  5. Las células de tipo T en una célula por pozo, omitiendo la fila 12, que servirá como control negativo.
    Nota: La eficiencia de la clase dependerá de la alineación de la placa precisa colección dentro del sostenedor de la placa, así como mantener las células y las placas a una temperatura baja antes de la reacción de cDNA. Placas de colección deben tener hielo en todo momento, excepto durante la clasificación, cuando son fijos dentro de la placa de enfriamiento. Clasificadores no todos cuentan con un soporte de placa regulado de temperatura; sin embargo, se recomienda encarecidamente el uso de uno. Puesto que el tipo toma generalmente alrededor 10-15 min por placa, hay un mayor potencial para la degradación de RNA si la placa no se mantiene a baja temperatura.
  6. Como control positivo, añadir un mayor número de células (100) manualmente con una pipeta a uno de los pozos en esta etapa. Por otra parte, previamente aislado ARN de células agrupadas puede utilizarse como control positivo a 10 ng por bien.
    Nota: Pipetear control purificado RNA con precisión y cuidado para evitar la contaminación cruzada de otros pozos y falsos positivos.
  7. La placa con la película adhesiva del sello y desactivación a 1000 x g durante 5 min a 4 ° C.
  8. Inmediatamente transcribir RNA a cDNA por incubar la placa a 25 ° C durante 10 min, 37 º C durante 45 minutos y 85 ° C durante 10 minutos
    Nota: Para asegurar la eficaz reacción de PCR, se recomienda que la primera reacción de PCR se realizó el mismo día. Por otra parte, las placas transcritas pueden conservarse en-80 ° C hasta por 2 meses.

3. Realizar PCR anidado multiplex

Nota: preparar todos los mixes de maestro en una zona libre de plantilla para evitar la contaminación.

Cartilla de
  1. reconstituir cada región variable a 100 μm con DNasa y Rnasa free H 2 O. A continuación, combinar 20 μl de cada uno de los 44 iniciadores para generar la piscina de la cartilla de V-alfa. Para generar la beta V piscina primer combinan 20 μl de cada uno de los iniciadores de V-beta 40 y 80 μl de DNasa y Rnasa free H 2 O. cartilla secuencias aparecen en la tabla 1. Una vez agrupados, la concentración de cada cebador en la mezcla es 2.3 μm.
  2. Reconstituir los iniciadores de la región constante de solución stock de 100 μm con DNasa y Rnasa free H 2 O. diluir los iniciadores de la región constante a 10 μm trabajo solución y alícuota para uso.
  3. Preparar dos mezclas de maestro separadas para la amplificación de la TCR-alfa y TCR-beta. Generar las mezclas maestras combinando 5 X buffer, 80 piscina de cartilla μm dNTPs, 3% de DMSO, 2 μm (concentración final de 46 nM para cada cartilla), 200 nM TCR constante región inversa la cartilla, 1 U ADN polimerasa y DNasa y Rnasa free H 2 O (tabla 2 < / strong >). Para cada placa de 96 pocillos, constituyen suficiente mix master para 10 reacciones adicionales (total 106), para compensar la pérdida de líquido durante el pipeteo.
    Nota: Los cálculos se basan en el volumen final de la PCR de 25 μl por pocillo, donde 22,5 μl mezclar maestro de PCR se combina con plantilla de cDNA de 2.5 μl.
  4. Mantenga la placa con cDNA en hielo o en un bloque frío. Utilice un multicanal para pipetear 22,5 μl de reacción de TCR-beta en una nueva placa de PCR de 96 pocillos. Luego usar un multicanal para transferir 2.5 μl de cDNA a la placa PCR.
  5. Utilizar un multicanal para pipetear 22,5 μl de reacción de la TCR-alfa directamente en la placa que contiene el resto del cDNA.
  6. Sello las placas con el adhesivo suavemente vortex y vuelta abajo a 1000 x g durante 5 min a 4 ° C.
  7. Ejecutar la reacción de PCR multiplex con los siguientes ciclos: 5 min a 95 ° C seguido de 34 ciclos de 20 s a 95 ° C, 30 s a 54 ° C y 1 min a 72 ° C, seguido de 7 min a 72 ° C.
  8. Llevar a cabo la reacción de PCR anidada en un volumen final de 25 μl, usando 2,5 μl de la mezcla PCR múltiplex como plantilla.
    1. Reconstituir los cebadores internos y adaptador a 100 μm con DNasa y Rnasa libre H 2 O. hacer 10 μm alícuotas del material de trabajo.
    2. Preparar dos mezclas de maestro separadas para ampl TCR-alfa y TCR-betamostr. Mezcla 5 X buffer, 25 X DNTP, 3% DMSO, 200 nM adaptador hacia adelante la cartilla, cartilla anidados inversa de 200 nM, 1 U ADN polimerasa y polimerasa de la DNA y libre de nucleasas H 2 O para un volumen final de 22.5 μl (tabla 2). Para cada placa de 96 pocillos, constituyen suficiente mix master para 10 reacciones adicionales (total 106), para compensar la pérdida de líquido durante el pipeteo.
      Nota: En el segundo uso de la reacción de PCR el 5 X PCR de búfer que contiene colorante de carga para facilitar la carga del gel de la agarosa.
    3. Usando un multicanal, pipeta la mezcla principal para las reacciones TCR-alfa y TCR-beta en 22.5 μl por pocillo en dos placas de PCR de 96 pocillos nueva.
    4. Añadir la plantilla de la reacción de PCR multiplex en 2,5 μl por pocillo.
      Nota: La primera reacción de PCR quedan sellada y almacenada a-20 ° C para servir como una fuente de plantilla adicional, si es necesario (ver Nota 4.3).
    5. Sellar las placas, suavemente vortex y vuelta abajo a 1000 x g durante 5 min a 4 ° C.
    6. Ejecutar la reacción de PCR anidada con los siguientes ciclos: 5 min a 95 ° C seguido de 34 ciclos de 20 s a 95 ° C, 30 s a 56 ° C y 1 min a 72 ° C, seguido de 7 min a 72 ° C.
    7. Ejecutar 5 μl de la reacción final hacia fuera en una agarosa 1% gel con bromuro de etidio (incluyendo los pocillos de control positivo y negativo).
      Nota: La banda esperada debe ejecutarse en tamaño de bp alrededor de 500. Un ejemplo de reacción se muestra en la figura 2.
    8. Purifica el resto de la segunda reacción (20 μl) utilizando un formato de 96 pocillos kit PCR purificación, eluir con 15 μl de 70 ° C H 2 O por pozo y realizar Sanger secuenciación. Usar el apropiado alfa de TCR o TCR-beta adaptador delantero cartilla de secuenciación (tabla 1).
      Nota: Secuencias pueden ser analizadas con el software de inmunogenética disponibles en línea.

4. Clonación las cadenas de polimerización en cadena alfa y beta.

Nota: la piscina de los cebadores adelantados utilizados en la primera reacción y los iniciadores inversos en la segunda reacción de PCR se utilizan para incorporar sitios de restricción. Por lo tanto, los productos PCR obtenidos alfa y beta cadena están listos para ser secuencialmente el clonado en el vector retroviral de la plantilla ( figura 1).

Productos
  1. Resumen la PCR purificada de la beta anidados reacción con BstbI y MfeI (tabla 3).
    Nota: No sobrepase 5 μg insertar.
  2. En paralelo, digerir el vector plantilla con BstbI y MfeI (tabla 3). Utilice 1-2 μg del vector de la plantilla por el TCR. Ejecutar el vector digerido en un gel de agarosa y aislar la banda más grande (~ 7500 bp). Purificar el vector con un gel kit purificación DNA.
    Nota: Durante la recopilación de la enzima de la restricción, murino TCR-beta variable región de la plantilla se quita, lo que permite la adición de la región variable de TCR-beta humana.
  3. Purificar los productos PCR digeridos utilizando un kit de purificación PCR.
    Nota: Comprobar la capacidad de purificación de ADN de las columnas incluidas en el kit; utilizar varias columnas si es necesario. La cantidad mínima de un purificado inserto necesario para una reacción de ligadura acertada es de 50 ng en una concentración mínima de 10 ng/μl. Si la cantidad de inserción purificada no es suficiente para una ligadura acertada, la segunda reacción de PCR puede repetirse.
  4. Tratar el vector plantilla con 10 enzima U CIP durante 1 h a 37 ° C para evitar la uno mismo-ligadura, seguida por la inactivación de calor durante 10 minutos a 75 ° C. purifica el ADN con un kit de potabilización de PCR (tabla 3).
  5. Ligan TCR-beta Inserte y vector con ligase de la DNA en un volumen total de 20 μl en 6 exceso molar de la estufa durante 30 min a temperatura ambiente.
    Nota: En total, la reacción de la ligadura debe contener unos 150 ng de ADN (tabla 3).
  6. De transformaciones, mezclar 8 μl de la reacción de la ligadura con 80 μl de células químicamente competentes de e. coli DH5α (Tabla de materiales) e incubar en hielo durante 30 min choque térmico a 42 ° C por 45 s. Añadir 500 μl Super Caldo óptimo medio de Catabolito supresión (novedosa) y agitar durante 1,5 h a 37 ° C.
  7. Placa salida 250 μl de cultivo bacteriano en una ampicilina que contiene la placa de agar caldo de lisogenia (LB). Incubar la placa durante la noche (~ 16 h) a 37 ° C.
  8. Al día siguiente elegir colonias bacterianas y crece en medio de 3 mL LB con ampicilina durante la noche. Aislar el DNA plasmídico utilizando el kit de purificación de DNA plasmídico.
  9. Confirmar la inserción exitosa de la cadena beta, un pequeños Resumen de prueba con las enzimas de restricción BstbI y MfeI. En un volumen de reacción total μl 12, combinar 200-500 μg plásmido ADN y 0.25 μl de cada enzima tampón de enzima X 10 (tabla 3). Ejecutar la reacción hacia fuera en un gel de agarosa al 1% con bromuro de etidio para confirmar el tamaño de la banda de insertar (~ 500 bp).
  10. Después de confirmar la presencia de la inserción, la secuencia de la sección de TCR-beta del vector usando la cartilla reversa IRES (tabla 1).
  11. Tras la confirmación de la secuencia del inserto de TCR-beta, realizar un proceso similar para la inserción de la región variable alfa. Digerir los productos PCR purificados de la reacción anidada alfa y la inserción de TCR-beta recién generada con vector, con SnaBI y SacII.
    Nota: Durante la recopilación de la enzima de la restricción, la región variable TCR-alfa murina plantilla se retira, permitiendo la incorporación de la región variable de TCR-alfa humana.
  12. Alfa
  13. ligan inserta en vectores TCR que codifican la región variable beta correspondiente con ligase de la DNA en un volumen total de 20 μl en 6 exceso molar de la estufa durante 30 min a temperatura ambiente.
    Nota: En total, la reacción de la ligadura debe contener unos 150 ng de ADN (tabla 3).
  14. Para transformaciones, mezclar 8 μl de la reacción de la ligadura con 80 μl de células químicamente competentes de e. coli DH5α (Tabla de materiales) e incubar en hielo durante 30 min choque térmico a 42 ° C por 45 s. Añadir 500 μl novedosa medio y agitar durante 1,5 h a 37 ° C.
  15. Placa salida 250 μl de cultivo bacteriano en una ampicilina que contiene la placa de agar caldo de lisogenia (LB). Incubar la placa durante la noche (~ 16 h) a 37 ° C.
  16. Al día siguiente elegir colonias bacterianas y crece en medio de 3 mL LB con ampicilina durante la noche. Aislar el DNA plasmídico utilizando el kit de purificación de DNA plasmídico.
  17. Confirmar la inserción exitosa de la cadena alfa por un pequeños Resumen de prueba con las enzimas de restricción SnaBI y SacII. En un volumen de reacción total 12 μl mezclar 200-500 μg ADN plásmido, 0.25 μl de cada enzima y tampón de enzima x 10 (tabla 3). Ejecutar la reacción hacia fuera en un gel de agarosa al 1% con bromuro de etidio para confirmar el tamaño de la banda de insertar (~ 500 bp).
  18. Después de confirmar la presencia de la inserción, la secuencia de la sección de TCR-alfa del vector usando la cartilla de MSCV2-forward (tabla 1).
  19. Una vez que se valida la secuencia de la cadena alfa, verificar la completa inserción TCR por secuenciación con el primer TCR-beta-inversión y IRES-inversa (tabla 1).

5. Verificar la expresión superficial de la célula TCR y especificidad.

Nota: las células HEK293T se utilizan para probar acertado TCR cadena pariNG y célula superficial expresión ( Figura 3A) 8. La tinción de tetrámero de péptido-MHC puede realizarse también en las células transfected HEK293T para comprobar la retención de aislamiento de genes TCR especificidad antigénica post ( figura 3B).

  1. Placa de células HEK293T en placas de cultivo de tejidos 12-bien en 1 x 10 5 células por pocillo en 1 mL completo DMEM medios conteniendo 5% FCS y la cultura durante la noche a 37 ° C. placa suficientes células han señalado pocillos distintos para cada nueva TCR , control plantilla TCR vectores, CD3 vectores solamente, control vector TCR solamente y no transfectadas bien.
    Nota: Transfección con una plantilla totalmente ratón TCR vector (mTCR-pMIA) en combinación con el vector de mCD3εγδζ-pMIG, mTCR-pMIA vector solo, y mCD3εγδζ-pMIG vector solo se usan como controles positivos y negativos.
    Nota: DMEM completo contiene 2 mM L-glutamina, 1 mM de piruvato de sodio, 100 μm no esenciales aminoácidos, 5 mM HEPES buffer, 5.5 x 10 -5 unidades de 2-Mercaptoetanol, 100 U/ml de penicilina/estreptomicina.
  2. Al día siguiente, transfectar las células con el vector h/mTCR-pMIA quimérica de 1 μg, 1 μg del ratón CD3εγδζ-pMSCVII-GFP (pMIG) vector y un reactivo de transfección basada en liposomas siguiendo las instrucciones del fabricante.
  3. Para cada TCR, añadir 6 μl de reactivo de transfección a 100 μl de temperatura, DMEM libre de suero. Brevemente vortex e incubar a temperatura ambiente durante 15 min
  4. En separado 1,5 mL tubos combinan 1 μg de TCR-pMIA vector con 1 μg del ratón CD3εγδζ-pMSCVII-GFP (pMIG) vector o 1 μg de cada vector separado para los controles de.
  5. Dropwise, añadir la solución DMEM/reactivo de transfección para los tubos que contienen el vector de ADN. Incubar a temperatura ambiente durante 15 min
  6. Dropwise, añadir la solución de ADN de DMEM de reactivo de transfección de las células HEK293T. Golpear suavemente la placa para mezclar. Incubar a 37 ° C durante 24 h.
  7. Después de 24 h reemplazar los medios de comunicación y mantener las células en cultivo por más de 24 h.
  8. Extraer las células de la placa mediante pipeteo vigoroso y teñir las células con el anticuerpo anti-ratón CD3 (2,5 μg/mL) para verificar la expresión superficial de la quimérica-TCR mediante citometría de flujo.
  9. Para comparar la expresión de CD3 entre células fueron transfectadas a un nivel similar, el análisis de las células que expresan un nivel alto de moléculas reportero fluorescente (GFP para complejo CD3 y ametrina de vectores de expresión de TCR) similar de la puerta. Óptimo, el análisis debe ser cerrado GFP + ametrina + células dentro de los 10 4 10 5 intensidad fluorescente ( Figura 3A).
    Nota: El nivel de expresión de CD3 en células transfectadas con la construcción quimérica debe ser comparable al vector control ratón (original plantilla) ( Figura 3A). Los vectores retrovirales de TCR generados son compatibles con sistemas de expresión de vivo como se describió anteriormente 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La eficiencia de la reacción de PCR anidado multiplex se comprueba en el paso 3.2.7 (figura 2) ejecutando a 5μl de la segunda reacción en un gel de agarosa. En promedio se espera que la eficiencia de amplificación de TCR-beta sería alrededor del 80%, mientras que la eficiencia de la reacción de la TCR-alfa es generalmente más baja, en torno al 50%4. Sólo emparejadas cadenas TCR-alfa y TCR beta pueden utilizarse para la expresión del TCR; sin embargo, todos los productos PCR podrían ser ordenados para obtener la secuencia TCR y la información de repertorio.

Silenciamiento del gen sólo permitirá una sola cadena TCR-beta ser expresado en una célula de T dada. Sin embargo, una célula T es capaz de reordenar una segunda cadena TCR-alfa, y aproximadamente el 25% de las células T que expresan un TCR-alfa de segunda en el marco cadena 14. Se espera que alguna proporción de las cadenas TCR-alfa aisladas será el secundario alfa en lugar de la cadena alfa "correcto". La cadena alfa secundaria a menudo no es un socio de Unión óptima con la cadena TCR-beta; en consecuencia, se espera que no todos los TCRs clonados formará un establo complejo y expreso en la superficie de la célula. Por lo tanto, la correcta TCR cadena emparejamiento celular superficial expresión y debe confirmarse por transfectar las células HEK293T (Figura 3A).

Figure 1
Figura 1 . PCR multiplex nested aerodinámica y retroviral construcción desarrollo de las células T. Dos ciclos de PCR como resultado en la amplificación de las cadenas de alfa y beta TCR de correspondiente. Sitios de restricción encajados los iniciadores permiten el clonación y generación de vectores quimérico ratón/humano de expresión en células de ratón. El vector del mouse plantilla puede utilizarse para cambiar fácilmente a las regiones de ratón variable para el ser humano, generando un quimérico humano/ratón TCR retroviral vector compatible con la expresión en células de ratón. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 . Ejemplo de célula PCR. Amplificación por PCR anidada Multiplex de T cell receptor beta y alfa de solo células de T humanas ordenadas en un placa de 96 pocillos. Se muestran productos PCR (superior e inferior) correspondientes de célula amplificaron TCR beta y cadenas alfa de TCR de humano PBMCs. NC - sin control de la plantilla, PC - control positivo. Ejecutando una pequeña porción de la reacción en un gel de agarosa (5 μl), se confirma la eficacia de las célula alfa y beta PCR reacciones en cadena antes de producto de PCR secuenciación. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 . Verificación de célula superficial quimérica expresión de TCR y especificidad. (A) HEK293T células fueron transfectadas con ratón TCR o un humano/ratón quimérico TCR en combinación con ratón CD3εγδζ. La expresión de superficie de células TCR se midió con el anticuerpo anti-mCD3ε. Estrategia de control: en primer lugar, el análisis es cerrado en Ametrine y GFP doble las células positivas (G2). En el caso de controles vector solo la compuerta tiene que basarse en la sola fluorescencia (G1). En segundo lugar, las células de G1 y G2 se analizan el nivel de expresión de CD3ε. (B) TCR especificidad se confirma con la tinción de tetrámero de células 293T con DRB1 * 0401:GAD115-tetrámero 127. Análisis es cerrada en GFP + ametrina + CD3ε + células, como se muestra en (A). Haga clic aquí para ver una versión más grande de esta figura.

GENE DE LA BLANCO CARTILLA DE ORIENTACIÓN SECUENCIA DE
Transcripción reversa
CDNA TRAC AGCTGGACCACAGCCG
CDNA de TRBC1 GAAATCCTTTCTCTTGACCATG
CDNA de TRBC2 GCCTCTGGAATCCTTTCTCT
Reacción de polimerización en cadena alfa de TCR 1
TRAV1-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG Externo TRAC Marcha atrás CAGACAGACTTGTCACTGGATTTAGAGTCTC Reacción de PCR TCRbeta 1 TRBV2 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Hacia adelante CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC externo Marcha atrás GTGGCCAGGCACACCAGTGTG Reacción de polimerización en cadena alfa de TCR 2 TRAC interna Marcha atrás CAGCTGGTACAccgcggGGTCAGGGTTCTG Adaptador de TRAV Hacia adelante CGGTTCAGCAGGAATGCCtacgtaATG Beta TCR reacción PCR 2 TRBC interna Marcha atrás CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adaptador Hacia adelante CAGAAGACGGCATACGAGATcaattgATG Secuencia de primers pMSCV-II Hacia adelante CCTCCTCTTCCTCCATCCGCC TCRbeta Marcha atrás GCCAAGCACACGAGGGTAGCC IRES Marcha atrás AACGCACACCGGCCTTATTCC * Minúsculas dentro de las secuencias de la cartilla indican que la enzima de restricción incorporada corte sitios

Tabla 1: Reverso transcripción, PCR y primers de secuencia.

Paso 2.2 cantidades por pozo
Reacción de RT-PCR (6μL) (ΜL)
buffer de x 10 0.6
dNTP x 2 0.24
10% Tritón X 0.06
3 cartillas de TCR-específicas (mM 10 ea.) 0.23 ea. (x 3 = 0.69)
Enzima 0.18
Inhibidor de Rnasa 0.28
NF(nuclease-Free)-H2O 3.95
Paso 3.1
una reacción de PCR 1 (25μL) (ΜL) b 1 (25μL) de la reacción de PCR (ΜL)
buffer de x 5 5 buffer de x 5 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0.75 DMSO (3%) 0.75
una piscina (cartilla F) (2.3μM) 0.3 pool b (cartilla F) (2.3μM) 0.5
una cartilla de R externa (10uM) 0.6 cartilla de R externa b (10μM) 1
Polimerasa de la DNA 0.2 Ir de Taq polimerasa 0.2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14,65 NF-H2O 14.05
Paso 3.8
Reacción de PCR 2 - igual para a y b (25μL) (ΜL)
buffer de x 5 5
dNTP (10mM) 1
DMSO 0.75
Cartilla del adaptador F (10μM) 1
Interior cartilla R (10μM) 1
Polimerasa de la DNA 0.2
Producto PCR reacción 1 2.5
NF-H2O 13.55

Tabla 2. Transcripción inversa y PCR reacciones.

Pasos 4.2 y 4.3
Reacción de síntesis TRBV (50μL) (ΜL) Resumen de vectores de mTCR-pMIA (500μL) (ΜL)
ADN (~ 20μg) ADN (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Buffer 5 10 x Buffer 50
H2O H2O
Paso 4.4
Reacción de CIP (100μL) (ΜL) DNA(~1.5mg)
> Digestión & purificado ADN vector 84 10 x Buffer 10 Enzima CIP 6 Paso 4.5 Reacción de ligadura (20μL) (ΜL) Digestión/CIPed vector ADN (cantidad total de inserto y el vector ~ 150ng) Insertar ADN (acceso 6 molar a vector) 2 x buffer ligasa 10 Enzima ligasa 1 H2O Paso 4.9 Prueba de reacción de síntesis (12μL) (ΜL) ADN (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x Buffer 1.2 H2O 9.3 Paso 4.11 Reacción de digestión TRAV (60μL) (ΜL) Que contienen beta - Resumen de vectores de mTCR-pMIA (120μL) DNA(~1.5μg) ADN (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x Buffer 6 10 x Buffer 10 H2O H2O

Tabla 3. Vector de clonación reacciones.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En el actual protocolo, describimos un método eficiente para la célula TCR amplificación y posterior sub clonación de las cadenas de alfa y beta TCR de pares en un vector de expresión retroviral de la plantilla. Aunque se han desarrollado varios protocolos PCR unicelular, ninguno hasta ahora han sido compatible con la inmediata sub clonación en un vector de expresión. En la mayoría de los casos, se amplifica una secuencia parcial que abarca las regiones CDR3 altamente variables, con suficiente secuencia para extrapolar la región variable. Este menor tamaño de producto PCR es compatible con una mayor eficiencia de la PCR, pero requiere de novo síntesis de genes TCR para estudios funcionales. El protocolo actual mantiene la eficacia de protocolos de secuenciación TCR previamente publicados se centró la CDR3 unicelular, mientras que al mismo tiempo que rinde un amplicon más larga que contiene la región entera variable conveniente para la clonación. Por lo tanto, el sistema descrito tiene una mayor flexibilidad en dar una secuencia cuantitativa, así como la salida funcional.

Dependiendo de la pregunta científica dirigida, pueden variar el origen y la especificidad de las células analizadas. Sin embargo, si el objetivo final del proyecto es el análisis de la función TCR en vivo , es necesario conocer la restricción HLA de las células T aisladas. El protocolo actual ha sido diseñado específicamente para ser compatible con en vivo expresión TCR en ratones humanizados de HLA. Muchos de estos ratones se han generado y están comercialmente disponibles, incluyendo HLA-A2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA B2705, HLA-A24 y cepas transgénicas HLA - B * 0702. Este protocolo puede ser combinado con éxito con el protocolo previamente publicado para retroviral mediada la médula célula de vástago expresión de humana TCRs4,15,16. Esperamos que el sistema de retrogenic TCR humanizado sea aplicables y muy útiles para el análisis funcional de TCR humana en varios autoinmunes, cáncer y los modelos infecciosos.

La célula actual protocolo PCR describe los pasos críticos y sugerencias necesarios para la exitosa amplificación de pares TCR-alfa y TCR beta secuencias. El primer paso crítico es una oportuna actuación de cADN transcripción y posterior primera ronda de PCR múltiplex. Todos los pasos deben realizarse de manera oportuna, y todos los reactivos y células mantienen en hielo para evitar la degradación del RNA y del cDNA. En segundo lugar, porque el protocolo está diseñado para ser muy sensibles a niveles bajos de la plantilla, es muy susceptible a la contaminación. Por lo tanto, es imprescindible trabajar en un área libre de plantilla, lejos de productos PCR amplificados o TCR vector de clonación. Se utilizará una campana o sala de cDNA y reacciones de PCR. Plantilla de la primera reacción de PCR se debe agregar en un área diferente de donde se configura la PCR. Es recomendable utilizar un sistema separado de reactivos alícuotas para los experimentos PCR unicelular.

Este protocolo ha sido específicamente optimizada utilizando los reactivos enumerados en la Tabla de materiales, y cualquier sustitución de reactivos requiere optimización adicional. La identificación inicial de las células antígeno específicas puede modificarse para utilizar tetrámeros de péptido-MHC. La tinción de tetrámero permite la evaluación simultánea de la especificidad del antígeno, así como restricción HLA. Métodos alternativos para la detección de la reactividad del antígeno, como upregulation de marcadores tempranos de activación o secreción de citoquinas inflamatorias pueden considerarse en ausencia de los reactivos de tetrámero. Por ejemplo, especificidad dual fusion anticuerpos específicos contra un antígeno de la célula de T y el IFNγ puede combinarse con el aislamiento de grano magnético para enriquecer las células productoras de IFNγ reactivo antígeno.

Mientras que la construcción de humano/ratón quimérico descrita en nuestro protocolo garantiza la compatibilidad con las células de ratón, se desconoce el nivel de su compatibilidad con CD3 humano complejo. Aunque no formalmente probado por nosotros, otros han demostrado que quiméricas construcciones TCR con regiones constantes murinas pueden expresarse en la superficie de los linfocitos humanos17. Esto indica que regiones constantes de murino TCR pueden soportar interacción con el humano CD3 de señalización complejo. Sin embargo, si el objetivo es expresar los TCRs identificados en células primarias humanas o líneas celulares humanas, como las células de Jurkat, un enfoque más óptimo puede utilizar una construcción plenamente humana. Esto se puede lograr cambiando las regiones constante murinas en el vector con regiones constantes humanas.

Si una región variable identificada de TCR contiene uno de los sitios de restricción utilizados para la clonación, el TCR debe insertarse en un vector de transporte y posteriormente transformado usando un kit de mutagénesis sitio dirigida a inducir un cambio de nucleótido silenciosa dentro de la restricción sitio de corte. Una aproximación alternativa es la síntesis de novo de la región variable del TCR de interés modificada para excluir el sitio de la restricción no deseados.

La principal limitación de esta técnica es la incapacidad para eliminar la amplificación de cadenas alfa 'citoplásmicas' secundarias. Genes de TCR-alfa no pasan por exclusión alélica como genes de TCR-beta, por lo tanto que una proporción significativa de las células T expresará una cadena alfa 'citoplásmica' secundaria14. El protocolo PCR descrito sólo resulta en la amplificación de una cadena alfa de TCR, pero si la cadena alfa amplificada es la cadena alfa 'citoplásmica' no puede emparejar con la cadena beta amplificado. Por lo tanto, es imprescindible probar la superficial expresión de TCR de la célula en células HEK293T para asegurar la sincronización de la cadena éxito.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este estudio fue financiado por la JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, DK079638-05 de la P30 del NIH 5 PJ de piloto y el Robert y Janice McNair Foundation.

Agradecemos a Sandra Peña y Andrene McDonald para el reclutamiento de pacientes, Samuel Blum para asistencia técnica, el Dr. George Makedonas por el regalo de control utilizado para la optimización de la PCR de DNA y anticuerpos.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Aerodinámico unicelular TCR aislamiento y generación de vectores retrovirales para <em>In Vitro </em>y <em>In Vivo</em> expresión de TCR humana
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter