Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Strömlinjeformad enda Cell TCR isolering och generering av retrovirala vektorer för In Vitro och In Vivo uttryck för mänskliga TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

De nuvarande protokollet kombinerar enda cell ihop mänskliga TCR alfa och beta kedja sekvensering med strömlinjeformad generation av retrovirala vektorer kompatibel med in vitro- och in-vivo TCR uttryck.

Abstract

Även om flera metoder för sekvensering av Parade T-cell receptor (TCR) alfa och beta kedjor från enstaka T celler har utvecklats, har ingen hittills varit bidrar till nedströms i vivo funktionell analys av TCR heterodimerer. Vi har utvecklat ett förbättrat protokoll baserat på en två-stegs multiplex-kapslad PCR, vilket resulterar i en PCR produkt som sträcker sig över hela variabla regioner av en mänsklig TCR alfa och beta kedjor. Genom att identifiera unika begränsning platser och införliva dem i PCR primers, har vi gjort PCR-produkten kompatibel med direkt sub kloning i den mallen retrovirala vektorn. Den resulterande retrovirala bygga kodar en chimär mänskliga/mus TCR med en mus intracellulära domän, som är funktionella i mus celler eller i vivo musmodeller. Sammantaget kombinerar i protokollet som beskrivs här människors enda cell ihopkopplade TCR alfa och beta kedja identifiering med strömlinjeformad generation retrovirala vektorer lätt anpassningsbar för in vitro- och in-vivo TCR uttryck. Videon och det åtföljande materialet är utformade för att ge en mycket detaljerad beskrivning av den enda cellen PCR, så att de kritiska steg kan följas och potentiella fallgropar undvikas. Dessutom ger vi en detaljerad beskrivning av kloning stegen som krävs för att generera uttryck vektorn. När behärskar, kunde hela förfarandet från enda cell sortering till TCR uttryck utföras i en kort två-veckors period.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

T-cell receptorn (TCR) dikterar T cells öde beslut under utveckling, steady-state/homeostas och antigen stimulering i periferin1,2,3. Senaste utbyggnaden av djupa sekvensering teknik har avslöjat en tidigare underskattad TCR mångfald inom antigen specifika T-cell svar. TCR mångfald tyder på en potential för funktionellt breda T-cell svar. För att integrera TCR sekvens repertoar analysen med TCR funktionella analyser, bör sekvensering metoder utformas för att vara kompatibel med experimentella system och i vivo modeller utnyttjas för efterföljande funktionell analys av Välj TCRs. Vi har utvecklat en effektiv strategi för mänskliga TCR sekvens isolering och strömlinjeformad sub kloning i en chimär mänskliga/mus TCR mall vektor kompatibel med TCR uttryck i HLA-humaniserad möss4. Isolering av motsvarande alfa och beta kedjor av heterodimeriskt TCRs kräver PCR-amplifiering av båda kedjor från en enda cell. Även om flera encelliga TCR kloning protokoll har utvecklats och utnyttjas, har ingen hittills varit enkelt kompatibelt med hög genomströmning strömlinjeformad direkt kloning av okänd Vα/Vβ TCRs in retrovirala vektorer nödvändigt för nytt uttryck i vivo 4,5,6,7. Tidigare studier har använt två huvudinriktningar, antingen att selektivt förstärka en begränsad del av TCR tillräckligt att extrapolera sekvensen eller att förstärka hela TCR sekvens4,5,6 , 7. nedströms funktionell analys av TCR sekvenser erhålls via det första synsättet kräver kostsamma i silico församlingen och de novo byggandet av TCR. Medan det andra synsättet ger komplett TCR sekvensen, är mänsklig konstant regionen inte kompatibel med i vivo uttryck för de klonade TCRs i musmodeller. Vårt förhållningssätt är särskilt utformade för att vara kompatibel med i vivo funktionell analys av TCRs i musmodeller. Vi utvecklat en effektiv och strömlinjeformad enda cell PCR-protokoll som möjliggör direkt sub kloning av PCR-fragmenten i mallen uttryck vektorn.

Vår strategi använder tredjeparts en mycket känslig multiplex-kapslad PCR-reaktion som utförs i två steg. I den första multiplex reaktionen kliver en pool av 40 primers specifika för alla V-beta kedjor och en pool av 44 primers specifika för alla V-alpha kedjorna används för att förstärka den TCR-alpha eller TCR-beta utan kunskapen om sekvensen (tabell 1). Framåt primern har en adapter sekvens, som är införlivad i 5' av PCR-produkten. Reverse primer är baserad på den konstant regionen av TCR. Vi har identifierat unik begränsning webbplatser som är frånvarande från mänskliga variabel eller korsningen TCR regioner, och införlivat dessa i nydesignade TCRα och TCRβ primers (figur 1). I den andra kapslade reaktionen används en primer som är specifik för den adapter sekvensen och kapslade reverse primer inom regionen konstant att ytterligare förstärka TCR kedjorna med ökad specificitet (tabell 1, figur 1). Efter enstaka cell isolering, två rundor av PCR (första reaktion med en pool av både Vα och Vβ primers, dels med adapter grundfärger) resultera i en PCR produkt som kan klonas direkt sub in mallen retrovirala vektorn. Den slutliga TCR-konstruktionen kommer att koda, i en enda öppen behandling ram (ORF), mänskliga variabla regioner kombinerat med musen konstanta regioner ansluten av en 'själv proteinspjälkande' proteinsekvens, P2A (hVα-mCα-P2A-hVβ-mCβ)8. P2A sekvensen har använts i flera system och har testats specifikt för uttrycket av TCRs8,9,10,11. Även om, efter översättning som de flesta av P2A sekvens förblir kopplad till C-terminus av alfakedjan ansluten av en flexibel länkare, medan beta kedja signal sekvensen har en ytterligare prolin, denna ändring har ingen negativ effekt på TCR funktion. Mus konstant regionen används i konstruktionen istället för mänskliga för att undvika potentiella förändrad interaktioner med nedströms signalering komponenter när re uttryckt i mus celler. Den enda ORF leder stökiometriska separat uttryck för alpha och beta kedjor9,11. Det nuvarande protokollet baseras på reagenser och metoder som är allmänt tillgängliga och är avsedd att utföras på ett rationellt och effektivt sätt. Även om vi har specifikt används denna teknik till assay TCRs från självreaktiva T-celler inblandade i autoimmun diabetes, räknar vi med att detta protokoll kan vara allmänt tillämpliga för identifiering och funktionell bedömning av mänskliga TCRs specifika för autoimmuna epitoper, cancer epitoper eller Svaren till patogener och vacciner.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identifiera T cell befolkningen sevärdheter.

Obs: Antigen specifika spridning i kombination med celldelning färgämne (som Carboxyfluorescein succinimidyl ester, CFSE) kan användas för att isolera T celler baserat på deras spridning som svar på antigen stimulering. Om start från PBMC, en 7-dagars i vitro expansion bör vara tillräcklig för att identifiera en antigen specifika CFSE låg 12.

  1. Mix PBMC 1:1 med MHC-matchade feeder celler och etikett med 5 µM CFSE celldelning färgämne.
  2. Tallrik 2-2,5 x 10 5 celler per brunn i en 96-väl runda-botten kultur plattan i 200 µL 10% FCS komplett RPMI media.
    Obs: Komplett RPMI innehåller 2 mM l-glutamin, 1 mM natrium pyruvat, 100 µM MEM onödiga aminosyror, 5 mM HEPES, 5,5 × 10 − 5 enheter av 2-merkaptoetanol, 100 U mL − 1 penicillin och 100 µg mL − 1 streptomycin.
  3. Stimulera celler med 25 µM peptid antigen.
  4. På den fjärde dagen av kultur, noggrant ta bort och ersätta 100 µL av media.
    Obs: En mer optimal strategi för antigen-specifika T-cell identifiering är användningen av peptid-HLA tetramers 13. Tetramer färgning möjliggör samtidig bedömning av antigen specificitet, liksom HLA-begränsning.

2. Ställa in enstaka cell sortera.

  1. Utför alla procedurer i en huva eller ett visst område gratis förstärkta mall. Alikvotens reagenserna att undvika kontaminering, rengör alla arbetsytor och, om möjligt, utrustning med 10% blekmedel före PCR-installation. Använd filter tips, RNAse och DNAS gratis reagenser och plast i alla PCR och vektor kloning steg. Viktiga reagenser kan hittas i Tabellen för material.
    Obs: Multiplex PCR-reaktionen är mycket känsliga, och låga halter av föroreningar kan leda till förstärkt produkt.
  2. Generera omvänd Transkription huvudmixen genom att kombinera 10 x RT reaktion buffert, 25 X dNTP, 9 U RT enzym, 0,01% Triton-X, 0.7 U RNAse inhibitor, och 383 nM för varje RT-TCR primer (anges i tabell 1) i en steril pipettering reservoar. För varje plattan med 96 brunnar, göra upp tillräckligt master mix för 10 ytterligare reaktioner (totalt 106), att kompensera för förlusten av vätska under pipettering. Se tabell 2 för reaktion komponenter och belopp per brunn.
  3. Förbered en samling med 96 brunnar i PCR-plattan för cell sortering av pipettering 6 µL av omvänd Transkription huvudmixen per brunn med en flerkanalspipett. Hålla plattan på isen eller i en kall block.
  4. Etikett celler med antikroppar mot cell yta markörer (t.ex CD4 och CD3, eller CD8 och CD3, vart på 2 µg/mL, i kombination med celldelning färgämne eller tetramer färgning).
  5. Sortera T-celler i en cell per brunn, hoppa över den tolfte raden, som kommer att fungera som en negativ kontroll.
    Obs: Sortera effektivitet beror på exakt samling plattan justering inom innehavaren plattan, samt att upprätthålla celler och plattorna vid en låg temperatur före cDNA reaktion. Samlingsplattor bör hållas på isen hela tiden, utom under sortering, när de är fasta inom kyla plattan. Inte alla sorterare är utrustade med en temperatur reglerade plattan hållare; dock rekommenderas användning av en. Eftersom sortera tar i allmänhet ca 10-15 min per platta, finns det en ökad potential för RNA nedbrytning om plattan inte upprätthålls på en låg temperatur.
  6. Som positiv kontroll, lägga till ett större antal (100 celler) manuellt med en pipett till en av brunnarna i detta skede. Alternativt, tidigare isolerade RNA från poolade celler kan användas som en positiv kontroll 10 ng per brunn.
    Obs: Pipettera renat kontroll RNA med precision och omsorg för att undvika korskontaminering av andra brunnar och falskt positiva resultat.
  7. Tätning plattan med självhäftande film, och snurra ner vid 1000 x g i 5 min vid 4 ° C.
  8. Omedelbart transkribera RNA till cDNA med ruvning plattan vid 25 ° C i 10 min, 37 ° C i 45 min, och 85 ° C i 10 min.
    Obs: För att säkerställa effektiv PCR-reaktionen, det rekommenderas att den första PCR-reaktionen utförs samma dag. Alternativt, transkriberas plattorna kan hållas i-80 ° C i upp till 2 månader.

3. Utföra multiplex-kapslad PCR

Obs: förbereda alla master mixar i en ren mall-fritt område att undvika kontaminering.

  1. Rekonstituera varje variabel region primer till 100 µM med DNAS och RNAse gratis H 2 O. Nästa, kombinera 20 µL av varje 44 primers att generera V-alpha primer poolen. För att generera den V-betan kombinera primer pool 20 µL av varje 40 V-beta primers plus 80 µL av DNAS och RNAse gratis H 2 O. Primer sekvenser är listade i tabell 1. När poolade, koncentrationen av varje primer i mixen är 2,3 µM.
  2. RNAse gratis H 2 O. Dilute konstant region primers till 10 µM fungerande lösning och alikvot för användning och rekonstruera konstant region primers till 100 µM stamlösningen med DNAS.
  3. Förbereda två separata master mixar för TCR-alpha och TCR-beta förstärkning. Generera master mixar genom att kombinera 5 X buffert, 80 µM dNTP, 3% DMSO, 2 µM grundfärg pool (slutlig koncentration på 46 nM för varje grundfärg), 200 nM TCR-konstant region reverse primer, 1 U DNA-polymeras och DNAS och RNAse gratis H 2 O (tabell 2 < / starka >). För varje plattan med 96 brunnar, göra upp tillräckligt master mix för 10 ytterligare reaktioner (totalt 106), för att kompensera för förlusten av vätska under pipettering.
    Anmärkning: Beräkningarna är baserade på PCR slutvolymen av 25 µL per brunn, där 22,5 µL master PCR-mix kombineras med 2,5 µL cDNA mall.
  4. Hålla plattan med cDNA på isen eller i en kall block. Använd en flerkanals för att Pipettera 22,5 µL av TCR-beta reaktion till en ny PCR-plattan med 96 brunnar. Använd sedan en flerkanals överföra 2,5 µL av cDNA i PCR-plattan.
  5. Använda en flerkanals för att Pipettera 22,5 µL av TCR-alpha reaktion direkt i plattan som innehåller återstoden av cDNA.
  6. Tätning plattorna med lim, försiktigt vortex och spinn ner vid 1000 x g i 5 min vid 4 ° C.
  7. Kör multiplex PCR-reaktionen med följande cykler: 5 min vid 95 ° C följt av 34 cykler av 20 s vid 95 ° C, 30 s vid 54 ° C och 1 min vid 72 ° C, följt av 7 min vid 72 ° C.
  8. Bär ut nästlade PCR-reaktionen i en slutlig volym av 25 µL, använder 2,5 µL av multiplex PCR blandningen som mall.
    1. Beredes interna och adapter primers till 100 µM med DNAS och RNAse gratis H 2 O. göra 10 µM alikvoter för arbetande beståndet.
    2. Förbereda två separata master mixar för TCR-alpha och TCR-beta amplification. Blanda 5 X buffert, 25 X DNTP, 3% DMSO, 200 nM framåt adapter primer, 200 nM omvänd kapslade primer, 1 U DNA-polymeras, och DNA-polymeras och nuclease-fri H 2 O för en slutlig volym av 22,5 µL (tabell 2). För varje plattan med 96 brunnar, göra upp tillräckligt master mix för 10 ytterligare reaktioner (totalt 106), att kompensera för förlusten av vätska under pipettering.
      Obs: I det andra PCR-reaktion användandet 5 X PCR buffert innehållande lastning färgämnet att underlätta agarosgel lastning.
    3. Använder en multichannel, Pipettera master mixar för TCR-alpha och TCR-beta reaktioner på 22,5 µL per brunn in två nya 96 brunnar PCR-plattor.
    4. Lägga till mallen multiplex PCR-reaktion på 2,5 µL per brunn.
      Obs: Den återstående första PCR-reaktionen bör förseglas och förvaras vid-20 ° C att fungera som en källa till ytterligare mall, om det blir nödvändigt (se steg 4,3 Obs).
    5. Försegling på tallrikar, försiktigt vortex och spinn ner vid 1000 x g i 5 min vid 4 ° C.
    6. Kör nästlade PCR-reaktionen med följande cykler: 5 min vid 95 ° C följt av 34 cykler av 20 s vid 95 ° C, 30 s vid 56 ° C, och 1 min vid 72 ° C, följt av 7 min vid 72 ° C.
    7. Kör 5 µL av den sista reaktionen ut på en 1% agaros gel innehållande etidiumbromid (inklusive de negativa och positiva kontrollbrunnarna).
      Obs: Beräknade bandet bör köra på runt 500 bp storlek. En exempel reaktion visas i figur 2.
    8. Rena återstoden av andra reaktionen (20 µL) med ett 96 brunnar format PCR rening kit, eluera med 15 µL av 70 ° C H 2 O per brunn och utföra Sanger sekvensering. Använda lämpliga TCR-alpha eller TCR-beta adapter framåt primer för sekvensering (tabell 1).
      Obs: Sekvenser kan analyseras med online tillgängliga immunogenetik programvara.

4. Sub kloning alfa och beta PCR-kedjor.

Obs: poolen framåt primers utnyttjas i den första reaktionen, och omvänd primers i andra PCR-reaktionen används för att införliva begränsning platser. Därför erhålls alfa och beta kedja PCR-produkterna är redo att vara sekventiellt sub klonade in mallen retrovirala vektorn ( figur 1).

  1. Digest renat PCR produkter från beta kapslade reaktion med BstbI och MfeI (tabell 3).
    Obs: Inte överstiger 5 µg infoga.
  2. Parallellt, smälta mall vektorn med BstbI och MfeI (tabell 3). Använd 1-2 µg mall vektorns per TCR. Kör smält vektorn på en agarosgel och isolera större bandet (~ 7500 bp). Rena vektorn med en gel DNA rening kit.
    Obs: Under restriktionsenzym digest, mall murina TCR-beta variabla regionen avlägsnas, vilket möjliggör tillägg av regionen som mänskliga TCR-beta rörlig.
  3. Rena smält PCR-produkterna med hjälp av en PCR-rening kit.
    Obs: Kontrollera DNA reningskapacitet de kolumner som ingår i kit; Använd flera kolumner vid behov. Minimibeloppet för en renat Infoga som är nödvändiga för en framgångsrik ligering reaktion är 50 ng med en lägsta koncentration på 10 ng/µL. Om mängden renat Infoga inte är tillräckligt för en framgångsrik ligatur, andra PCR-reaktionen kan upprepas.
  4. Behandla mall vektorn med 10 U CIP enzym för 1 h vid 37 ° C att förhindra egen ligatur, följt av Värmeinaktivering för 10 min vid 75 ° C. rena DNA med en PCR-rening kit (tabell 3).
  5. Ligate TCR-beta sätt och vektor med DNA-ligase i en 20 µL total volym på 6 molar överskott av skäret för 30 min i rumstemperatur.
    Obs: Totalt, ligatur reaktionen bör innehålla ca 150 ng DNA (tabell 3).
  6. För transformationer, blanda 8 µL av ligering reaktionen med 80 µL av kemiskt behöriga E.coli DH5α celler (Tabell av material) och inkubera på is för 30 min. värme chock vid 42 ° C i 45 s. Tillsätt 500 µL Super Optimal buljong med Catabolite dämpning (S.O.C.) medium och skaka i 1,5 h på 37 ° C.
  7. Platta ut 250 µL av bakterieodling på en ampicillin innehållande Lysogeny buljong (LB) agarplatta. Inkubera plattan över natten (~ 16 h) vid 37 ° C.
  8. Nästa dag plocka bakteriekolonier och odla dem i 3 mL LB medium innehållande ampicillin över natten. Isolera plasmid DNA med DNA plasmid rening kit.
  9. Bekräfta framgångsrika införandet av beta kedjan genom en småskalig test-digest med begränsning enzymerna BstbI och MfeI. I en 12 µL totala reaktionsvolym, kombinera 200-500 µg plasmid DNA, 0,25 µL av varje enzym och 10 X enzym buffert (tabell 3). Springa reaktionen ut på en 1% agarosgel innehållande etidiumbromid för att bekräfta storleken på Infoga bandet (~ 500 bp).
  10. Efter bekräftar förekomsten av skäret, sekvens avsnittet TCR-beta av den vektor som använder IRES reverse primer (tabell 1).
  11. Följande sekvens bekräftelse av TCR-beta skäret, utför en liknande process för införande av alfa variabla regionen. Smälta renat PCR produkter från alpha kapslade reaktionen, och nyligen genererade TCR-beta skäret som innehåller vektor, med SnaBI och SacII.
    Obs: Under restriktionsenzym digest, mall murina TCR-alpha variabla regionen avlägsnas, vilket möjliggör tillägg av mänskliga TCR-alpha variabla regionen.
  12. Ligate alpha infogas med TCR vektorer kodning motsvarande beta variabla regionen med hjälp av DNA-ligase i en 20 µL total volym på 6 molar överskott av skäret i 30 min i rumstemperatur.
    Obs: Totalt, ligatur reaktionen bör innehålla ca 150 ng DNA (tabell 3).
  13. För transformationer, blanda 8 µL av ligering reaktionen med 80 µL av kemiskt behöriga E.coli DH5α celler (Tabell av material) och inkubera på is för 30 min. värme chock vid 42 ° C i 45 s. Tillsätt 500 µL S.O.C. medium och skaka i 1,5 h på 37 ° C.
  14. Platta ut 250 µL av bakterieodling på en ampicillin innehållande Lysogeny buljong (LB) agarplatta. Inkubera plattan över natten (~ 16 h) vid 37 ° C.
  15. Nästa dag plocka bakteriekolonier och odla dem i 3 mL LB medium innehållande ampicillin över natten. Isolera plasmid DNA med DNA plasmid rening kit.
  16. Bekräfta framgångsrika införandet av alfakedjan av en småskalig test-digest med begränsning enzymerna SnaBI och SacII. I en 12 totala µL reaktionsvolym kombinera 200-500 µg plasmid DNA, 0,25 µL av varje enzym och 10 x enzym buffert (tabell 3). Springa reaktionen ut på en 1% agarosgel innehållande etidiumbromid för att bekräfta storleken på Infoga bandet (~ 500 bp).
  17. Efter bekräftar förekomsten av skäret, sekvens avsnittet TCR-alpha i vektorn med MSCV2-forward primer (tabell 1).
  18. När sekvensen alfa-kedja har verifierats, verifiera komplett TCR skäret genom sekvensering med TCR-beta-reverse och IRES-reverse primer (tabell 1).

5. Kontrollera TCR cell surface uttryck och specificitet.

Obs: HEK293T celler används för att testa framgångsrika TCR kedja paring och cellen ytbehandlar uttryck ( figur 3A) 8. Peptid-MHC tetramer färgning kan även utföras på HEK293T transfekterade cellerna att testa för lagring av antigen specificitet post TCR gen isolering ( figur 3B).

  1. Plattan ut HEK293T celler i 12-väl vävnadsodling pläterar på 1 x 10 5 celler per brunn i 1 mL komplett DMEM media som innehåller 5% FCS och kultur över natten vid 37 ° C. plattan ut tillräckligt med celler att ha designerat separata brunnar för varje ny TCR , kontroll mallen TCR vektor, CD3 vektor endast styra TCR vektor endast, och en icke-transfekterade bra.
    Obs: Transfection med en fullt mus mall TCR vektor (ordningarnas-pMIA) i kombination med mCD3εγδζ-pMIG vektor, ordningarnas-pMIA vector ensam, och mCD3εγδζ-pMIG vector enbart används som positiva och negativa kontroller.
    Obs: Komplett DMEM innehåller 2 mM L-glutamin, 1 mM natrium pyruvat, 100 µM icke-essentiella aminosyror, 5 mM HEPES buffert, 5,5 x 10 -5 enheter av 2-merkaptoetanol, 100 U/ml Penicillin/Streptomycin.
  2. Följande dag, transfect cellerna med 1 µg chimära h/ordningarnas-pMIA vector, 1 µg mus CD3εγδζ-pMSCVII-GFP (pMIG) vektor och en Liposom-baserade transfection reagens efter tillverkarens anvisningar.
  3. För varje TCR, lägga till 6 µL transfection reagens i 100 µL rumstemperatur, serumfritt DMEM. Kort vortex, och inkubera i rumstemperatur i 15 min.
  4. i separata 1,5 mL rör kombinera 1 µg av TCR-pMIA vektor med 1 µg mus CD3εγδζ-pMSCVII-GFP (pMIG) vektor eller 1 µg av varje vektor separat för kontroller.
  5. Dropwise, lägga till transfection reagens/DMEM lösningen till rören som innehåller vektorn DNA. Odla i rumstemperatur i 15 min.
  6. Dropwise, lägga till transfection reagens/DMEM/DNA lösningen i de HEK293T cellerna. Knacka försiktigt på plattan att blanda. Inkubera vid 37 ° C under 24 h.
  7. Efter 24 h ersätta media, och hålla celler i kultur för ytterligare 24 h.
  8. Ta bort celler från plattan genom kraftig pipettering och färga cellerna med antimus CD3 antikropp (2,5 µg/mL) att verifiera ytan uttryck för chimära-TCR genom flödescytometri.
  9. För att jämföra CD3 uttryck mellan celler som var transfekterade till en liknande nivå, gate analysen på celler som uttrycker en liknande hög fluorescerande reporter molekyler (GFP för CD3 komplexa och Ametrine för TCR uttryck vektor). Optimalt, analysen bör vara gated om GFP + Ametrine + celler inom 10 4 10 5 fluorescerande intensiteten ( figur 3A).
    Obs: Nivån på CD3 uttryck i celler transfekterade med den chimära konstruktionen bör vara jämförbar kontroll mus (ursprungliga mallen) vektorn ( figur 3A). De genererade TCR retrovirala vektorerna är kompatibla med i vivo uttryck system som tidigare beskrivits 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Effektiviteten i multiplex-kapslad PCR-reaktionen är incheckat steg 3.2.7 (figur 2) genom att köra ut 5 µl av den andra reaktionen på en agarosgel. I genomsnitt effektiviteten av TCR-beta förstärkning förväntas vara cirka 80%, medan effektiviteten av TCR-alpha reaktionen är oftast lägre, runt 50%4. Endast Parade TCR-alpha och TCR-beta kedjor kan användas för TCR uttryck; alla PCR-produkter kunde dock sekvenseras för att få TCR sekvens och repertoar information.

Nedtystning tillåter endast en enda TCR-beta kedja skall uttryckas i en given T-cell. Dock en T cell klarar av att ordna en andra TCR-alpha-kedja, och cirka 25% av T-celler kommer att uttrycka ett andra i-frame TCR-alpha kedja 14. Det förväntas att vissa andelen isolerade TCR-alpha kedjorna blir sekundära alfa istället för den ”rätta” alfa-kedjan. Sekundära alfakedjan är ofta inte en optimal bindande partner med TCR-beta kedjan; Följaktligen förväntas att inte alla klonade TCRs kommer att bilda en stabil komplexa och express på cellytan. Ordentlig TCR kedja ihopparning och cell surface uttrycket har därför bekräftas av transfecting HEK293T celler (figur 3A).

Figure 1
Figur 1 . Strömlinjeformad multiplex-kapslad PCR och retrovirala konstruera utveckling från enkel T-celler. Två rundor av PCR resultera i förstärkning av motsvarande TCR alfa och beta kedjor. Begränsning webbplatser inbäddade i primers kan strömlinjeformad sub kloning och generering av mänskliga/mus chimära vektor för uttryck i mus celler. Mall mus vektorn kan användas för att enkelt byta ut rörliga musen regioner för mänskliga, genererar en chimär mänskliga/mus TCR retrovirala vektor kompatibel med uttryck i mus celler. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 . Exempel på enstaka cell PCR. Multiplex nästlade PCR-amplifiering av T-cell receptor beta och alfa kedjor från enda mänskliga T celler sorterade i ena plattan med 96 brunnar. Visas är motsvarande (topp och botten) PCR produkter från enda cell förstärks TCR beta och TCR alfa kedjor från mänskliga PBMC. NC - ingen mall kontroll, PC - positiv kontroll. Genom att köra en liten del av reaktionen på en agarosgel (5 µL), bekräftas effektiviteten i enskild cell alfa och beta PCR kedjereaktioner innan PCR-produkten sekvensering. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 . Verifiering av cell surface chimära TCR uttryck och specificitet. (A) HEK293T cell var transfekterade med mus TCR eller en mänskliga/mus chimära TCR i kombination med musen CD3εγδζ. Celler ytan TCR uttryck mättes med anti-mCD3ε antikroppar. Gating strategi: för det första analysen är gated på Ametrine och god Jordbrukarsed dubbel positiva celler (G2). När det gäller enda vektor kontroller har den gating ska baseras på den enda fluorescensen (G1). Det andra analyseras cellerna från G1 och G2 för nivån på CD3ε uttryck. (B), TCR specificitet bekräftas av tetramer färgning av 293T celler med DRB1 * 0401:GAD115-127 tetramer. Analys är gated om GFP + Ametrine + CD3ε + celler, som visas i (A). Klicka här för att se en större version av denna siffra.

MÅLGENEN PRIMER ORIENTERING SEKVENS
Omvänd Transkription
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR alfa PCR-reaktionen 1
TRAV1-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Framåt CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Framåt CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Framåt CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Framåt CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Framåt CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Framåt CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Framåt CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC externa Omvänd CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR reaktionen 1 TRBV2 Framåt CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Framåt CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Framåt CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Framåt CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Framåt CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Framåt CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Framåt CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Framåt CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Framåt CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Framåt CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Framåt CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Framåt CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Framåt CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Framåt CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Framåt CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Framåt CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Framåt CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Framåt CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Framåt CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Framåt CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Framåt CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Framåt CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Framåt CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Framåt CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Framåt CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Framåt CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC externa Omvänd GTGGCCAGGCACACCAGTGTG TCR alfa PCR-reaktion 2 TRAC inre Omvänd CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV-adapter Framåt CGGTTCAGCAGGAATGCCtacgtaATG TCR beta PCR-reaktion 2 TRBC inre Omvänd CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adapter Framåt CAGAAGACGGCATACGAGATcaattgATG Sekvensering grundfärger pMSCV-II Framåt CCTCCTCTTCCTCCATCCGCC TCRbeta Omvänd GCCAAGCACACGAGGGTAGCC IRES Omvänd AACGCACACCGGCCTTATTCC * Gemener inom primer sekvenser visar den införlivad restriktionsenzym skär platser

Tabell 1: Omvänd Transkription, PCR och sekvensering primers.

Steg 2.2 belopp per brunn
RT-PCR-reaktion (6μL) (ΜL)
10 x buffert 0,6
2 x dNTP 0,24
10% Triton X 0,06
3 TCR-specifika primers (10mM ea.) 0,23 ea. (x 3 = 0,69)
Enzymet 0,18
RNase inhibitor 0,28
NF(Nuclease-Free)-H2O 3,95
Steg 3.1
en PCR-reaktion 1 (25μL) (ΜL) b PCR-reaktionen 1 (25μL) (ΜL)
5 x buffert 5 5 x buffert 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3%) 0,75
en pool (F primer) (2.3μM) 0,3 b pool (F primer) (2.3μM) 0,5
en extern R primer (10uM) 0,6 b externa R primer (10μM) 1
DNA-polymeras 0,2 Gå Taq polymeras 0,2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14,65 NF-H2O 14,05
Steg 3,8
PCR-reaktionen 2 - samma för en och b (25μL) (ΜL)
5 x buffert 5
dNTP (10mM) 1
DMSO 0,75
Adapter F primer (10μM) 1
Interna R primer (10μM) 1
DNA-polymeras 0,2
PCR-rxn 1 produkt 2.5
NF-H2O 13,55

Tabell 2. Omvänd Transkription och PCR-reaktioner.

Steg 4.2 och 4.3
TRBV digest reaktion (50μL) (ΜL) ordningarnas-pMIA vector digest (500μL) (ΜL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x buffert 5 10 x buffert 50
H2O H2O
Steg 4,4
CIP reaktion (100μL) (ΜL) DNA(~1.5mg)
> Rötas & renas vektor-DNA 84 10 x buffert 10 CIP enzym 6 Steg 4,5 Ligatur reaktion (20μL) (ΜL) Smält/CIPed vector DNA (Infoga och vektor totalbeloppet är ~ 150ng) Infoga DNA (6 molar tillgång till vektor) 2 x Ligase buffert 10 Ligase enzym 1 H2O Steg 4,9 Testa Digest reaktion (12μL) (ΜL) DNA (100-300ng) 1 MfeI 0,25 BstbI 0,25 10 x buffert 1.2 H2O 9,3 Steg 4.11 TRAV digest reaktion (60μL) (ΜL) Beta som innehåller - ordningarnas-pMIA vector digest (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x buffert 6 10 x buffert 10 H2O H2O

Tabell 3. Vector kloning reaktioner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I det nuvarande protokollet beskriver vi en effektiv metod för enstaka cell TCR amplifiering och efterföljande sub kloning av Parade TCR alfa och beta kedjor i en mall retrovirala uttryck vektor. Även om flera enstaka cell PCR-protokoll har utvecklats, ha ingen hittills varit förenligt med omedelbar sub kloning i ett uttryck vektor. I de flesta fall förstärks delsekvens omfattar de mycket varierande CDR3 regionerna, med tillräckligt sekvens att extrapolera variabla regionen. Denna mindre PCR-Produktstorlek stöder högre PCR effektivitet, men kräver de novo TCR gen syntes för funktionella studier. Det nuvarande protokollet upprätthåller effektiviteten i tidigare publicerade CDR3-fokuserad enda cell TCR sekvensering protokoll, samtidigt som den ger en längre amplikon som innehåller hela variabla regionen lämplig för kloning. Det beskrivna systemet har därför en ökad flexibilitet i att ge en kvantitativ sekvens, samt funktionella utdata.

Källan och specificitet av T-celler som analyseras kan variera beroende på den vetenskapliga frågan tas upp. Om det slutliga målet för projektet är analysen av funktionen i vivo TCR, är det dock nödvändigt att veta HLA begränsning av isolerade T-celler. Det nuvarande protokollet har utformats särskilt för att vara kompatibel med i vivo TCR uttryck i HLA-humaniserad möss. Många av dessa möss har genererats och finns nu kommersiellt tillgängliga, inklusive HLA-A2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 och HLA - B * 0702 transgena stammar. Detta protokoll kan framgångsrikt kombineras med tidigare publicerade protokollet retrovirala medierad benmärg stamceller uttryck för mänskliga TCRs4,15,16. Vi förväntar oss att humaniserad TCR retrogenic systemet kommer att vara tillämplig och mycket användbart för funktionell analys av mänskliga TCRs i olika autoimmuna, cancer och infektionssjukdomar modeller.

Den nuvarande enda cellen PCR-protokoll beskriver de kritiska steg och ger förslag som krävs för framgångsrika förstärkning av Parade TCR-alpha och TCR-beta sekvenser. Ett första viktigt steg är en läglig prestanda av cDNA transkription och efterföljande första omgången av multiplex PCR. Alla de inblandade steg bör utföras i tid, och alla reagenser och celler förvaras på is för att förhindra RNA och cDNA nedbrytning. För det andra, eftersom protokollet är avsedd att vara mycket känslig för låga nivåer av mallen, det är mycket mottagliga för smitta. Därför är det absolut nödvändigt att arbeta i ett mall-fritt område, borta från amplifierade PCR-produkter eller TCR vektor kloning. Ett separat rum eller huva bör användas för att ställa in cDNA och PCR-reaktioner. Mall från den första PCR-reaktionen bör läggas i ett annat område från där PCR ställs in. Det är tillrådligt att en separat uppsättning aliquoted reagens användas för enstaka cell PCR-experiment.

Detta protokoll har optimerats speciellt med reagens som anges i Tabell av material, och alla substitutioner i reagens kommer att kräva ytterligare optimering. Inledande identifiering av antigen-specifika celler kan ändras för att använda peptid-MHC tetramers. Tetramer färgning möjliggör samtidig bedömning av antigen specificitet, liksom HLA-begränsning. Alternativa metoder för detektion av antigen reaktivitet, såsom uppreglering av tidig aktivering markörer eller utsöndringen av inflammatoriska cytokiner kan anses vara i avsaknad av tetramer reagenser. Dubbla specificitet fusion antikroppar specifika för en T-cells antigen och IFNγ kan exempelvis kombineras med magnetiska pärla isolering att berika för antigen reaktiva IFNγ producerar celler.

Medan chimära mänskliga/mus bygga beskrivs i vårt protokoll garanterar kompatibilitet med musen celler, är nivån på dess förenlighet med humant CD3 komplexa okänd. Även om inte formellt testats av oss, har andra visat att chimära TCR konstruktioner med murin konstanta regioner kan uttryckas på ytan av humana lymfocyter17. Detta indikerar att murina TCR konstanta regioner kan stödja interaktion med den mänskliga CD3 signalering komplexa. Men om målet är att uttrycka de identifierade TCRs i människans primära celler eller mänskliga cellinjer, såsom Jurkat celler, kan en mer optimal strategi vara att använda en fullt ut mänsklig konstruktion. Detta kan åstadkommas genom att byta murina konstant regionerna inom vektorn med mänsklig konstant regioner.

Om en identifierad TCR variabel region innehåller en av de begränsning webbplatser som används för kloning, TCR skall införas i en shuttle vektor och därefter muterade använder en webbplats riktad mutagenes kit för att inducera en tyst nukleotid förändring inom begränsningen skär webbplats. En alternativ metod är de novo syntes av TCR variabla regionen av intresse som modifierats för att utesluta oönskade inskränkning webbplatsen.

Den största begränsningen av denna teknik är en oförmåga att eliminera amplifiering av sekundära 'cytoplasmiska' alfa kedjor. TCR-alpha gener går inte igenom alleliska utslagning som TCR-beta gener, således en betydande andel av T-celler kommer att uttrycka en sekundär 'cytoplasmiska' alfa-kedja14. Protokollet beskrivs PCR resulterar endast i amplifiering av en TCR alfa-kedja, men om förstärkt alfakedjan är 'cytoplasmiska' alfakedjan det inte kan parkoppla med förstärkta beta kedjan. Därför är det absolut nödvändigt att testa TCR cell surface uttryck i HEK293T celler att säkerställa framgångsrika kedjan ihopkoppling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Denna studie har finansierats av JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 PILOT PJ, och The Robert och Janice McNair Foundation.

Vi tackar Sandra Pena och Andrene McDonald för patient rekrytering, Samuel Blum för tekniskt bistånd, Dr. George Makedonas för gåvan av antikroppar och kontroll DNA som används för PCR-optimering.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Strömlinjeformad enda Cell TCR isolering och generering av retrovirala vektorer för <em>In Vitro </em>och <em>In Vivo</em> uttryck för mänskliga TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter