Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

יעיל בידוד TCR תא בודד, דור של וקטורים Retroviral עבור במבחנה In Vivo הביטוי של האדם TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

המשלב בפרוטוקול הנוכחי לתא בודד לזווג אדם TCR אלפא, ביתא שרשרת רצף עם אווירודינמית דור תואם במבחנה ויוו TCR והביטוי retroviral וקטורים.

Abstract

למרות זאת, פותחו מספר שיטות רצף של תא T מזווג קולטן (TCR) שרשראות אלפא, ביתא מתאי T יחיד, אף אחד עד כה להצטיינות במורד הזרם ויוו אנליזה פונקציונלית של TCR heterodimers. פיתחנו פרוטוקול משופר מבוסס על שני שלבים מולטיפלקס-מקונן PCR, כשהתוצאה היא מוצר ה-PCR המתפרס על כל משתנה מחוזות האדם TCR אלפא ביתא רשתות. על ידי זיהוי אתרים ייחודיים הגבלת שילוב אותם תחל ה-PCR, עשינו את המוצר PCR תואם ישירה תת שיבוט לתוך תבנית retroviral וקטור. הבונה retroviral וכתוצאה מכך מקודד chimeric האדם/TCR עם העכבר העכבר מחשבים תאיים, אשר מתפקד בתאי עכבר או במודלים העכבר ' ויוו . בסך הכל, הפרוטוקול המתואר כאן משלב האנושי תא בודד לזווג TCR אלפא, ביתא שרשרת הזדהות עם דור יעילה וישימה ברצון retroviral וקטורים לביטוי TCR במבחנה , ויוו . הוידאו והחומרים הנלווים מתוכננים לתת תיאור מפורט מאוד של התא הבודד PCR, כך לשלבים הקריטיים יכול להיות החסרונות שהופעלו ופוטנציאליים להימנע. בנוסף, אנו מספקים תיאור מפורט של השלבים שיבוט הדרושים ליצור ביטוי וקטור. לאחר mastered, כל התהליך מתא יחיד מיון לביטוי TCR יכול להתבצע תוך תקופה קצרה של שבועיים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הקולטן תא T (TCR) מכתיבה תא T ההחלטה לגורל במהלך הפיתוח, מצב יציב/הומאוסטזיס, גירוי antigenic לפריפריה1,2,3. הרחבת האחרונות עמוק רצף טכנולוגיות חשף מגוון TCR בעבר מעריכים בתוך אנטיגן ספציפי תא T תגובות. TCR גיוון מצביע על פוטנציאל תא T פונקציונלית רחבה של תגובות. על מנת לשלב את ניתוח רפרטואר של רצף TCR עם TCR מבחני פונקציונלי, הגישות רצף צריך להיות מתוכנן כך שיהיה תואם מערכות ניסויית ומודלים ויוו מנוצל לניתוח פונקציונלי עוקבות של בחירה TCRs. לנו יש פיתח גישה יעילה עבור האדם TCR רצף בידוד של תת שיבוט לתוך TCR אדם chimeric/עכבר תבנית וקטורית תואם TCR ביטוי עכברים humanized הלע4. בידוד של שרשראות אלפא, ביתא המתאים של heterodimeric TCRs דורש הגברה PCR של שתי שרשראות של תא בודד. למרות, יש TCR תא בודד מספר פרוטוקולים שיבוט פותחה, מנוצל, אף אחד עד כה בקלות תואם עם תפוקה גבוהה יעיל ישירה שכפול של TCRs Vα/Vβ לא ידוע לתוך הכרחי עבור הביטוי מחדש ויוו retroviral וקטורים 4,5,6,7. מחקרים קודמים נעזרו שתי גישות הגדולות, גם להגביר באופן סלקטיבי של חלק מוגבל TCR מספיקות כדי לנחש את הרצף או כדי להגביר את כולו TCR רצף4,5,6 , 7. אנליזה פונקציונלית במורד הזרם של רצפי TCR להשיג באמצעות הגישה הראשונה דורשת יקר סיליקו הרכבה דה נובו בנייה של TCR. בעוד הגישה השניה מספק את רצף TCR מלאה, באזור קבוע האנושית אינה תואמת ויוו ביטוי TCRs משובטים במודלים של העכבר. הגישה שלנו היא תוכננה במיוחד כדי שיהיה תואם ויוו אנליזה פונקציונלית של TCRs במודלים של העכבר. פיתחנו מפושטת ויעילה יחיד תא PCR פרוטוקול המאפשר ישירה תת שיבוט של PCR קטעים לתוך תבנית הביטוי וקטור.

הגישה שלנו מנצל רגישה מאוד מולטיפלקס-מקונן PCR תגובה מבוצעת בשני שלבים. התגובה הראשונה מולטיפלקס בשלב שלולית ספציפיות עבור כל הרשתות V-בטא 40 תחל ובריכה של 44 תחל ספציפיים עבור כל הרשתות V-אלפא משמשים כדי להגביר את TCR-אלפא או בטא TCR ללא ידיעת מוקדמת של הרצף (טבלה 1). פריימר לפנים יש רצף מתאם, שסופחה לתוך 5' של המוצר ה-PCR. ומהצמיגים הפוכה מבוססת על אזור קבוע TCR. זיהינו הגבלת ייחודי אתרים, נעדרו למשתנה האנושי או צומת TCR אזורים, ושילבו האלה לתוך תחל TCRα ו- TCRβ נייווי (איור 1). התגובה השניה מקוננים, פריימר ספציפיות עבור הרצף מתאם ו פריימר הפוכה מקוננים בתוך אזור קבוע משמשים כדי להגביר עוד יותר את השלשלאות TCR עם ירידה לפרטים מוגברת (טבלה 1, איור 1). לאחר בידוד תא בודד, 2 כדורים של ה-PCR (התגובה הראשונה עם מאגר של צבעי יסוד הן Vα והן Vβ, ועם השנייה תחל מתאם) במוצר ה-PCR זה יכול להיות ישירות תת משובטים לתוך תבנית retroviral וקטור. הבונה TCR הסופי לקודד, בתוך מסגרת קריאה פתוחה יחיד (ORF), אנושי אזורים משתנה בשילוב עם העכבר קבוע אזורים מחוברים על ידי הרצף חלבון 'שהפריד עצמית', P2A (hVα-mCα-P2A-hVβ-mCβ)8. רצף P2A נעשה שימוש במערכות מרובות, נבדק באופן מקיף במיוחד עבור הביטוי TCRs8,9,10,11. למרות, אחרי תרגום מרבית השרידים רצף P2A קשור קצה קרבוקסילי שרשרת אלפא מחובר באמצעות מקשר גמיש, ואילו רצף אות שרשרת ביתא של פרולין נוספים, שינוי זה יש השפעה מזיקה על תפקוד TCR. אזור קבוע העכבר נמצא בשימוש הבונה במקום האדם להימנע פוטנציאליים שינו אינטראקציות עם רכיבים איתות במורד הזרם כאשר הביע מחדש בתאי עכבר. ORF יחיד תגרום בביטוי נפרדים stoichiometric של אלפא, בטא שרשראות9,11. בפרוטוקול הנוכחי מושתת על ריאגנטים, גישות זמינים באופן נרחב, והוא נועד להתבצע בצורה מפושטת ויעילה. למרות במיוחד השתמשנו בטכניקה זו כדי assay TCRs מתאי T self-reactive מעורבים סוכרת אוטואימונית, אנו צופים כי פרוטוקול זה יכול להיות החלים נרחב עבור זיהוי והערכה תפקודית של ספציפיות עבור האדם TCRs epitopes אוטואימונית, סרטן epitopes או התגובות פתוגנים וחיסונים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. לזהות את האוכלוסייה תא T עניין.

הערה: אנטיגן ספציפי התפשטות בשילוב עם צבע חלוקת התא (כמו Carboxyfluorescein succinimidyl אסתר, CFSE) יכול לשמש כדי לבודד תאי T מבוסס על ההפצה שלהם בתגובה לגירוי antigenic. אם החל מ- PBMCs, הרחבה 7 ימים במבחנה צריך להספיק לזהות של אנטיגן ספציפי CFSE האוכלוסיה נמוכה 12.

  1. PBMCs מיקס 1:1 עם תאים מתאימים-MHC מזין, תווית עם 5 מיקרומטר CFSE חלוקת התא לצבוע.
  2. צלחת 2-2.5 x 10 5 תאים לכל טוב ב 96-ובכן עגול-תחתון תרבות צלחת בתקשורת 200 µL 10% FCS מלאה RPMI.
    הערה: RPMI מלאה כוללת 2 מ מגלוטמין, פירובט נתרן 1 מ מ, 100 מיקרומטר MEM שאינן חיוניות חומצות אמינו, 5 מ מ HEPES, 5.5 × 10 − 5 יחידות של מרקפטואתנול, 100 מ ל U − 1 פניצילין ו 100 מ ל µg − 1 סטרפטומיצין.
  3. לעורר תאים עם אנטיגן פפטיד מיקרומטר 25.
  4. ביום הרביעי של תרבות, בזהירות להסיר ולהחליף µL 100 של המדיה-
    הערה: גישה אופטימלית יותר לזיהוי תא T אנטיגן ספציפי הוא השימוש של פפטיד-הלע tetramers 13. Tetramer מכתים מאפשר הערכה בו זמנית של ירידה לפרטים אנטיגן, וכן הלע-הגבלה.

2. להגדיר את סוג תא בודד.

  1. ביצוע כל ההליכים ברדס או אזור ייעודי ללא תבנית מוגבר. Aliquot ריאגנטים כדי למנוע זיהום, לנקות כל משטחי עבודה, אם ריאלי, ציוד עם 10% אקונומיקה לפני התקנת ה-PCR. השתמש טיפים מסנן, ריאגנטים חינם RNAse ו- DNAse ופלסטיק כל PCR ו וקטור שיבוט צעדים. ריאגנטים מפתח ניתן למצוא טבלת חומרים.
    הערה: התגובה PCR מולטיפלקס היא רגישה מאוד, רמות נמוכות של זיהום יכול לגרום מוצר מוגבר.
  2. צור המיקס מאסטר שעתוק במהופך על ידי שילוב של 10 x RT התגובה מאגר, 25 X DNTPs, האנזים U RT 9, 0.01% טריטון-X, מעכב 0.7 U RNAse, ו- 383 nM של כל פריימר RT-TCR (המפורטים בטבלה 1) מאגר pipetting סטרילי. על כל צלחת 96-ובכן, להמציא מספיק מיקס מאסטר לתגובות נוספות 10 (סה כ 106), כדי לפצות על אובדן נוזלים במהלך pipetting. ראה בטבלה 2 עבור רכיבי התגובה וכמויות לכל טוב.
  3. צלחת
  4. הכן אוסף ה-PCR 96-ובכן עבור תא מיון לפי pipetting 6 µL של המיקס מאסטר שעתוק במהופך לכל באר עם פיפטה רב-ערוצי. לקחת את הצלחת על קרח או בבלוק קר.
  5. תווית תאים עם נוגדנים לתא סמני פני השטח (כגון CD4 ו- CD3, או CD8 CD3, כל אחד ב- 2 µg/mL, בשילוב עם חלוקת התא לצבוע או tetramer מכתים).
  6. תא
  7. תאי T מיון אחד לכל טוב, דילוג על השורה השתים עשרה, אשר ישמש פקד שלילי.
    הערה: היעילות של המיון יהיה תלוי אוסף מדויק היישור צלחת בתוך את לוחית, כמו גם שמירה על התאים ואת לוחות בטמפרטורה נמוכה לפני cDNA התגובה. אוסף צלחות יש לשמור על קרח בכל עת, למעט במהלך מיון, כאשר הם קבועים בתוך לוח הקירור. הממיינים לא כל מצויידים עם בעל צלחת מווסתת טמפרטורה; עם זאת, מומלץ מאוד לשימוש. כיוון המיון בדרך כלל לוקח בערך 10-15 דקות לכל צלחת, יש פוטנציאל מוגברת RNA השפלה אם הצלחת שלא נשמר בטמפרטורה נמוכה.
  8. כפקד חיובית, להוסיף מספר גדול יותר של תאים (תאים 100) באופן ידני עם פיפטה אחת הבארות בשלב זה. לחלופין, בעבר מבודד RNA מתאי במאגר יכול לשמש פקד חיובי ב-10 נג לכל טוב.
    הערה: פיפטה מטוהרים שליטה RNA עם דיוק ולדאוג למניעת זיהום צולב של אחרים בארות, תוצאות חיוביות שגויות.
  9. לאטום את הצלחת עם סרט דביק, ספין למטה ב- 1000 g x עבור 5 דקות ב-4 מעלות צלזיוס
  10. לתמלל באופן מיידי RNA ל cDNA מאת המקננת את הצלחת ב 25 מעלות צלזיוס למשך 10 דקות, 37 מעלות צלזיוס במשך 45 דקות, ו- 85 מעלות צלזיוס במשך 10 דקות
    הערה: כדי להבטיח תגובה PCR יעיל, מומלץ כי התגובה הראשונה של ה-PCR להתבצע באותו היום. לחלופין, הלוחות משועתקים ניתן לשמור ב- 80 ° C עד 2 חודשים-

3. לבצע PCR מולטיפלקס-מקונן

הערה: הכנת תערובות מאסטר כל באזור נקי ללא תבנית כדי למנוע זיהום.

פריימר
  1. לשקם כל אזור משתנה 100 מיקרומטר עם DNAse ו RNAse חינם H 2 O. לשלב הבא, 20 µL של כל אחד תחל 44 כדי ליצור מאגר פריימר V-אלפא. כדי להפיק את V-בטא פריימר בריכה לשלב 20 µL של כל אחד תחל V-בטא 40 פלוס µL 80 DNAse, RNAse חינם H 2 פריימר או רצפי המפורטים בטבלה 1. ברגע, איחדו הריכוז של כל פריימר בתערובת הוא 2.3 מיקרומטר.
  2. לשקם את אזור קבוע תחל 100 מיקרומטר פתרון מניות עם DNAse וללא RNAse H 2 O. Dilute את אזור קבוע תחל 10 מיקרומטר הפתרון עובד, aliquot לשימוש.
  3. להכין שתי תערובות מאסטר נפרד הגברה TCR-אלפא ו TCR בטא. ליצור את תערובות הראשי על-ידי שילוב 5 X מאגר, 80 מיקרומטר dNTPs, דימתיל סולפוקסיד 3%, 2 מיקרומטר פריימר בריכה (הריכוז הסופי של 46 ננומטר עבור כל פריימר), 200 ננומטר TCR-קבוע אזור פריימר הפוכה, 1 U DNA פולימראז ו DNAse ו RNAse חינם H 2 O (בטבלה 2 < / חזק >). על כל צלחת 96-ובכן, להמציא מספיק מיקס מאסטר לתגובות נוספות 10 (סה כ 106), כדי לפצות על אובדן נוזלים במהלך pipetting.
    הערה: החישובים מבוססים על נפח PCR הסופי של µL 25 לכל טוב, איפה 22.5 µL מאסטר PCR מיקס בשילוב עם 2.5 תבנית cDNA µL.
  4. לקחת את הצלחת עם cDNA על קרח או בבלוק קר. להשתמש רב-ערוצי פיפטה 22.5 µL של תגובה TCR בטא לתוך צלחת חדשה של ה-PCR 96-ובכן. ואז להשתמש רב-ערוצי להעביר µL 2.5 של cDNA המשקולת PCR.
  5. להשתמש רב-ערוצי פיפטה 22.5 µL של תגובה TCR-אלפא ישירות לתוך הבסיס המכיל את שארית cDNA.
  6. חותם הצלחות עם דבק בעדינות מערבולת, ספין למטה ב- 1000 g x עבור 5 דקות ב-4 מעלות צלזיוס
  7. להפעיל את תגובת ה-PCR מולטיפלקס במחזורים הבאים: 5 דקות ב 95 ° C ואחריו 34 מחזורים של 20 s ב 95 ° C, 30 s ב 54 ° C, ו- 1 דקות ב-72 מעלות, ואחריו 7 דקות-72 מעלות צלזיוס
  8. µL
  9. לשאת את התגובה PCR מקוננים בתוך נפח סופי של 25, באמצעות µL 2.5 של תערובת PCR מולטיפלקס כתבנית.
    1. לשקם את תחל פנימי וגם מתאם 100 מיקרומטר עם DNAse, RNAse חינם H 2 O. להפוך 10 מיקרומטר aliquots המניות לעבוד.
    2. להכין שתי תערובות מאסטר נפרד ampl TCR-אלפא ו TCR בטאification. מיקס 5 X מאגר, 25 X DNTP, 3% דימתיל סולפוקסיד, 200 ננומטר מתאם קדמי פריימר, 200 ננומטר פריימר מקוננים הפוכה, U DNA פולימראז 1, ו DNA פולימראז ו נטול נוקלאז H 2 O עבור נפח סופי של 22.5 µL (טבלה 2). על כל צלחת 96-ובכן, להמציא מספיק מיקס מאסטר לתגובות נוספות 10 (סה כ 106), כדי לפצות על אובדן נוזלים במהלך pipetting.
      הערה: בשימוש התגובה השנייה PCR 5 X PCR מאגר המכיל צבע טעינה כדי להקל על ג'ל agarose טעינה.
    3. באמצעות רב-ערוצי pipette את תערובות TCR-אלפא TCR בטא התגובות ב 22.5 µL לכל טוב לתוך שתי צלחות PCR החדש של 96-ובכן האב.
    4. להוסיף את תבנית התגובה PCR מולטיפלקס µL 2.5 לכל טוב.
      הערה: התגובה PCR הנותרים הראשונה צריך להיות אטום, המאוחסנים ב-20 ° C כדי לשמש כמקור של תבנית נוספת, אם יש צורך (ראה צעד הערה 4.3).
    5. לאטום את הצלחות מערבולת ובעדינות ספין למטה ב- g 1000 x עבור 5 דקות ב-4 מעלות צלזיוס
    6. להפעיל את תגובת ה-PCR מקוננות במחזורים הבאים: 5 דקות ב 95 ° C ואחריו 34 מחזורים של 20 s ב 95 ° C, 30 s ב 56 ° C, ו- 1 דקות ב-72 מעלות, ואחריו 7 דקות-72 מעלות צלזיוס
    7. לרוץ 5 µL של התגובה האחרונה בחוץ על agarose 1% ג'ל המכיל אתידיום ברומיד (כולל הבארות שליטה שלילי וחיובי).
      הערה: הלהקה צפויה לפעול בגודל bp כ-500. לתגובה לדוגמה מוצג באיור 2.
    8. לטהר את שאר התגובה השנייה (20 µL) באמצעות תבנית 96-ובכן ערכת טיהור PCR, elute עם µL 15 של 70 מעלות צלזיוס H 2 O לכל טוב, ולבצע סנגר רצף. השתמש את המתאים TCR-אלפא או בטא TCR מתאם קדמי פריימר על רצף (טבלה 1).
      הערה: רצפים ניתן לנתח בעזרת תוכנת immunogenetics זמינים באינטרנט-

4. תת שיבוט רשתות ה-PCR אלפא ביתא.

הערה: הבריכה תחל קדימה מנוצל התגובה הראשונה, את צבעי יסוד הפוכה, בעקבות תגובות PCR השני משמשים לשילוב באתרים מגבלת. לכן, שהושג אלפא ביתא שרשרת PCR המוצרים מוכנים להיות ברצף תת משובטים לתוך תבנית retroviral וקטור ( איור 1).

מוצרי
  1. לעכל ה-PCR מטוהרים את גרסת הבטא מקונן התגובה עם BstbI ו- MfeI (טבלה 3).
    הערה: לא יעלה על 5 הוספה µg.
  2. במקביל, לעכל את תבנית הווקטור עם BstbI ו- MfeI (טבלה 3). השתמש µg 1-2 של וקטור תבנית לכל TCR. להפעיל את הווקטור מתעכל ג'ל agarose, לבודד את הלהקה גדול יותר (~ 7500 bp). לטהר את הווקטור עם ג'ל ערכת טיהור DNA-
    הערה: במהלך התקציר אנזים הגבלה, האזור תבנית משתנה TCR בטא מאתר מוסר, המאפשר התוספת של האזור משתנה האדם TCR-beta-
  3. לטהר את המוצרים PCR מתעכל באמצעות ערכת טיהור PCR.
    הערה: ודא את יכולת טיהור DNA של העמודות הכלולות בערכה; השתמש מספר עמודות במידת הצורך. כמות המינימום הוספה מטוהרים הכרחי לתגובה מצדו מוצלח הוא 50 ng-ריכוז מינימלי של 10 ng/µL. אם הסכום מטוהרים הוספה אינה מספקת עבור מצדו מוצלח, התגובה PCR השני שיכול לחזור.
  4. מתייחס המבוססת על תבנית עם אנזים 10 U CIP עבור 1 h ב 37 ° C כדי למנוע מצדו עצמית, ואחריו איון חום למשך 10 דקות ב-75 ° ג Purify ה-DNA עם ערכת טיהור PCR (טבלה 3).
  5. Ligate TCR בטא הכנס והפעל וקטוריות באמצעות DNA ליגאז הנפח הכולל 20 µL-6 טוחנת עודף של הקדמי למשך 30 דקות בטמפרטורת החדר.
    הערה: בסך הכל, התגובה מצדו צריך להכיל כ-150 ng של DNA (טבלה 3).
  6. להמרות, לערבב µL 8 התגובה מצדו עם 80 µL של e. coli DH5α כשיר מבחינה כימית תאים (טבלה של חומרים), דגירה על קרח במשך 30 דקות הלם חום ב 42 מעלות צלזיוס במשך 45 µL להוסיף 500 ש סופר מרק אופטימלית עם אמצעי דיכוי (S.O.C.) Catabolite ו- shake עבור 1.5 h ב- 37 מעלות צלזיוס.
  7. צלחת החוצה 250 µL של התרבות חיידקי לוקחת אמפיצילין המכיל צלחת אגר Lysogeny מרק (ליברות). דגירה לצלחת בן לילה (~ 16 h) ב- 37 מעלות צלזיוס.
  8. למחרת לבחור מושבות חיידקים, גדלים להם 3 מ ל LB בינוני המכיל אמפיצילין בן לילה. לבודד את הדנ א פלסמיד באמצעות ערכת טיהור פלסמיד דנ א.
  9. לאשר את הכניסה המוצלחת של שרשרת ביתא על ידי מבחן בקנה מידה קטן-תקציר עם אנזימי הגבלה BstbI ו- MfeI. ב 12 µL התגובה הכולל אמצעי אחסון, לשלב 200-500 µg פלסמיד DNA µL 0.25 של כל אנזים, מאגר אנזים X 10 (טבלה 3). להפעיל את תגובת בחוץ על agarose 1% ג'ל המכיל אתידיום ברומיד כדי לאשר את הגודל של הלהקה הוספה (~ 500 bp).
  10. לאחר המאשרים את נוכחותם של הקדמי, רצף המקטע TCR בטא של הווקטור באמצעות פריימר הפוכה של IRES (טבלה 1).
  11. בעקבות אישור לרצף תותב TCR בטא, לבצע תהליך דומה עבור הכניסה של האזור משתנה אלפא. לעכל את המוצרים PCR מטוהרים התגובה מקוננים אלפא, והוספה של החדש שנוצר TCR בטא וקטורית, עם SnaBI, SacII.
    הערה: במהלך התקציר אנזים הגבלה, האזור תבנית משתנה TCR-אלפא מאתר מוסר, המאפשר התוספת של האזור משתנה האדם TCR-אלפא-
  12. Ligate אלפא מוסיף וקטורים TCR בקידוד המתאים בטא משתנה האזור באמצעות DNA ליגאז הנפח הכולל 20 µL-6 טוחנת עודף של הקדמי למשך 30 דקות בטמפרטורת החדר.
    הערה: בסך הכל, התגובה מצדו צריך להכיל כ-150 ng של DNA (טבלה 3).
  13. להמרות, לערבב µL 8 התגובה מצדו עם 80 µL של e. coli DH5α כשיר מבחינה כימית תאים (טבלה של חומרים), דגירה על קרח במשך 30 דקות הלם חום ב 42 מעלות צלזיוס במשך 45 ס' להוסיף 500 µL S.O.C. בינוני ו- shake עבור 1.5 h ב- 37 מעלות צלזיוס.
  14. צלחת החוצה 250 µL של התרבות חיידקי לוקחת אמפיצילין המכיל צלחת אגר Lysogeny מרק (ליברות). דגירה לצלחת בן לילה (~ 16 h) ב- 37 מעלות צלזיוס.
  15. למחרת לבחור מושבות חיידקים, גדלים להם 3 מ ל LB בינוני המכיל אמפיצילין בן לילה. לבודד את הדנ א פלסמיד באמצעות ערכת טיהור פלסמיד דנ א.
  16. לאשר את הכניסה המוצלחת של שרשרת אלפא על ידי מבחן בקנה מידה קטן-תקציר עם אנזימי הגבלה SnaBI ו- SacII. באמצעי התגובה הכולל 12 µL לשלב 200-500 µg פלסמיד DNA µL 0.25 של כל אנזים, מאגר אנזים x 10 (טבלה 3). להפעיל את תגובת בחוץ על agarose 1% ג'ל המכיל אתידיום ברומיד כדי לאשר את הגודל של הלהקה הוספה (~ 500 bp).
  17. לאחר המאשרים את נוכחותם של הקדמי, רצף המקטע TCR-אלפא של הווקטור באמצעות ומהצמיגים MSCV2-קדימה (טבלה 1).
  18. , ברגע, הרצף שרשרת אלפא תוחזר לאמת את תותב TCR מלאה על ידי רצף עם פריימר TCR בטא-היפוך של IRES-הפוכה (טבלה 1).

5. ודא TCR תא השטח ביטוי וספציפיות.

הערה: HEK293T תאים משמשים כדי לבדוק מוצלחת TCR שרשרת פאריng ותא על פני השטח ביטוי ( איור 3 א) 8. פפטיד-MHC tetramer מכתים גם ניתן לבצע על תאים HEK293T transfected כדי לבדוק את השמירה של ירידה לפרטים antigenic פוסט TCR ג'ין בידוד ( איור 3B).

  1. צלחת את התאים HEK293T תרביות רקמה. ובכן 12 צלחות-עונה 1 פרק 10 5 תאים לכל באר 1 מ"ל מלאה DMEM מדיה המכילה 5% FCS והתרבות בין לילה-37 ° ג צלחת בחוץ מספיק תאים כדי ייעד את וולס נפרד עבור כל TCR חדש , פקד בתבנית TCR וקטור, CD3 וקטור בלבד, לשלוט וקטור TCR בלבד, ו שאינם transfected טוב.
    הערה: תרביות תאים עם העכבר תבנית לחלוטין TCR וקטור (mTCR-pMIA) בשילוב עם וקטור mCD3εγδζ-pMIG, וקטור mTCR-pMIA לבד, ו mCD3εγδζ-pMIG וקטור לבד משמשים פקדים חיוביים ושליליים.
    הערה: DMEM מלאה כוללת 2 מ מגלוטמין, 1 מ"מ נתרן פירובט, 100 מיקרומטר חומצות אמינו שאינן הכרחיות, 5 מ מ HEPES מאגר, 5.5 x 10 יחידות -5 מרקפטואתנול, פניצילין U/ml 100/סטרפטומיצין....
  2. למחרת, transfect את התאים עם וקטור h/mTCR-pMIA chimeric µg 1, 1 µg העכבר CD3εγδζ-pMSCVII-GFP (pMIG) וקטור ריאגנט ליפוזום מבוססי תקנים בעקבות הוראות יצרן-
  3. עבור כל TCR, הוספת ריאגנט 6 של תרביות תאים µL בטמפרטורת החדר µL 100, ללא סרום DMEM. בקצרה מערבולת, דגירה בטמפרטורת החדר במשך 15 דקות
  4. ב mL 1.5 נפרד צינורות לשלב 1 µg של וקטור TCR-pMIA עם העכבר µg 1, CD3εγδζ-pMSCVII-GFP (pMIG) וקטור, או µg 1 של כל וקטור נפרדים עבור פקדים.
  5. Dropwise, להוסיף את הפתרון ריאגנט/DMEM תקנים הצינורות המכילים המבוססת על ה-DNA. דגירה בטמפרטורת החדר במשך 15 דקות
  6. Dropwise, להוסיף את הפתרון ריאגנט/DMEM/ה-DNA של תרביות תאים לתאים HEK293T. טפח בעדינות את הצלחת לערבב. דגירה ב 37 ° C עבור ה 24
  7. לאחר 24 h להחליף את המדיה, ולשמור תאים בתרבות עבור ה 24 שעות נוספות
  8. להסיר תאים מהצלחת מאת pipetting נמרצת, מכתים את התאים עם העכבר אנטי CD3 נוגדנים (2.5 µg/mL) כדי לוודא משטח הבעת chimeric-TCR מאת cytometry זרימה.
  9. על מנת להשוות CD3 הביטוי בין התאים היו transfected לרמה דומה, שער הניתוח על תאים לבטא ברמה גבוהה דומה של מולקולות כתב פלורסנט (GFP עבור CD3 מורכבים, ו Ametrine עבור וקטור ביטוי TCR). בצורה אופטימלית, הניתוח צריך להיות פיקוח GFP + Ametrine + תאים בתוך 10 4 כדי 5 10 פלורסנט בעוצמה ( איור 3 א).
    הערה: הרמה של CD3 ביטוי בתאים transfected עם הבונה chimeric אמורים להיות דומים במהירותם הווקטור העכבר (התבנית המקורית) שליטה ( איור 3 א). הווקטורים retroviral TCR שנוצר תואמים לויוו ביטוי מערכות כמו שתואר לעיל 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

היעילות של התגובה PCR מולטיפלקס-מקונן נבדקת בשלב 3.2.7 (איור 2) מאת פועלת 5µL התגובה השניה הג'ל agarose. בממוצע היעילות של הגברה TCR בטא צפוי להיות בסביבות 80%, בעוד היעילות של התגובה TCR-אלפא הוא בדרך כלל נמוך יותר, בסביבות 50%4. רק לזווג TCR-אלפא TCR בטא רשתות ניתן להשתמש להבעה TCR; עם זאת, כל מוצרי ה-PCR יכול להיות רציף כדי לקבל רצף TCR ומידע רפרטואר.

ג'ין להשתיק יאפשר רק שרשרת TCR בטא אחת להתבטא תא T נתון. עם זאת, תא T הוא מסוגל סידור מחדש של שרשרת TCR-אלפא השנייה, כ-25% של תאי T לבטא TCR-אלפא השני במסגרת שרשרת 14. הוא צפוי כי קצת פרופורציה של הרשתות TCR-אלפא מבודד יהיה אלפא משני במקום שרשרת אלפא "הנכונה". שרשרת אלפא המשני הוא לעתים קרובות לא שותף מחייב אופטימלית עם השרשרת TCR בטא; כתוצאה מכך, צפוי כי לא כל TCRs משובטים יהוו אורווה אקספרס על פני התא ומורכבת. לכן, ראוי TCR שרשרת זיווג ותא משטח הביטוי יש לאשר מראש transfecting תאים HEK293T (איור 3 א).

Figure 1
איור 1 . PCR מולטיפלקס-מקונן יעילה ופיתוח לבנות retroviral מתאי T יחיד. שני סיבובים של PCR לגרום הגברה של שרשראות אלפא, ביתא TCR המתאימים. הגבלת האתרים להטביעה תחל מאפשרים תת שיבוט מאופין בעיצוב דור של וקטור chimeric האדם/עכבר להבעה תאי עכבר. הווקטור העכבר תבנית ניתן לעבור בקלות את העכבר משתנה אזורים עבור האדם, יצירת TCR אדם chimeric/עכבר תואם עם ביטוי retroviral וקטור בתאי עכבר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 . דוגמה של תא בודד PCR. מגה-פלקס מקוננים PCR הגברה של תא T קולטן שרשראות ביתא, אלפא יחיד מתאי T אנושיים מתמיינים לוח 96-ובכן אחד. מוצגות המתאים (העליון והתחתון) PCR מוצרים מתא בודד מוגבר TCR בטא ו TCR שרשראות אלפא מן האדם PBMCs. NC - אין שליטה תבנית, PC - בקרה חיובית. על ידי מפעיל חלק קטן של התגובה ג'ל agarose (5 µL), אישר את היעילות של תא בודד אלפא ביתא שרשרת PCR תגובות לפני המוצר PCR רצף. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 . אימות של התא על פני השטח chimeric TCR ביטוי וספציפיות. (א) HEK293T תא היו transfected עם עכבר TCR או עכבר/האדם TCR chimeric בשילוב עם העכבר CD3εγδζ. הביטוי TCR משטח תאים נמדדה עם נוגדן anti-mCD3ε. Gating אסטרטגיה: ראשית, הניתוח יש פיקוח על Ametrine תאים ו- GFP כפול חיובי (G2). במקרה של פקדים וקטור יחידה gating חייב להתבסס על ידי קרינה פלואורסצנטית (G1) יחיד. שנית, התאים G1 ו G2 הם ניתחו עבור הרמה של ביטוי CD3ε. ירידה לפרטים (B) TCR אושר על ידי tetramer מכתים של תאים 293T עם DRB1 * 0401:GAD115-tetramer-127. ניתוח יש פיקוח על GFP + Ametrine + CD3ε + תאים, כפי שמוצג (A). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

היעד ג'ין התמצאות פריימר רצף
שעתוק במהופך
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR התגובה PCR אלפא 1
TRAV1-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 קדימה CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 קדימה CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
td > TRAV17 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 קדימה CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 קדימה CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 קדימה CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 קדימה CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 קדימה CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC חיצוני הפוך CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR תגובה 1 TRBV2 קדימה CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 קדימה CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 קדימה CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 קדימה CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 קדימה CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 קדימה CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 קדימה CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 קדימה CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 קדימה CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 קדימה CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 קדימה CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 קדימה CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 קדימה CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 קדימה CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 קדימה CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 קדימה CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >קדימה CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 קדימה CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 קדימה CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 קדימה CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 קדימה CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 קדימה CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 קדימה CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 קדימה CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 קדימה CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 קדימה CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC חיצוניים הפוך GTGGCCAGGCACACCAGTGTG TCR אלפא PCR תגובה 2 TRAC פנימי הפוך CAGCTGGTACAccgcggGGTCAGGGTTCTG מתאם לחצות לגבה קדימה CGGTTCAGCAGGAATGCCtacgtaATG TCR בטא PCR תגובה 2 TRBC פנימי הפוך CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG מתאם TRBV קדימה CAGAAGACGGCATACGAGATcaattgATG רצף תחל pMSCV-II קדימה CCTCCTCTTCCTCCATCCGCC TCRbeta הפוך GCCAAGCACACGAGGGTAGCC IRES הפוך AACGCACACCGGCCTTATTCC * האותיות הרישיות והקטנות בתוך הרצף פריימר מציינים שאנזים הגבלה incorporated לחתוך אתרים

טבלה 1: הפוכה שעתוק, PCR ורצף תחל.

שלב 2.2 כמויות לאדם טוב
RT-PCR התגובה (6μL) (ΜL)
מאגר x 10 0.6
2 x dNTP 0.24
טריטון 10% X 0.06
TCR הספציפי 3 תחל (10 מ מ ea.) 0.23 ea. (x 3 = 0.69)
אנזים 0.18
Rnase מעכב 0.28
NF(nuclease-free)-H2O 3.95
שלב 3.1
תגובת ה-PCR 1 (25μL) (ΜL) b PCR תגובה 1 (25μL) (ΜL)
מאגר x 5 5 מאגר x 5 5
dNTP (10 מ מ) 1 dNTP (10 מ מ) 1
דימתיל סולפוקסיד 0.75 דימתיל סולפוקסיד (3%) 0.75
בריכה (פריימר F) (2.3μM) 0.3 בריכת b (פריימר F) (2.3μM) 0.5
פריימר R חיצוניים (10uM) 0.6 b R חיצוני פריימר (10μM) 1
Dna פולימראז 0.2 ללכת. אנזימים 0.2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14.05
שלב 3.8
PCR התגובה 2 - אותו הדבר עבור ו- b (25μL) (ΜL)
מאגר x 5 5
dNTP (10 מ מ) 1
דימתיל סולפוקסיד 0.75
מתאם F פריימר (10μM) 1
R פנימי פריימר (10μM) 1
Dna פולימראז 0.2
PCR rxn 1 מוצר 2.5
NF-H2O 13.55

בטבלה 2. שעתוק במהופך, תגובות PCR.

שלבים 4.2 ו- 4.3
התגובה תקציר TRBV (50μL) (ΜL) תקציר וקטור mTCR-pMIA (500μL) (ΜL)
דנ א (~ 20μg) דנ א (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x מאגר 5 10 x מאגר 50
H2O H2O
שלב 4.4
התגובה CIP (100μL) (ΜL) DNA(~1.5mg)
> מתעכל & טיהור DNA וקטור 84 10 x מאגר 10 אנזים CIP 6 שלב 4.5 מצדו תגובה (20μL) (ΜL) וקטור מתעכל/CIPed דנ א (סכום insert ווקטור הוא ~ 150ng) הכנס ה-DNA (6 גישה טוחנת וקטוריים) 2 x ליגאז מאגר 10 האנזים ליגאז 1 H2O שלב 4.9 מבחן התגובה תקציר (12μL) (ΜL) דנ א (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x מאגר 1.2 H2O 9.3 שלב 4.11 ? טרוו ' תקציר התגובה (60μL) (ΜL) בטא המכיל - תקציר וקטור mTCR-pMIA (120μL) DNA(~1.5μg) דנ א (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x מאגר 6 10 x מאגר 10 H2O H2O

בטבלה 3. וקטור שיבוט תגובות.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בפרוטוקול הנוכחי, אנו מתארים שיטה יעילה עבור הגברה TCR תא בודד ו עוקבות תת שיבוט לזווג TCR אלפא ביתא רשתות לתוך תבנית הביטוי retroviral וקטור. למרות זאת, פותחו מספר פרוטוקולים PCR תא בודד, אף עד כה תואם מיידית תת שיבוט לתוך וקטור ביטוי. ברוב המקרים, רצף חלקי המקיף את האזורים CDR3 משתנה מאוד מוגבר, עם מספיק רצף להסיק האזור משתנה. זה גודל קטן יותר של מוצר ה-PCR תומך PCR יעילות גבוהה יותר, אך מחייבת דה נובו TCR ג'ין סינתזה ללימודי פונקציונלי. בפרוטוקול הנוכחי שומר על היעילות של תא בודד ממוקדות CDR3 שפורסמו בעבר TCR רצפי פרוטוקולים, בזמן בו זמנית מניב אמפליקון ארוך המכיל את האזור משתנה לגמרי מתאים שיבוט. לכן, המערכת המתוארת יש גמישות מוגברת של נתינה של רצף כמותי, וכן פלט פונקציונלי.

בהתאם השאלה המדעית התייחס, מקור וספציפיות של תאי T ניתח יכול להשתנות. עם זאת, אם היעד הסופי של הפרויקט הוא הניתוח של הפונקציה TCR ויוו , זה צורך להכיר את ההגבלה הלע תאי T מבודד. בפרוטוקול הנוכחי תוכנן במיוחד כך שיהיה תואם ויוו TCR ביטוי בעכברים humanized הלע. רבים של עכברים אלה נוצרו, עכשיו הם זמינים מסחרית, לרבות הלע-A2.1, הלע-DQ8 (הלע-DQA1 * 301, הלע-DQB1 * 302), הלע-DQ6 (DQA1 * 0102, HLADQB1 * 0602), הלע-DR4 (DRB1 * 0401), הלע-DR1 (DRA * 0101, DRB1 * 0101), הלע-A11 (A * 11:01/K), הלע-B2705, הלע-A24, הלע - B * 0702 הטרנסגניים זנים. פרוטוקול זה ניתן לשלב בהצלחה עם פרוטוקול שפורסמו קודם לכן עבור retroviral מח עצם בתיווך ביטוי תאי הגזע האנושי TCRs4,15,16. אנו מצפים כי מערכת retrogenic TCR humanized יהיה רלוונטי ושימושי מאוד לניתוח פונקציונליים של האדם TCRs שונות אוטואימונית, סרטן, ומודלים זיהומיות.

התא הבודד הנוכחי PCR פרוטוקול מתאר את השלבים הקריטיים ונותן הצעות הכרחי עבור הגברה מוצלחת של TCR לזווג-אלפא ורצפים TCR בטא. השלב הקריטי הראשון היא הופעה במועד של cDNA שעתוק, לאחר מכן בסיבוב הראשון של ה-PCR מולטיפלקס. כל השלבים הכרוכים צריכה להתבצע באופן מסודר, כל ריאגנטים, תאי שמר על קרח כדי למנוע השפלה RNA ו- cDNA. שנית, מאחר הפרוטוקול נועדה להיות רגישה מאוד לרמות נמוכות של התבנית, לא רגישים מאוד זיהום. לכן, זה הכרחי לעבודה באזור ללא תבנית, מוצרי ה-PCR מוגבר או TCR וקטור שיבוט. חדר נפרד או המנוע אמור לשמש להגדרת cDNA ותגובות PCR. תבנית מתוך התגובה הראשונה של ה-PCR צריך להתווסף באיזור שונה מאיפה ה-PCR מוגדר. רצוי כי ערכה נפרדת של ריאגנטים aliquoted להשתמש עבור הניסויים PCR תא בודד.

פרוטוקול זה במיוחד מוטבה באמצעות של ריאגנטים המופיעים בטבלה של חומרים, כל ההחלפות של ריאגנטים ידרוש מיטוב נוספות. הזיהוי הראשוני של תאים אנטיגן ספציפי יכול להיות שונה לשימוש tetramers פפטיד-MHC. Tetramer מכתים מאפשר הערכה בו זמנית של ירידה לפרטים אנטיגן, וכן הלע-הגבלה. שיטות אלטרנטיביות עבור זיהוי אנטיגן תגובתיות, כגון קולטנים upregulation של סמני הפעלה מוקדמת או הפרשת ציטוקינים דלקתיים יכול להיחשב בהיעדרו של ריאגנטים tetramer. לדוגמה, ירידה לפרטים כפול פיוז'ן נוגדנים ספציפיים עבור תא T אנטיגן ו IFNγ יכול להיות משולב עם חרוז מגנטי בידוד להעשיר עבור תאים IFNγ בהפקת תגובתי אנטיגן.

בעוד הבונה אדם chimeric/עכבר שמתואר פרוטוקול שלנו מבטיח תאימות עם התאים בעכבר, לרמת התאימות שלו ל- CD3 האנושית מורכבת אינו ידוע. אמנם לא באופן רשמי נבדק על ידינו, אחרים הראו כי המבנים chimeric TCR עם אזורים קבוע מאתר יכול לבוא לידי ביטוי על פני השטח של לימפוציטים אנושיים17. אפשרות זו מציינת כי מאתר TCR אזורים קבוע יכול לתמוך באינטראקציה עם אדם CD3 באיתות מורכבים. עם זאת, אם המטרה היא לבטא את TCRs מזוהה תאים אנושיים הראשי או שורות תאים אנושיים, כגון תאים Jurkat, גישה אופטימלית יותר ייתכן להשתמש בונה אנושית לחלוטין. זה יכול להתבצע על ידי החלפת אזורים קבוע מאתר בתוך וקטור עם אזורים קבוע אנושי.

אם אזור משתנה מזוהה TCR מכיל אתרים הגבלת שימוש עבור שכפול, TCR צריך להיות מוכנס לתוך וקטור הסעות, לאחר מכן עבר מוטציה באמצעות ערכת מוטגנזה מכוונת בוים אתר לזירוז שינוי נוקלאוטיד שקט בתוך ההגבלה חותכים את האתר. גישה חלופית היא דה נובו סינתזה של האזור משתנה TCR עניין שונה כדי לא לכלול אתר ההגבלה לא רצויים.

המגבלה העיקרית של טכניקה זו היא חוסר היכולת לחסל הגברה של שרשראות אלפא 'cytoplasmic' משני. TCR-אלפא גנים לא עברה הדרה allelic כמו גנים TCR בטא, ולכן שחלק ניכר בתאי T מבטאים שרשרת אלפא 'cytoplasmic'14משני. הפרוטוקול המתואר PCR תוצאות רק הגברה של אחד שרשרת אלפא TCR, אך אם שרשרת אלפא מוגבר שרשרת אלפא 'cytoplasmic' זה לא ייתכן לשייך שרשרת ביתא מוגבר. לכן, זה הכרחי כדי לבדוק ביטוי פני השטח של התא TCR בתאים HEK293T כדי להבטיח רשת המצליחה זיווג.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

מחקר זה מומן על ידי האגודה לסוכרת נעורים 1-FAC-2014-243-A-N, עדה 7-14-JF-07, NIH 5 P30 DK079638-05 טייס פיג'יי, ואת רוברט ג'ניס מקנייר קרן.

אנו מודים Pena סנדרה ומקדונלד Andrene על גיוס החולה, סמואל בלום לקבלת סיוע טכני, ד ר ג'ורג Makedonas על המתנה של נוגדנים ושליטה DNA משמש PCR אופטימיזציה.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
יעיל בידוד TCR תא בודד, דור של וקטורים Retroviral עבור <em>במבחנה </em> <em>In Vivo</em> הביטוי של האדם TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter