Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Aerodinâmico única célula TCR isolamento e geração de vetores retrovirais para In Vitro e In Vivo de expressão de TCRs humanas

doi: 10.3791/55379 Published: September 10, 2017

Summary

O atual combina de protocolo único celular emparelhado humana TCR alfa e beta cadeia sequenciamento com simplificada geração de vetores retrovirais compatíveis com expressão de TCR in vitro e in vivo .

Abstract

Embora, desenvolveram-se vários métodos de sequenciamento de emparelhados T cell receptor (TCR) alfa e beta cadeias de células T únicas, nenhum até agora têm sido propício à jusante na vivo análise funcional de TCR heterodímeros. Nós desenvolvemos um protocolo melhorado baseado em um Two-Step aninhada multiplex PCR, o que resulta em um produto PCR que abrange regiões inteiras de variável de um humano TCR alfa e beta cadeias. Identificando locais da limitação original e incorporando-os aos primers PCR, fizemos o produto do PCR compatível com sub clonagem direto para o vetor retroviral do modelo. A construção resultante retroviral codifica um quimérico humano/mouse TCR com um domínio intracelular do mouse, que é funcional em células de rato ou em modelos de rato na vivo . No geral, o protocolo descrito aqui combina humana única célula emparelhada TCR alfa e beta cadeia identificação com geração simplificada de vetores retrovirais facilmente adaptávelas para expressão de TCR in vitro e in vivo . O vídeo e o material que acompanha são projetados para dar uma descrição minuciosa da única célula PCR, para que os passos críticos podem ser seguidas e potenciais armadilhas evitadas. Além disso, nós fornecemos uma descrição detalhada das etapas necessárias para gerar o vetor de expressão clonagem. Uma vez dominado, todo o processo de célula única classificação a expressão TCR poderia ser realizado em um curto período de duas semanas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O receptor de células T (TCR) dita decisão de destino T celular durante o desenvolvimento, estado estacionário/homeostase e estimulação antigênica na periferia1,2,3. Recente expansão de tecnologias de sequenciamento de profundidade descobriu uma diversidade TCR subvalorizada anteriormente dentro respostas de célula T específica do antígeno. Diversidade TCR sugere um potencial de respostas funcionalmente amplo de célula T. Para integrar a análise de repertório do TCR sequência com ensaios funcionais de TCR, as abordagens de sequenciamento devem ser projetadas para ser compatível com sistemas experimentais e na vivo modelos utilizados para posterior análise funcional de select TCRs. Desenvolvemos uma abordagem eficiente para o isolamento de sequência humana TCR e racionalizado sub clonagem em um vetor de modelo TCR quimérico humano/rato compatível com expressão de TCR em ratos HLA-humanizado4. Isolamento das correspondentes cadeias alfa e beta de heterodimérica TCRs requer amplificação por PCR de ambas as correntes de uma única célula. Apesar de vários protocolos TCR da célula única clonagem foram desenvolvidos e utilizados, nenhum até agora foram facilmente compatível com elevado-throughput simplificada clonagem direto do desconhecido Vα/Vβ TCRs em vetores retrovirais necessárias para re-expressão in vivo 4,5,6,7. Estudos anteriores já utilizaram duas abordagens principais, tanto para amplificar seletivamente uma parte limitada da TCR suficiente para extrapolar a sequência, ou amplificar a sequência TCR inteira4,5,6 , 7. análise funcional a jusante das sequências TCR, obtidos através da primeira abordagem requer dispendiosos em silico montagem e novo de construção da TCR. Enquanto a segunda abordagem fornece a sequência completa de TCR, região constante humana não é compatível com expressão na vivo das TCRs clonados em modelos do rato. Nossa abordagem é especificamente projetada para ser compatível na vivo análise funcional de TCRs em modelos do rato. Desenvolvemos uma única célula simplificada e eficiente protocolo PCR que permite o sub clonagem direto de fragmentos do PCR em vetor de expressão do modelo.

Nossa abordagem utiliza uma altamente sensível aninhada multiplex PCR reação é executada em duas etapas. Na primeira reação de multiplex passo uma de 40 primers específicos para todas as cadeias de V-beta e uma piscina de 44 primers específicos para todas as cadeias de V-Alfa são usadas para amplificar o TCR-alfa ou beta-TCR sem o conhecimento prévio da sequência (tabela 1). O primer para a frente tem uma sequência de adaptador, que é incorporada a 5' do produto do PCR. O primer reverso baseia-se na região constante da TCR. Nós identificamos sites única restrição que são ausentes de variável humana ou junção TCR regiões e incorporada no redesenhado TCRα e TCRβ primers (Figura 1). Na segunda reação aninhada, um primer específico para a sequência de adaptador e um primer reverso aninhado dentro da região constante são usados para amplificar ainda mais as cadeias TCR com maior especificidade (tabela 1, Figura 1). Após o isolamento de célula única, duas rodadas de PCR (reação de primeira com uma piscina de primers tanto Vα e Vβ e a segunda com primers adaptador) resultam em um produto PCR que pode diretamente ser sub clonado no vetor retroviral modelo. Construção de TCR final irá codificar, em uma moldura única leitura aberta (ORF), regiões variáveis humanas, combinadas com regiões de constante do mouse conectadas pela 'self chicotada' sequência de proteína, P2A (hVα-mCα-P2A-hVβ-mCβ)8. A sequência de P2A tem sido usada em vários sistemas e foi extensivamente testada especificamente para a expressão de TCRs8,9,10,11. Embora, após tradução, a maioria dos restos sequência P2A anexada ao C-terminal da cadeia alfa, conectado por um vinculador flexível, enquanto a sequência de sinal de cadeia beta tem uma prolina adicional, esta alteração não tem nenhum efeito prejudicial na função TCR. A região constante do mouse é usada na construção em vez de humanos para evitar potenciais interações alteradas com componentes de sinalização downstream quando re-expressa em células de rato. O único ORF irá resultar em estequiométrico expressão separada da de9,de cadeias alfa e beta11. O protocolo atual é baseado em reagentes e abordagens que estão amplamente disponíveis e é projetado para ser executada de maneira otimizada e eficiente. Embora especificamente usamos essa técnica para ensaiar TCRs de células T auto-reativas implicadas na diabetes auto-imune, prevemos que este protocolo pode ser amplamente aplicável para identificação e avaliação funcional de humanos TCRs específicos para epítopos auto-imunes, câncer epítopos ou respostas a patógenos e vacinas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identificar a população de células T de interesse.

Nota: antígeno específica proliferação em combinação com tintura de divisão celular (como Carboxyfluorescein succinimidil éster, CFSE) pode ser usada para isolar as células T com base na sua proliferação em resposta à estimulação antigênica. Se a partir de PBMC, uma expansão de 7 dias em vitro deve ser suficiente para identificar um antígeno específico CFSE baixa população 12.

  1. PBMCs mistura 1:1 com células MHC-combinados do alimentador e etiqueta com tintura de divisão celular 5 µM CFSE.
  2. Placa de 2 a 2,5 x 10 5 células por poço em um fundo redondo 96 poços cultura placa em 200 µ l 10% FCS completo RPMI mídia.
    Nota: RPMI completa contém 2 mM l-glutamina, piruvato de sódio 1 mM, 100 µM MEM não essenciais aminoácidos, 5 mM HEPES, 5.5 × 10 − 5 unidades de 2-Mercaptoetanol, 100 mL de U − 1 penicilina e 100 µ g mL − 1 estreptomicina.
  3. Estimulam as células com antigénios de peptídeo 25 µM.
  4. No quarto dia da cultura, com cuidado, remova e substitua a 100 µ l de mídia.
    Nota: Uma abordagem mais ideal para identificação de célula de T antígeno-específicas é o uso de peptídeo-HLA tetrâmeros 13. Tetrâmero coloração permite a avaliação simultânea de especificidade antigénica, bem como a restrição de HLA.

2. Configurar o tipo de célula única.

  1. Executar todos os procedimentos em uma capa ou uma área livre de modelo amplificado. Alíquota os reagentes para evitar contaminação, limpe todas as superfícies de trabalho e, se for possível, o equipamento com 10% bleach antes da instalação do PCR. Use dicas de filtro, reagentes livre de RNAse e DNAse e plásticos em todos o PCR e o vetor de clonagem passos. Principais reagentes podem ser encontrados na Tabela de materiais.
    Nota: A reação de PCR multiplex é altamente sensível, e baixos níveis de contaminação podem resultar em produto amplificado.
  2. Gerar o mix de transcrição reversa mestre combinando 10 x reação de RT do buffer, 25 X DNTPs, 9 enzima RT U, 0,01% Triton-X, inibidor de RNAse U 0,7 e 383 nM de cada primer RT-TCR (listado na tabela 1) em um reservatório de pipetagem estéril. Para cada placa de 96 poços, compõem suficiente mistura mestre para 10 reações adicionais (106 total), para compensar a perda de líquido durante a pipetagem. Consulte a tabela 2 para componentes de reação e montantes por bem.
  3. Placa de
  4. preparar uma coleção de PCR de 96 poços para célula Classificar por pipetagem µ l 6 da mistura mestre transcrição reversa por alvéolo com uma pipeta multicanal. Manter a placa no gelo ou em um bloco frio.
  5. Células com anticorpos de marcadores de superfície (tais como CD4 e CD3, ou CD8 e CD3, cada um em 2 µ g/mL, em combinação com tintura de divisão celular ou tetrâmero coloração) da pilha de rótulo.
  6. De células T do tipo em uma célula por alvéolo, ignorando a décima segunda fila, que servirá como um controle negativo.
    Nota: A eficiência da classificação dependerá alinhamento de placa precisos coleção dentro do suporte da placa, bem como a manutenção das células e placas em uma baixa temperatura antes da reação de cDNA. Placas de coleção devem ser mantidas no gelo em todos os momentos, exceto durante a classificação, quando eles são fixos dentro da placa de resfriamento. Nem todos os classificadores estão equipados com um suporte de placa regulamentado de temperatura; no entanto, é altamente recomendável o uso de um. Desde que o tipo geralmente leva cerca de 10-15 min por placa, há um aumento potencial de degradação de RNA se a placa não é mantida a uma temperatura baixa.
  7. Como um controle positivo, adicionar um maior número de células (100) manualmente com uma pipeta para um dos poços nesta fase. Alternativamente, anteriormente isolado RNA das células em pool pode ser usado como controle positivo em 10 ng por alvéolo.
    Nota: Pipetar controle purificado RNA com precisão e cuidado para evitar contaminação cruzada de outros poços e resultados falso-positivos.
  8. a placa com a película adesiva do selo e girar para baixo a 1000 x g por 5 min a 4 ° C.
  9. Imediatamente transcrever RNA de cDNA por incubar a placa a 25 ° C por 10 min, a 37 ° C por 45 min e 85 ° C por 10 min.
    Nota: Para garantir a reação de PCR eficiente, é recomendável que a primeira reação de PCR seja realizada no mesmo dia. Alternativamente, as placas transcritas podem ser mantidas em-80 ° C por até 2 meses.

3. Realizar o PCR multiplex aninhada

Nota: preparar todas as misturas de mestre numa área limpa livre de modelo para evitar contaminação.

Cartilha de
  1. reconstituir cada região variável de 100 µM com DNAse e RNAse livre H 2 O. Em seguida, combine 20 µ l de cada um dos 44 primers para gerar o pool de cartilha V-alfa. Para gerar o V-beta piscina cartilha combinar 20 µ l de cada um dos primers V-beta 40 e 80 µ l de DNAse e RNAse livre H 2 O. Primer sequências estão listadas na tabela 1. Uma vez reunidos, a concentração de cada primer na mistura é 2.3 µM.
  2. Reconstituir os primers região constante a solução estoque de 100 µM com DNAse e RNAse livre H 2 O. dilua os primers região constante 10 solução de trabalho µM e alíquota para uso.
  3. Preparar duas mixagens mestre separadas para amplificação de TCR-alfa e beta-TCR. Gerar as mixagens mestre combinando 5x buffer, pool de cartilha de 2 µM de dNTPs, 3% DMSO, 80 µM (concentração final de 46 nM para cada primeira demão), 200 nM TCR-constante região inversa da primeira demão, 1 U DNA-polimerase e DNAse e RNAse livre H 2 O (tabela 2 < / strong >). Para cada placa de 96 poços, compõem suficiente mistura mestre para 10 reações adicionais (total 106), a fim de compensar a perda de líquido durante a pipetagem.
    Nota: Os cálculos são baseados em volume final de 25 µ l por alvéolo, onde 22,5 mistura µ l de mestre-PCR é combinada com o modelo de cDNA 2,5 µ l PCR.
  4. Manter a placa com cDNA no gelo ou em um bloco frio. Use um multicanal para pipetar 22,5 µ l de reação de TCR-beta em uma nova placa PCR de 96 poços. Em seguida, use um multicanal para transferir 2,5 µ l de cDNA em placa de PCR.
  5. Usar um multicanal para pipetar 22,5 µ l de reação de TCR alfa diretamente para a placa contendo o restante do cDNA.
  6. Selar as placas com adesivo, delicadamente vórtice e rotação para baixo a 1000 x g por 5 min a 4 ° C.
  7. Executar a reação de PCR multiplex com os seguintes ciclos: 5 min a 95 ° C seguido de 34 ciclos de 20 s a 95 ° C, 30 s 54 ° c e a 1 minuto a 72 ° C, seguiram por 7 min em 72 ° C.
  8. Transportar para fora a reação de PCR aninhada em um volume final de 25 µ l, utilizando 2,5 µ l da mistura de PCR multiplex como modelo.
    1. Reconstituir os primers internos e adaptador de 100 µM com DNAse e RNAse livre H 2 O. fazer 10 µM alíquotas para as ações de trabalho.
    2. Preparar duas mixagens mestre separadas para TCR-alfa e beta-TCR amplificação. Mix 5 X tampão, 25 X DNTP, 3% DMSO, cartilha de adaptador frente 200 nM, 200 nM reversa aninhados primer, 1 U DNA polimerase e DNA polimerase e livre de nuclease H 2 O, para um volume final de 22,5 µ l (tabela 2). Para cada placa de 96 poços, compõem suficiente mistura mestre para 10 reações adicionais (106 total), para compensar a perda de líquido durante a pipetagem.
      Nota: Na segunda utilização do PCR reação a 5 X PCR de buffer contendo corante de carregamento para facilitar o carregamento do gel do agarose.
    3. Usando um multicanal, pipetar as mixagens mestre para as reações de TCR-alfa e beta-TCR em 22,5 µ l por alvéolo em duas novas placas PCR de 96 poços.
    4. Adicionar o modelo de reação de PCR multiplex em 2,5 µ l por alvéolo.
      Nota: A primeira reação de PCR restante deve ser selada e armazenada a-20 ° C, para servir como uma fonte de modelo adicional, se for necessário (ver passo Nota 4,3).
    5. Selar as placas, delicadamente vórtice e rotação para baixo a 1000 x g por 5 min em 4 ° C.
    6. Executar a reação de PCR aninhada com os seguintes ciclos: 5 min a 95 ° C seguido de 34 ciclos de 20 s a 95 ° C, 30 s a 56 ° C e 1 min a 72 ° C, seguiram por 7 min em 72 ° C.
    7. Executar 5 µ l da reação final para fora em uma agarose a 1% do gel contendo brometo de etídio (incluindo os poços de controle negativo e positivo).
      Nota: A banda esperada deve ser executado em cerca de 500 tamanho de bp. Uma reação de exemplo é mostrada na Figura 2.
    8. Purificar o restante da segunda reação (20 µ l) usando um formato kit de purificação de PCR de 96 poços, eluir com 15 µ l de 70 ° C H 2 O por alvéolo e executar Sanger sequenciamento. Use o apropriado TCR-alfa ou beta-TCR adaptador frente primer para sequenciamento (tabela 1).
      Nota: As sequências podem ser analisadas com software de Imunogenética disponível on-line.

4. Sub clonagem cadeias PCR alfa e beta.

Nota: A piscina de frente primers utilizados na primeira reação e os primers reversos na segunda reação PCR são usados para incorporar sítios de restrição. Portanto, os obtidos alfa e beta da cadeia os produtos de PCR estão prontos para ser sequencialmente sub clonado no vetor retroviral modelo ( Figura 1).

Produtos
  1. Digest o PCR purificado do beta aninhada reação com BstbI e MfeI (tabela 3).
    Nota: Não exceda 5 inserção µ g.
  2. Em paralelo, digerir o vetor modelo com BstbI e MfeI (tabela 3). Use 1-2 µ g do vetor modelo por TCR. Execute o vetor digerido em um gel de agarose e isolar a maior banda (~ 7500 bp). Purificar o vetor com um gel kit de purificação de DNA.
    Nota: Durante a síntese da enzima de restrição, a região variável modelo murino TCR-beta é removido, permitindo a adição da região variável humana de TCR-beta.
  3. Purificar os produtos PCR digeridos usando um kit de purificação de PCR.
    Nota: Verificar a capacidade de purificação de DNA das colunas incluídas no kit; Use várias colunas se necessário. A quantidade mínima de uma inserção purificada necessária para uma reação de sucesso da ligadura é 50 ng em uma concentração mínima de 10 ng / µ l. Se a quantidade de inserção purificado não é suficiente para uma bem sucedida da ligadura, a segunda reação de PCR pode ser repetida.
  4. Tratar o vetor modelo com 10 enzima U CIP para 1 h a 37 ° C para evitar Auto ligadura, seguida por inativação de calor durante 10 minutos a 75 ° C. Purify o DNA com um kit de purificação de PCR (tabela 3).
  5. Ligam TCR-beta inserir e vetoriais usando DNA ligase em um volume total de 20 µ l em 6 excesso molar da inserção por 30 min à temperatura ambiente.
    Nota: No total, a reação da ligadura deve conter cerca de 150 ng de DNA (tabela 3).
  6. Para transformações, misture 8 µ l de reação da ligadura com 80 µ l de células quimicamente competentes de Escherichia coli DH5α (Tabela de materiais) e incubar no gelo por 30 min. choque térmico a 42 ° C por 45 s. µ l adicionar 500 Super Caldo ideal com Catabolite supressão (S.O.C) médio e agitar durante 1,5 h a 37 ° C.
  7. Placa fora 250 µ l de cultura bacteriana em uma ampicilina contendo placa de ágar caldo lisogenia (LB). Incubar a placa durante a noite (~ 16 h) a 37 ° C.
  8. No dia seguinte escolha colônias bacterianas e eles cresce meio de 3 mL LB contendo ampicilina durante a noite. Isolar o DNA do plasmídeo usando o kit de purificação de plasmídeo de DNA.
  9. Confirmar a inserção bem sucedida da cadeia beta de um teste em pequena escala-digest com as enzimas de restrição, BstbI e MfeI. Em um volume de reação total 12 µ l, combine 200-500 µ g plasmídeo, 0,25 µ l de cada enzima e buffer de enzima 10 X (tabela 3). Executar a reação fora em um gel de agarose 1% contendo brometo de etídio para confirmar o tamanho da banda inserir (~ 500 bp).
  10. Depois de confirmar a presença da inserção, sequenciar a seção TCR-beta do vetor usando o primer reverso IRES (tabela 1).
  11. Após a confirmação da sequência da inserção da TCR-beta, realizar um processo semelhante para a inserção da região variável alfa. Digerir os produtos PCR purificados da reação aninhada alfa e a inserção de TCR-beta recentemente gerada contendo o vetor, com SnaBI e SacII.
    Nota: Durante a síntese da enzima de restrição, a região variável modelo murino TCR-alfa é removido, permitindo a adição da região variável de TCR-alfa humana.
  12. Alfa
  13. ligam insere-se em vetores TCR codificação correspondente região variável beta usando o ligase do DNA em um volume total de 20 µ l em 6 excesso molar da inserção por 30 min à temperatura ambiente.
    Nota: No total, a reação da ligadura deve conter cerca de 150 ng de DNA (tabela 3).
  14. Para transformações, misture 8 µ l de reação da ligadura com 80 µ l de células quimicamente competentes de Escherichia coli DH5α (Tabela de materiais) e incubar no gelo por 30 min. choque térmico a 42 ° C por 45 s. adicionar 500 µ l S.O.C médio e agitar durante 1,5 h a 37 ° C.
  15. Placa fora 250 µ l de cultura bacteriana em uma ampicilina contendo placa de ágar caldo lisogenia (LB). Incubar a placa durante a noite (~ 16 h) a 37 ° C.
  16. No dia seguinte escolha colônias bacterianas e eles cresce meio de 3 mL LB contendo ampicilina durante a noite. Isolar o DNA do plasmídeo usando o kit de purificação de plasmídeo de DNA.
  17. Confirmar a inserção bem sucedida da cadeia alfa de um teste em pequena escala-digest com as enzimas de restrição, SnaBI e SacII. Em um volume de reação total 12 µ l combine 200-500 µ g plasmídeo, 0,25 µ l de cada enzima e buffer de enzima 10 x (tabela 3). Executar a reação fora em um gel de agarose 1% contendo brometo de etídio para confirmar o tamanho da banda inserir (~ 500 bp).
  18. Depois de confirmar a presença da inserção, sequenciar a seção TCR-alfa do vetor usando o primer MSCV2-para diante (tabela 1).
  19. Uma vez que a sequência de cadeia alfa é validada, verificar a completa inserção TCR de sequenciação com IRES-ré e TCR-beta-reverso primer (tabela 1).

5. Verifique se a expressão de superfície celular TCR e especificidade.

Nota: HEK293T células são usadas para testar o sucesso TCR cadeia pariNG e célula de superfície de expressão ( Figura 3A) 8. Peptídeo-MHC tetrâmero coloração também pode ser realizada em células transfectadas HEK293T para testar para retenção de isolamento ( Figura 3B) gene TCR do post especificidade antigênica.

  1. Placa HEK293T células em placas de cultura de tecidos de 12-poços em 1 x 10 5 células por poço em 1ml completa DMEM mídia contendo 5% FCS e cultura durante a noite a 37 ° C. Plate fora células suficientes para designou poços separados para cada nova TCR , controle modelo TCR vetor, CD3 vetor somente, controle vetorial TCR única e uma não-transfectadas bem.
    Nota: Transfection com um totalmente rato modelo TCR vector (mTCR-pMIA) em combinação com mCD3εγδζ-pMIG vector, vector mTCR-pMIA sozinho, e mCD3εγδζ-pMIG vector sozinho são usados como controles positivos e negativos.
    Nota: DMEM completa contém 2 mM 1 mM piruvato de sódio, L-glutamina, 100 µM não essenciais aminoácidos, 5 mM HEPES buffer, 5,5 x 10 -5 unidades de 2-Mercaptoetanol, 100 U/ml penicilina/estreptomicina.
  2. No dia seguinte, transfect as células com um reagente de transfeccao baseada em lipossomas, seguindo as instruções do fabricante, 1 vetor de CD3εγδζ-pMSCVII-GFP (pMIG) de rato µ g e 1 µ g quimérico h/mTCR-pMIA vetor.
  3. Para cada TCR, adicionar o reagente de transfeccao 6 µ l para 100 µ l da temperatura ambiente, DMEM isento de soro. Brevemente o vórtice e incubar a temperatura ambiente por 15 min.
  4. Em separado 1,5 mL tubos combinam 1 µ g de TCR-pMIA vector com 1 µ g do mouse CD3εγδζ-pMSCVII-GFP (pMIG) vetor, ou 1 µ g de cada vetor separado para controles.
  5. Dropwise, adicionar a solução DMEM/reagente de Transfeccao para os tubos contendo o DNA do vetor. Incubar a temperatura ambiente por 15 min.
  6. Dropwise, adicionar a solução de DNA/DMEM/reagente de Transfeccao para as células HEK293T. Bata levemente a placa para misturar. Incubar a 37 ° C por 24 h.
  7. Após 24 h substituir os meios de comunicação e manter as células em cultura para adicionais 24 h.
  8. Remover células da placa pipetando vigoroso e mancha as células com anticorpos de anti-rato CD3 (2,5 µ g/mL) para verificar a expressão de superfície de quimérico-TCR por citometria de fluxo.
  9. a fim de comparar a expressão CD3 entre células que foram transfectadas para um nível semelhante, portão a análise de células expressando um alto nível similar de moléculas de repórter fluorescente (GFP para complexo CD3 e Ametrine para vetor de expressão de TCR). Idealmente, a análise deve ser fechada na GFP + Ametrine + células dentro de 10 4 10 5 fluorescente intensidade ( Figura 3A).
    Nota: O nível de expressão CD3 em células transfectadas com o constructo quimérico deve ser comparável do vetor de rato (modelo original) de controle ( Figura 3A). Vetores retrovirais TCR gerados são compatíveis com sistemas de expressão em vivo como descrito anteriormente 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A eficiência da reação de PCR multiplex aninhada é verificada na etapa 3.2.7 (Figura 2), a esgotar-se 5µL da segunda reação em um gel de agarose. Em média, a eficiência de amplificação de TCR-beta é esperada em cerca de 80%, enquanto a eficiência da reação de TCR-alfa é geralmente baixa, em torno de 50%4. Só emparelhadas cadeias TCR-alfa e beta-TCR podem ser usadas para a expressão de TCR; no entanto, todos os produtos PCR podem ser sequenciados para obter informações de repertório e sequência TCR.

Silenciamento do gene só permitirá uma única cadeia TCR-beta ser expresso em uma determinada célula T. No entanto, uma célula T é capaz de reorganizar uma segunda cadeia TCR-α, e cerca de 25% de células T vai expressar um segundo em-frame TCR-alfa da cadeia de 14. Espera-se que alguma proporção das cadeias TCR alfa isoladas será o alfa secundário em vez da cadeia alfa "correto". A cadeia alfa secundária, muitas vezes não é um parceiro ideal de vinculação com a cadeia TCR-beta; Consequentemente, espera-se que nem todos os TCRs clonados formarão um estábulo complexo e expresso na superfície celular. Portanto, a adequada TCR cadeia emparelhamento e célula superfície expressão tem de ser confirmada pelo transfecting HEK293T células (Figura 3A).

Figure 1
Figura 1 . Simplificada de PCR multiplex aninhada e construção retroviral desenvolvimento de células T únicas. Duas rodadas de PCR resultam em amplificação de cadeias de alfa e beta TCR correspondentes. Sites de restrição incorporados os primers permitem sub clonagem simplificada e geração de vetor quimérico humano/rato para expressão em células de rato. O vetor de rato do modelo pode ser usado para alternar facilmente entre regiões de variável de rato para humano, gerando um rato/humano quimérico TCR vetor retroviral compatível com expressão em células de rato. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 . Exemplo de uma única célula PCR. Multiplex amplificação por PCR aninhada de célula T do receptor alfa e beta cadeias de simples células T humanas, classificadas em uma placa de 96 poços. São mostrados correspondentes produtos PCR (superior e inferior) de uma única célula amplificada beta TCR e cadeias alfa TCR da humana PBMCs. NC - nenhum controle modelo, PC - controle positivo. Executando uma pequena porção da reação em um gel de agarose (5 µ l), confirma-se a eficiência das única célula alfa e beta do PCR reacções em cadeia antes do produto PCR, sequenciamento. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 . Verificação de célula de superfície quimérico expressão TCR e especificidade. (A) HEK293T célula foram transfectadas com mouse TCR ou um humano/mouse quimérico TCR em combinação com mouse CD3εγδζ. Células superficiais TCR expressão foi medido com anticorpo anti-mCD3ε. Retenção de estratégia: primeiro, a análise é fechada em células positivas duplas Ametrine e GFP (G2). No caso de controles único vector o gating tem de basear-se o única fluorescência (G1). Em segundo lugar, as células de G1 e G2 são analisadas para o nível de expressão CD3ε. (B) TCR especificidade é confirmada pela tetrâmero de coloração de células 293T com DRB1 * 0401:GAD115-127 tetrâmero. Análise é fechado na GFP + Ametrine + CD3ε + células, como mostrado em (A). Clique aqui para ver uma versão maior desta figura.

GENE ALVO CARTILHA DE ORIENTAÇÃO SEQUÊNCIA DE
Transcrição reversa
CDNA TRAC AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
Reação de PCR TCR alfa 1
TRAV1-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Para a frente CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC externo Inverter CAGACAGACTTGTCACTGGATTTAGAGTCTC Reação de PCR TCRbeta 1 TRBV2 Para a frente CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Para a frente CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Para a frente CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Para a frente CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Para a frente CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Para a frente CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Para a frente CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Para a frente CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Para a frente CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Para a frente CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Para a frente CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Para a frente CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Para a frente CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC externo Inverter GTGGCCAGGCACACCAGTGTG Reação de PCR TCR alfa 2 TRAC interno Inverter CAGCTGGTACAccgcggGGTCAGGGTTCTG Adaptador TRAV Para a frente CGGTTCAGCAGGAATGCCtacgtaATG Beta TCR reação PCR 2 TRBC interno Inverter CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG Adaptador TRBV Para a frente CAGAAGACGGCATACGAGATcaattgATG Iniciadores de sequenciamento pMSCV-II Para a frente CCTCCTCTTCCTCCATCCGCC TCRbeta Inverter GCCAAGCACACGAGGGTAGCC IRES Inverter AACGCACACCGGCCTTATTCC * Letras minúsculas letras dentro as sequências de cartilha indicam que a enzima de restrição incorporada cortar sites

Tabela 1: Reverter a transcrição, PCR e sequenciamento primers.

Etapa 2.2 montantes por bem
Reação de RT-PCR (6μL) (ΜL)
buffer de x 10 0.6
2 x dNTP 0,24
10% Triton X 0,06
3 primeiras demão TCR-específicas (ea de 10mM). 0,23 ea. (x 3 = 0,69)
Enzima 0.18
Inibidor de RNase 0.28
NF(nuclease-Free)-H2O 3,95
Passo 3.1
uma reação de PCR 1 (25μL) (ΜL) b reação de PCR 1 (25μL) (ΜL)
buffer de 5 x 5 buffer de 5 x 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0.75 DMSO (3%) 0.75
uma piscina (cartilha de F) (2.3μM) 0.3 piscina b (cartilha de F) (2.3μM) 0,5
uma cartilha de R externa (10uM) 0.6 cartilha de R b externa (10μM) 1
DNA polimerase 0.2 Ir a Taq polimerase 0.2
CDNA de RT-PCR 2.5 CDNA de RT-PCR 2.5
NF-H2O 14.65 NF-H2O 14,05
Passo 3.8
Reação de PCR 2 - mesmo para um e b (25μL) (ΜL)
buffer de 5 x 5
dNTP (10mM) 1
DMSO 0.75
Cartilha de adaptador F (10μM) 1
Cartilha de R interna (10μM) 1
DNA polimerase 0.2
Produto PCR rxn 1 2.5
NF-H2O 13.55

Tabela 2. A transcrição reversa e reações de PCR.

Passos, 4.2 e 4.3
Reação de síntese TRBV (50μL) (ΜL) Resumo de vetor mTCR-pMIA (500μL) (ΜL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Buffer 5 10 x Buffer 50
H2O H2O
Passo 4.4
Reação de CIP (100 μL) (ΜL) DNA(~1.5mg)
> Digerido & purificado vector DNA 84 10 x Buffer 10 Enzima CIP 6 Passo 4.5 Reação de ligadura (20μL) (ΜL) Digerido/CIPed vector DNA (quantidade total de inserção e o vetor é ~ 150ng) Inserir DNA (6 molar acesso ao vetor) 2 x buffer de Ligase 10 Enzima ligase 1 H2O Passo 4.9 Testar a reação de Digest (12μL) (ΜL) DNA (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x Buffer 1.2 H2O 9.3 Passo 4.11 Reação de digerir TRAV (60μL) (ΜL) Contendo beta - digest de vetor mTCR-pMIA (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x Buffer 6 10 x Buffer 10 H2O H2O

Tabela 3. Vetor de clonagem reações.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O protocolo atual, descrevemos um método eficiente para amplificação de TCR unicelulares e subsequente sub clonagem de cadeias de alfa e beta TCR emparelhadas em um vetor retroviral expressão do modelo. Embora, desenvolveram-se vários protocolos PCR de célula única, nenhum até agora têm sido compatíveis com imediata sub clonagem em um vetor de expressão. Na maioria dos casos, uma sequência parcial, englobando as regiões CDR3 altamente variáveis é amplificada, com suficiente sequência de extrapolar a região variável. Este menor tamanho do produto do PCR suporta maior eficiência de PCR, mas exige a síntese de gene TCR de novo para estudos funcionais. O protocolo atual mantém a eficiência dos protocolos de sequenciamento de TCR publicados anteriormente CDR3-focado única célula, enquanto ao mesmo tempo produzindo um amplicon mais longa que contém a região toda variável apropriada para clonagem. Portanto, o sistema descrito tem uma maior flexibilidade em dar uma sequência quantitativa, bem como a saída funcional.

Dependendo da questão científica dirigida, a fonte e a especificidade das células T analisados podem variar. No entanto, se o objetivo final do projeto é a análise da função TCR na vivo , é necessário conhecer a restrição HLA de células isoladas de T. O protocolo atual tem sido especificamente projetado para ser compatível com expressão na vivo de TCR em camundongos HLA-humanizado. Muitos destes ratos foram gerados e agora estão disponíveis comercialmente, incluindo HLA-2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 e HLA - B * 0702 variedades transgênicas. Este protocolo pode ser combinado com êxito com o protocolo publicado anteriormente para expressão de células-tronco retroviral mediada da medula óssea de humanos TCRs4,15,16. Esperamos que o sistema de retrogenic TCR humanizado será aplicável e altamente útil para análise funcional de TCRs humanas em vários auto-imunes, câncer e modelos infecciosos.

A única célula atual protocolo PCR descreve os passos críticos e dá sugestões necessárias para amplificação bem-sucedida de TCR-alfa emparelhado e sequências de TCR-beta. O primeiro passo crítico é uma apresentação oportuna da transcrição do cDNA e subsequente primeira rodada de PCR multiplex. Todas as etapas envolvidas devem ser realizadas em tempo hábil, e todos os reagentes e células mantiveram no gelo para evitar a degradação do RNA e do cDNA. Em segundo lugar, porque o protocolo é projetado para ser altamente sensíveis a baixos níveis do modelo, é altamente suscetível à contaminação. Consequentemente, é imperativo para trabalhar em uma área livre de modelo, longe de produtos da PCR amplificados ou TCR vetor de clonagem. Uma sala separada ou capa deve ser usada para configurar o cDNA e reações de PCR. Modelo da primeira reação de PCR deve ser adicionado em uma área diferente de onde a PCR está configurado. É aconselhável que um conjunto separado de reagentes aliquotados ser utilizados para os experimentos PCR de célula única.

Este protocolo foi especificamente otimizado usando os reagentes listados na Tabela de materiaise quaisquer substituições em reagentes exigirá otimização adicional. A identificação inicial de células antígeno-específicas pode ser modificada para usar tetrâmeros de peptídeo-MHC. Tetrâmero coloração permite a avaliação simultânea de especificidade antigénica, bem como a restrição de HLA. Métodos alternativos para a detecção de reatividade de antígeno, tais como a regulação alta de marcadores de ativação precoce ou secreção de citocinas inflamatórias podem ser considerados na ausência de reagentes tetrâmero. Por exemplo, os anticorpos de fusão dupla especificidade específicos para um antígeno de células T e relato podem ser combinados com isolamento magnético do grânulo para enriquecer para células de relato produzindo reativas do antígeno.

Enquanto a construção de rato/humano quimérico descrita em nosso protocolo garante compatibilidade com pilhas do rato, o nível da sua compatibilidade com o complexo humano CD3 é desconhecido. Embora não formalmente testada por nós, outros têm mostrado que quimérico TCR construções com regiões de constantes murino podem ser expressa na superfície de linfócitos humanos17. Isto indica que murino regiões constantes de TCR podem oferecer suporte a interação com o humano CD3 sinalização complexo. No entanto, se o objetivo é expressar as TCRs identificados em células primárias humanas ou linhas de células humanas, tais como células Jurkat, uma abordagem mais ideal pode ser usar uma construção totalmente humana. Isso pode ser feito, trocando as regiões constantes murino dentro do vetor com regiões de constantes humanas.

Se uma região variável identificada de TCR contém um dos sites de restrição utilizados para clonagem, TCR deve ser inserido em um vetor de transporte e posteriormente transformado usando um kit de mutagênese sítio dirigido para induzir uma mudança silenciosa nucleótidos dentro a restrição corte o local. Uma abordagem alternativa é a síntese de novo da região variável TCR de interesse modificado para excluir o site restrição indesejados.

A principal limitação dessa técnica é a incapacidade de eliminar a amplificação de cadeias Alfa 'citoplasmáticas' secundárias. TCR-alfa genes não passam alélica exclusão como genes TCR-beta, assim, que uma proporção significativa de células T expressará um secundário de cadeia alfa 'citoplasmática'14. O protocolo PCR descrito só resulta em amplificação de uma cadeia TCR alfa, mas se a cadeia alfa amplificada é a cadeia alfa 'citoplasmática' que não pode emparelhar com a cadeia beta amplificado. Consequentemente, é imperativo teste TCR célula superfície expressão nas células HEK293T para garantir sucesso cadeia de emparelhamento.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este estudo foi financiado pelo 1-FAC-2014-243-A-N JDRF, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 piloto PJ e o Robert e Janice McNair Foundation.

Agradecemos a Sandra Pena e Andrene McDonald para o recrutamento de paciente, Samuel Blum para assistência técnica, Dr. George Makedonas pelo dom de controle usado para otimização de PCR de DNA e anticorpos.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Aerodinâmico única célula TCR isolamento e geração de vetores retrovirais para <em>In Vitro </em>e <em>In Vivo</em> de expressão de TCRs humanas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter