Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Zuivering van hoog molecuulgewicht Genomic DNA van echte meeldauw voor Long-Read Sequencing

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

De echte meeldauw schimmels zijn een groep van economisch belangrijke schimmelplantenpathogenen. Er is relatief weinig bekend over de moleculaire biologie en de genetica van deze ziekteverwekkers, voor een deel te wijten aan een gebrek aan goed ontwikkelde genetische en genomische hulpbronnen. Deze organismen hebben grote, herhalende genomen, die genoom en assemblage onbetaalbaar moeilijk hebben gemaakt. We beschrijven hier werkwijzen voor het verzamelen, extraheren, zuivering en kwaliteitscontrole evaluatie van hoogmoleculair genomisch DNA molecuul van een echte meeldauw soorten, Golovinomyces cichoracearum. De beschreven protocol bevat mechanisch afbreken van sporen, gevolgd door een geoptimaliseerde fenol / chloroform genomisch DNA extractie. Een typische opbrengst was 7 ug DNA per 150 mg conidia. Het genomische DNA dat geïsoleerd is middels deze werkwijze zijn geschikt voor het lezen sequencing (bijv:> 48,5 kbp). Kwaliteitscontrolemaatregelen de grootte, opbrengst en zuiverheid van het genomische DNA waarborgen ookbeschreven in deze werkwijze. Sequentiebepaling van het genomische DNA van de hier beschreven kwaliteit zal zorgen voor de montage en vergelijking van meerdere meeldauw genomen, wat op zijn beurt zal leiden tot een beter begrip en een betere controle van de agrarische ziekteverwekker.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Poedermeeldauw een groep obligate biotrofe schimmelplantenpathogenen die, wanneer samengenomen, zijn de belangrijkste oorzaak van plantenziekten wereldwijd 1. Er zijn meer dan 900 beschreven soorten van echte meeldauw, die taxonomisch zijn gegroepeerd in vijf stammen binnen de familie Erisyphaceae 2. Als gevolg van zowel het economisch belang en de intieme relatie die zij ontwikkelen met hun gastheren, hebben echte meeldauw ziektes onderwerp van onderzoek voor> 100 jaar. Na infectie, echte meeldauw ontlokken drastische veranderingen in de celstructuur, het metabolisme en moleculaire biologie van hun gastheren, om deze ziekteverwekker ten goede komen. Echter, de studie van echte meeldauw is een bijzondere uitdaging als gevolg van hun obligate lifestyle, en de groei van de schimmel in zuivere cultuur is nog niet beschreven 3, 4, 5,"xref"> 6, 7, 8. Betrouwbare, stabiele genetische transformatie van poederige meeldauw is ook nog niet voltooid hoewel transiënte transformatie gemeld bij sommige soorten 9, 10.

De sequentiebepaling en assemblage van meeldauw genomen is moeilijk gebleken vanwege een aantal kenmerken van het genoom zelf. Echte meeldauw genomen zijn groot (120-180 Mbp) ten opzichte van andere schimmels genomen, en bestaan uit 60-90% gelijkmatig repetitieve elementen 11. Deze elementen omvatten niet-lange terminale herhalingen, alsook uncategorized repetitieve elementen. Twee formae speciales van een echte meeldauw soorten, Blumeria graminis f. sp. hordei en f. sp. tritici (BGH en Bgt respectievelijk) alsmede de druif echte meeldauw Erysiphe necator, LEVn gesequenced en voorstellen genomen voor verscheidene andere zijn afgerond 12, 13, 14. Het repetitieve aard van de genomen samenstel heeft bemoeilijkt en de voltooide BGH genoom geassembleerd tot 6989 supercontigs een L50 2 Mb 12.

Ondanks de grote genoom, het poedervormige meeldauw blijken een klein aantal eiwitten coderende genen, met 5.845 en 6.540 genen voorspeld BGH en Bgt resp. De sequentie poederige meeldauw blijken ook ten minste 99 kern genen die essentieel andere schimmels, die in overeenstemming met de afhankelijkheid van de schimmels op de waardplant te overleven 11, 12, 13, 14 ontbreekt.

Repetitieve sequenties nabij telomeren, centromeren, ribosomaal RNEen gen arrays en gebieden verrijkt transponeerbare elementen zijn slecht samengesteld uit korte gelezen sequencing strategieën en vaak ondervertegenwoordigd in genoom samenstellen 15. Dergelijke gebieden worden verondersteld verantwoordelijk voor veel van de spleten die zich in genoomsequenties zijn, en dit geldt voor het poedervormige meeldauw hun omvangrijke uitbreiding van repetitieve elementen 16. Sterk plastic genoomgebieden worden vaak in dergelijke herhalende gebieden 3. Ze dienen als een plaats van chromosoomherschikkingen vaak coderen voor genen onder sterk selectieve druk, zoals de genen die coderen effector eiwitten en de genen die coderen voor enzymen van secundair metabolisme. Vooruitgang in single-molecule lange lezen sequencing technologieën een mogelijke oplossing voor het rangschikken in herhaalde gebieden van genomen 15. B.v. Faino et al. (2015) gevonden dat het opnemen van de lange sequentie gelezen technologieën en optische mapping konden ze een gat-loze genoomsequentie te produceren voor twee stammen van de schimmel plantenpathogeen Verticillium dahlia, verdrievoudigde het percentage herhalende DNA sequenties in het genoom, waardoor het aantal gen annotaties (en vermindering van het aantal partiële of ontbrekende gen annotaties ) en onthullende genoomomleggingen 17.

Om deze lange-lezen sequencing technologie, hoge concentraties van hoge kwaliteit genoom DNA, in dienst nemen met minimale afmetingen> 20 kbp, nodig zijn. Hier beschrijven we onze methoden voor conidial collectie, zuivering van hoog moleculair gewicht DNA van conidia en onze kwaliteitscontrole assessments met behulp van de echte meeldauw soorten Golovinomyces cichoracearum geteeld op komkommer 18. Dit protocol is gebaseerd op een protocol ontwikkeld in het laboratorium groep B. Keller (Universiteit van Zürich, Zürich Switzerland) 13, 19en bevat diverse modificaties die leidden tot verhoogde DNA opbrengsten en een groter deel van DNA> 48,5 kbp in grootte. Het protocol bevat ook kwaliteitscontrole stappen basis van aanbevelingen van het Amerikaanse ministerie van Energie Joint Genome Institute 20, 21, 22.

De functie van elk reagens in de lysisbuffer, en de reden voor elke zuiveringsstap, worden beschreven in Henry (2008) 23. Beschikbare gepubliceerde protocollen voor isolatie van hoogmoleculair genomisch DNA van planten en micro weefsels werden geraadpleegd bij het ontwerpen van dit protocol 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Bereiding van schimmelmateriaal

  1. Het kweken van echte meeldauw
    1. Planten groeien in groeikamers de volgende omstandigheden: 22 ° C dagtemperatuur 20 ° C nachttemperatuur, 80% relatieve vochtigheid, 14-h daglengte en een lichtintensiteit van 125 uE / m 2 / s (geleverd door fluorescentielampen ).
    2. Infect komkommerplanten (Cucumis sativa variëteit Bush Champion) met Golovinomyces cichoracearum stam UCSC1 beschreven 18, 29.
  2. Oogsten echte meeldauw Conidia
    1. Oogst conidia uit geïnfecteerde planten op 7-10 dagen na inoculatie met een kleine vacuüm met een in-lijn filter (11 pm) waarop de conidia ophopen. Licht aandrukt, voert het vacuüm mondstuk langs het oppervlak van het blad aan de conidia verzamelen.
      OPMERKING: De gemiddelde opbrengst van G. cichoracearum 20 mg conidia van een zwaar InfeCTED komkommerblad van circa 130 cm2 in oppervlak.
    2. Borstel ongeveer 150 mg van de conidiën (ongeveer 375 pl volume of conidia 7-8 geïnfecteerde komkommerbladeren) van het filter op een vel schoon papier. Vanaf hier overbrengen conidia in 2 ml cryovials met twee 5/32 inch diameter vooraf gekoelde (in vloeibare stikstof) stalen maalkogels. Onmiddellijk buizen terug naar vloeibare stikstof. WINKEL buisjes bij -80 ° C.
  3. Breaking Open Conidia door Ball Frezen
    1. Flash-bevriezen aluminiumplaten van kogelmolen in vloeibare stikstof. Load cryovials in kogelmolenstof rack. Schud de cryoflesjes met conidia en stalen ballen in de kogelmolen gedurende 30 seconden bij 30 cycli / s (bij kamertemperatuur). Onmiddellijk cryovials opnieuw invriezen in vloeibare stikstof.
      OPMERKING: Aanvankelijk toegang tot een deel van conidia met microscopie bij 100X vergroting voor efficiëntie van de celwand breuk tijdens het slijpen. Indien nodig, slijpen voor een extra 1 - 2 rondes van 30 en 30 cycli / s, but houden het aantal ronden tot een minimum. Routine beoordeling van conidiale breuk met behulp van microscopie in dit stadium niet nodig is zodra optimale omstandigheden zijn vastgesteld.

2. Genomic DNA Purification

  1. conidia Lysis
    1. Werken snel ontdooien conidia voorkomen, verwijder de stalen kogels van cryovials met een magneet. Voeg 700 ul 65 ° C lysisbuffer (tabel 1) en vortex 5-10 s tot een slurry gevormd.
    2. Voeg 300 ul voorverwarmde (65 ° C) 5% (v / v) sarcosyl en voorzichtig omkeren te mengen (1 inversie per 3S) vijfmaal. Incubeer buizen gedurende 30 minuten bij 65 ° C; keren voorzichtig 3 keer met 10, 20 en 30 minuten. Met behulp van een brede boring pipetpunt, dragen volledige oplossing op nieuwe 2 ml microcentrifugebuis. In alle volgende stappen meng door voorzichtig en langzaam omkeren en het DNA-bevattende oplossingen over te dragen met brede boring pipetpunten.
  2. DNA Extraction I
    1. Voeg 1 volume van chloorvorm: isoamylalcohol (24: / v 1 v) om de lyse-oplossing en voorzichtig omkeren vijfmaal mengen. Incubeer gedurende 10 minuten bij kamertemperatuur voorzichtig inverteren tot vijf keer mengen tegen halverwege en opnieuw aan het einde van de incubatie. Centrifugeer bij kamertemperatuur gedurende 15 minuten bij 14.000 x g. Gebruik brede boring pipetpunt voorzichtig Breng de waterige nieuwe 2 ml microcentrifugebuis; voorkomen waaronder materiaal uit de interface.
  3. DNA Neerslag I
    1. Voeg 1 volume kamertemperatuur 100% isopropanol (bij benadering 750 pi) en voorzichtig omkeren zes keer mengen. Centrifugeer bij kamertemperatuur gedurende 15 minuten bij 14.000 x g. Verwijder voorzichtig het supernatant af en gooi.
    2. Voeg 450 ul voorgekoelde (-20 ° C) 70% ethanol. Centrifugeer gedurende 5 minuten bij kamertemperatuur bij 14.000 x g. Verwijder voorzichtig het supernatant af en gooi. Centrifugeer bij 1000 xg gedurende 3 seconden, verwijder het supernatant met fijne pipetpunt en weggooien. Lucht-droog de pellet gedurende 15 min eent kamertemperatuur. Drogen niet langer dan 15 min.
    3. Resuspendeer de pellet in 300 ui TE (10 mM Tris-Cl, 1 mM ethyleendiaminetetra-azijnzuur, pH 8,0). Incubeer overnacht bij 4 ° C. Veeg voorzichtig om het resterende materiaal dat niet in oplossing gingen mengen.
  4. RNA verontreinigingen te verwijderen, wordt 10 ul RNase A (10 mg / ml). Voorzichtig omkeren tot drie keer mengen. Centrifugeer bij 1000 xg gedurende 3 seconden. Incubeer bij 37 ° C gedurende 2 uur.
  5. II DNA Extraction
    1. Voeg 300 ul fenol: chloroform: isoamylalcohol (25: 24: 1 v / v) en voorzichtig omkeren vijfmaal mengen. Incubeer 10 minuten bij kamertemperatuur voorzichtig inverteren tot vijf keer mengen tegen halverwege en opnieuw aan het einde van de incubatieperiode. Centrifugeer 15 minuten bij kamertemperatuur bij 14.000 x g. Met behulp van een brede boring pipetpunt, breng de supernatant nieuwe microcentrifugebuis van 1,5 ml.
  6. DNA Neerslag II
    1. Voeg 0,01 volume 3 M natriumacetaat pH 5,2 (approximately3 pl) voorzichtig omkeren vijfmaal mengen. Voeg 2,5 volumes voorgekoelde (-20 ° C) 100% ethanol (ongeveer 750 ui). Voorzichtig omkeren tot vijf keer te mengen. Incubeer overnacht bij -20 ° C
    2. Centrifugeer 30 minuten bij 4 ° C bij 14.000 x g. Verwijder voorzichtig het supernatant af en gooi.
    3. Voeg 450 ul voorgekoelde (-20 ° C) 70% ethanol. Centrifugeer gedurende 5 minuten bij 4 ° C bij 14.000 x g. Verwijder voorzichtig het supernatant af en gooi. Centrifugeer bij 1000 xg gedurende 3 seconden. Verwijder voorzichtig het supernatant met fijne pipet tip en gooi.
    4. Lucht-droog de pellet gedurende 30-60 minuten bij kamertemperatuur. Resuspendeer de pellet in 27,5 ul TE. Incubeer overnacht bij 4 ° C. Veeg voorzichtig om het resterende materiaal dat niet in oplossing gingen mengen.
    5. Aliquot 2,5 ul in 22,5 pl TE (eindvolume 25 pl) voor kwaliteitscontroles (zie hieronder). WINKEL DNA monsters bij 4 ° C tot indiening van sequencing. Voor langdurige opslag, opslag samplesbij -80 ° C en het minimaliseren van vries-dooi cycli te scheren voorkomen.
      LET OP: Wees voorzichtig bij het pipetteren bij deze stap als het hoge gewicht genomische DNA molecuul kan moeilijk zijn om goed te pipet, en het is belangrijk om ervoor te zorgen dat "QC Aliquot" is een nauwkeurige weergave van genoom-DNA-monster.

3. Quality Control

  1. sample Purity
    1. Gebruik een TE leeg beoordeelt het monster zuiverheid van het DNA door het laden van 1 pl van de QC Aliquot een klein volume spectrofotometer. Record A260 / A280 en A260 / A230 lezingen. Zuiver DNA zal een A260 / A280-verhouding van ongeveer 1,8 en A260 / A230-verhouding tussen 1,8 en 2,2 hebben.
  2. Kwantificering van genomisch DNA
    1. Voeren kwantificering van QC monster onder toepassing van een commerciële dubbelstrengs DNA kwantificatie assay kit volgens de instructies van de fabrikant.
  3. DNA Quality Assessment I
    1. Load ongeveer 60 ng genomisch DNA enDNA ladder op een 0,7% agarosegel in 1 x TAE (40 mM Tris, 20 mM azijnzuur en 1 mM EDTA, pH 8,0). Draaien gelapparaat bij 70 V gedurende 40-45 min tot genomisch DNA banden 2 cm van de bron en bandopsplitsing in de ladder blijkt. Deze voorwaarden moeten mogelijk worden aangepast op basis van beschikbare gelelektroforese inrichting.
  4. DNA Quality Assessment II
    1. Load ongeveer 60 ng genomisch DNA en een hoogmoleculair DNA-ladder molecuulgewicht (geschikt voor pulsed-field gelelektroforese) op een 1% agarosegel in 0,5 x TBE (44,5 mM Tris, 44,5 mM boorzuur, 1 mM EDTA, pH 8,3) en uitgevoerd in 0,5 x TBE loopbuffer gebruikmaking van een 5-80 kbp golfvorm pulsed-field gelelektroforese protocol voor 16 uur.
  5. Evaluatie van bacteriële, schimmel, en Plant Contaminanten
    1. Uitvoeren van polymerase kettingreactie (PCR) om de juiste interne getranscribeerde afstandhouder (ITS) gebieden van de ribosomale genen onder gebruikmaking van primers en amplificatie condities lijst amplificerened in tabel 2. Belasting 10 pi van het verkregen reactiemengsel op een gel.
      OPMERKING: Een band die het echte meeldauw ITS regio moet worden versterkt met de schimmel ITS primers. DNA van deze amplicon en elke amplicon gegenereerd met bacteriële of plantaardige primers worden gesequenced om de oorsprong van de verontreiniging te bepalen. Alleen echte meeldauw ITS sequenties moeten worden gevonden in de schimmel amplicon.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Een representatief voorbeeld van 60 ng gezuiverd genomisch DNA uit G. cichoracearum over agarose gel met gelelektroforese en gebruiken gepulseerd veld gelelektroforese worden getoond in Figuren 1 en 2 respectievelijk. Genomisch DNA preparaten die, marginaal passeren passeren en niet kwaliteitscontrole worden weergegeven. Genomisch DNA preparaten die kwaliteitscontrole volledig passen ideaal voor sequentiebepaling met behulp van lange-lezen genoom benaderingen. Preparaten die marginaal passeren kwaliteitscontrole aanvaardbaar, maar bereidingen die volledig voorbij de voorkeur. Preparaten die kwaliteitscontrole falen zijn niet aanvaardbaar voor de lange read genoom sequencing benaderingen.

Figuur 1
Figuur 1: Agarose gelelektroforese van gezuiverd genomisch DNA. Laan 1: Laan 2: genomisch DNA dat de kwaliteitscontrole doorgegeven; Laan 3: genomisch DNA die marginaal beschouwd; en Lane 4: genoom-DNA dat de kwaliteitscontrole is mislukt. Acceptabel en marginale genome DNA monsters een enkele band loopt dan 20 kbp met minimale vegen op <20 kbp. Genomische DNA-monsters die kwaliteitscontrole niet hebben uitsmeren dan 20 kbp, en kunnen laagmoleculaire fragmenten bij ongeveer 100 bp (*) bevatten. Pulsed-field gelelektroforese nodig is om onderscheid te maken tussen acceptabele en marginale DNA-monsters. Ethidium bromide werd aan de gel toegevoegd voorafgaand aan elektroforese op het genomische DNA te visualiseren. Monsters werden bij 60 V gedurende 50 minuten. De gel werd in beeld gebracht onder UV-licht met behulp van een gel-documentatiesysteem.

Figuur 2
Figuur2: Pulsed Field Gel Elektroforese (PFGE) van gezuiverde meeldauw Genomisch DNA. Laan 1: moleculair gewicht standaarden, met de hoogste band bij 48,5 kbp en de laagste op 8.1 kbp. Lanen 2 en 5: molecuulgewichtsstandaarden toont banden van 20, 10, 7, 5, 4, 3, 2 en 1,5 kbp (onderin beeld gel). Laan 3: marginaal DNA-monster, waarbij het merendeel van het DNA tussen 20 en 48,5 kbp in grootte. Laan 4: een acceptabel DNA-monster, waarbij het merendeel van het DNA> 48,5 kbp (*). De monsters werden bij 75 V gedurende 15 h en een 5-80 kbp PFGE golfvorm programma. DNA-kleuring kleurstof werd toegevoegd aan de gel na elektroforese en de gel werd onder UV-licht belicht onder gebruikmaking van een gel documentatiesysteem.

Reagens Final Concentratie
kalium Metabisulfite (K 2 S 2 O 5) 0,25 M
Trisbuffer pH 7,5 0,2 M
Ethyleendiaminetetraazijnzuur (EDTA) 50 mM
Natriumchloride (NaCl) 2M
Cetyltrimethylammoniumbromide (CTAB) 2% v / v

Tabel 1: Bereiding lysisbuffer. Brengen tot een volume van 5 ml met dH 2 O.

Doel primer Naam primer Sequence Tm (° C) Verwachte Grootte van het product (bp)
Fungal ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
Bacteriële 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Bacteriële 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Fungal 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

Tabel 2: Primers voor Verontreiniging Assessment.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Om zuivere, hoogmoleculair genomisch DNA te verkrijgen uit de obligate biotrofe meeldauw schimmels, een gemodificeerde versie van eerder beschreven werkwijzen ontwikkeld 30. De gemiddelde opbrengst met deze geoptimaliseerde protocol 7 ug DNA per 150 mg conidia, een verdubbeling van de opbrengst verkregen met een vooraf protocol. Ook de gemiddelde grootte steeg van ongeveer 20 kbp tot meer dan 48,5 kbp. Dit protocol werd geoptimaliseerd in cucumber- G. cichoracearum systeem. Om de beste kwaliteit en hoogste zuiverheid DNA in andere poederige meeldauw biotrofe schimmels verkrijgen of obligate kunnen bijkomende modificatie van het protocol nodig. In de toekomst kan dit protocol worden gebruikt hoogmoleculair DNA geschikt voor lange-lezen DNA sequencing alle obligate biotrofe schimmels te verkrijgen, maar verdere modificatie nodig zijn.

Balancing hoge DNA opbrengst en hoog molecuulgewicht geëxtraheerd DNA werd bezorgdheidtijdens het optimaliseren van het protocol. Stappen zoals vortexen werden geëlimineerd teneinde afschuiving van het DNA te minimaliseren en werden vervangen door voorzichtig te mengen door inversie. Deze verandering vergroot de kwaliteit van het geëxtraheerde DNA zonder de opbrengst aanzienlijk verminderen. Bovendien verwijderen van de stalen kogels in het begin de cellyse stap significant verhoogd DNA-opbrengst in vergelijking met het verlaten van de ballen in de oplossing tot het einde van de lysisstap.

Geen G. cichoracearum conidia bleef intact na de balmalen procedure in stap 1.3. Goede opbrengsten van hoogmoleculair genomisch DNA molecuulgewicht te verkrijgen, is het cruciaal dat de schimmel celwand wordt verstoord tijdens deze stap. Conidial integriteit kan microscopisch worden beoordeeld, en de extra bal malen of alternatieve methoden voor verstoring kan vereist zijn voor andere schimmelsoorten.

Sommige schimmels conidia, met name de Blumeria sp., Bevatten pigmenten die kunnen contamineren DNA extractie en zuivering pogingen. In deze gevallen het beste het DNA filtratiestap zoals bepaald in de Bourras et al. (2015) protocol 19 en een extra wasstap met TE na de filtratiestap. De toevoeging van de filtratiestap geleid tot een kleine maar significante toename in DNA-degradatie, en dient alleen geselecteerd als overmatige pigmentatie blijft na de tweede DNA-precipitatiestap. Deze pigmenten, indien toegestaan ​​in oplossing blijven, kunnen interfereren met latere analyse van de kwaliteit en kwantiteit van DNA en zou kunnen interfereren met sequentiebepalingsreacties.

Dit protocol omvat zowel een traditionele agarosegelelektroforese stap en een gepulseerd veld gelelektroforese stap. De eerste is een eerste beoordeling van de fractie van DNA dat> 20 kbp en de fractie die draait als een uitstrijk op <20 kbp. Ten behoeve van de stroomafwaartse sequentie reacties vereist poedervormige mildauw genomen, de fractie van DNA <20 kbp moet minimaal zijn (zie figuur 1, laan 2 versus laan 4). De gepulste-field gelelektroforese assessment een betere schatting van de omvang als DNA> 20 kbp kunnen gescheiden worden op grootte. DNA van> 48,5 kbp wenselijk voor toepassing bij volgende reacties voor sequentiebepaling (zie figuur 2, laan 4).

Het fungale materiaal dat in deze experimenten werd gekweekt in kweekkamers en vervuiling beperkt door strikte isolatie protocollen en personeel controles. Hierdoor verontreiniging met andere, niet-poederige meeldauw pathogenen was minimaal en sequentiebepaling van het ITS-gebied geamplificeerd met primers schimmels gewonnen slechts G. cichoracearum sequenties. Dit is misschien niet het geval voor echte meeldauw verzameld uit het veld sites of kassen ontbreekt dezelfde isolatie-controles, en de beoordeling besmetting in deze cas zijnes is cruciaal voor de montage van hoogwaardige genomen uit het geëxtraheerde DNA.

Niemand modificatie van de verschillende fungale DNA-isolatie protocollen was uniek belang. Veeleer geringe modificaties in vele stappen resulteerden in relatief hoge opbrengsten hoog molecuulgewicht meeldauw DNA hier beschreven.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Zuivering van hoog molecuulgewicht Genomic DNA van echte meeldauw voor Long-Read Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter