Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

טיהור של ה- DNA הגנומי משקל מולקולרי גבוה מ אבקתי טחב על רצף ארוך לקריאה

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

פטריות טחב אבקה הן קבוצה של פתוגנים צמח פטרייתיים חשובים מבחינה כלכלית. יחסית מעט מאוד ידוע על הביולוגיה והגנטיקה המולקולרית של פתוגנים אלה, בין השאר בשל חוסר משאבים גנטיים גנומי מפותח. יש אורגניזמים אלה הגנום גדול, החוזרות על עצמן, אשר הפכו הגנום רצף והרכבה להחריד קשה. כאן, אנו מתארים שיטות לאיסוף, מיצוי, טיהור בקרת איכות הערכת הדנ"א הגנומי משקל מולקולרי גבוה ממיני טחב אבקה אחד, Golovinomyces cichoracearum. הפרוטוקול המתואר כולל הפרעה מכנית של נבגים ואחריו מיצוי DNA גנומי מותאם פנול / כלורופורם. תשואה אופיינית היתה DNA 7 מיקרוגרם לכל 150 נבגים מ"ג. ה- DNA הגנומי כי הוא מבודד באמצעות הליך זה מתאים רצף ארוך לקרוא (כלומר,> 48.5 KBP). אמצעי בקרת איכות על מנת להבטיח את הגודל, תשואה, וטוהר של הדנ"א הגנומי הם גםהמתוארים בשיטה זו. רצף של הדנ"א הגנומי של האיכות המתוארת כאן יאפשר ההרכבה וההשוואה של הגנום טחב אבקתי מרובה, אשר בתורו יוביל להבנה טובה יותר ושיפור שליטת הפתוגן חקלאי זה.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

קימחון הם קבוצה של צמחים biotrophic פטרייתיים לחייב פתוגנים, כאשר נלקח יחד, הם הגורם הגדול ביותר של מחלות צמחים ברחבי העולם 1. ישנם מעל 900 מינים מתוארים של טחב אבקתי, אשר קובצו טקסונומית לחמש שבטים בתוך המשפחה Erisyphaceae 2. הן בשל חשיבותה הכלכלית שלהם ואת היחסים האינטימיים שהם מפתחים עם מארחיהם, מחלות טחב אבקתי כבר נושא למחקר עבור> 100 שנים. לאחר ההדבקה, קימחון לעורר שינויים דרסטיים במבנה הסלולר, חילוף החומרים וביולוגיה מולקולרית של מארחיהם, ליהנות פתוגן זה. עם זאת, המחקר של קימחון הוא מאתגר במיוחד בשל אורח חי מחייבים שלהם, והצמיחה של הפטרייה בתרבות טהורה טרם תארה 3, 4, 5,"Xref"> 6, 7, 8. שינוי גנטי אמין ויציב של קימחון יש גם עדיין לא הושג, למרות שינוי חולף דווח בכמה מינים 9, 10.

והרצף וההרכבה של הגנום טחב אבקתי הוכיח קשים בשל מספר התכונות של הגנום עצמו. הגנום טחב אבקתי גדול (120 - 180 MBP) ביחס הגנום פטרייתיים אחר, וכולל 60 - 90% אלמנטים חוזרים מופצים באופן שווה 11. אלמנטים אלה כוללים חזרות הטרמינל הלא-ארוכות, כמו גם אלמנטים חוזרים ללא קטגוריה. שני speciales formae של מיני טחב אבקה יחידים, F graminis Blumeria. sp. hordei ו F. sp. tritici (BGH ו bgt, בהתאמה) וכן טחב אבקתי ענבים Erysiphe necator, יש דבוריםn רצף, ואת הגנום טיוטה עבור כמה אחרים הושלמו 12, 13, 14. האופי החוזר ונשנה של הגנום עשה הרכבה קשה, ואת הגנום BGH השלימה הורכב לתוך 6989 supercontigs עם L50 של 2 Mb 12.

למרות בגנום גדול, קימחון נראה שיש מספר קטן של גנים המקודדים חלבונים, עם 5845 ו 6540 גנים החזוי BGH ו bgt, בהתאמה. קימחון הרצף גם נראה חסר לפחות גני ליבה 99 כי הם חיוניים פטריות אחרות, אשר עולה בקנה אחד עם התלות של הפטריות על הצמח הפונדקאי שלהם להישרדות 11, 12, 13, 14.

רצפים חוזרים ליד telomers, צנטרומר, RN הריבוזומיתמערכי גנים ואזורים המועשרים ב מאלמנטים ניידים הם מאורגנים מן אסטרטגיות רצף קצרות לקריאה ולעתים קרובות הם תת ייצוג המכלולים הגנום 15. אזורים כאלה נחשבים אחראים רבים של הפערים המתרחשים רצפי גנום, וזה חל על הקימחון עם ההתרחבות שלהם הנרחבת של אלמנטים חוזרים 16. Highly אזורים בגנום פלסטיק נמצאים בדרך כלל באזורים חוזרים כגון 3. הם משמשים כאתר של שיחלופים כרומוזום ולעתים קרובות לקודד גנים תחת לחץ סלקטיבי חזק, כגון גנים המקודדים חלבונים מפעיל ואת הגנים המקודדים אנזימים של המטבוליזם המשני. התקדמות בטכנולוגיות סידור מולקולה בודדת לקריאה ארוכה מספקת פתרון אפשרי עבור סידור פני אזורים חוזרים של הגנום 15. לדוגמה, Faino ואח. (2015) מצאו כי ארוך רצף כולל לקרוא טכנולוגיות מטר אופטיapping מותר להם לייצר רצף הגנום פחות פער לשני זנים של דליית Verticillium הפתוגן צמח פטרייתיים, שולש שיעור רצפי DNA חוזרים בגנום, הגדלת מספר הסברי גן (וצמצום מספר סברי גן חלקי או חסר ) ו הגנום חושפני שיחלופים 17.

כדי להעסיק טכנולוגיות רצף ארוכות לקרוא אלה, ריכוזים גבוהים של הדנ"א הגנומי באיכות גבוהה, עם גדלים מינימאלי> 20 KBP, נדרשים. כאן אנו מתארים את השיטות שלנו לאיסוף נבגים, טיהור של דנ"א משקל מולקולרי גבוה מ נבגים והערכות בקרת איכות שלנו באמצעות מיני טחב אבקה Golovinomyces cichoracearum גדלו על מלפפון 18. פרוטוקול זה מבוסס על פרוטוקול שפותח בקבוצה מעבדה B. קלר (אוניברסיטת ציריך, ציריך שוויץ) 13, 19וכולל מספר שינויים שהובילו תשואות DNA מוגברות שיעור גבוה יותר של ה- DNA> 48.5 KBP בגודלם. הפרוטוקול כולל גם צעדי בקרת איכות מבוססות על המלצות מארה"ב מח' הגנום משותף אנרגיה במכון 20, 21, 22.

הפונקציה של כל מגיב הכלול במאגר תמוגה, ואת הרציונל לכל שלב טיהור, מתוארת כמו הנרי (2008) 23. פרוטוקולים שפורסמו זמין עבור בידוד של DNA גנומי משקל מולקולרי גבוה מרקמות הצמח מיקרוביאלי היו התייעץ גם בשלבי התכנון של פרוטוקול זה 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. הכנת חומר פטרייתיים

  1. גידול אבק טחב
    1. לגדל צמחים בתאי גידול עם התנאים הבאים: 22 ° C יום הטמפרטורה, 20 ° C טמפרטורה בלילה, 80% לחות יחסית, 14-h-אורך היום לבין עוצמת אור של 125 μE / m 2 / s (המסופק על ידי תאורת פלורסנט ).
    2. להדביק צמחים מלפפון (מגוון סטיבה Cucumis בוש אלוף) עם UCSC1 זן cichoracearum Golovinomyces כמתואר 18, 29.
  2. קציר אבק טחב נבגים
    1. קציר נבגים מצמחים נגועים ב 7 - 10 ימים לאחר חיסון באמצעות ואקום קטן עם מסנן ב-קו (11 מיקרומטר) שעליו נבגים לצבור. הפעלת לחץ עדין, להפעיל את זרבובית הוואקום לאורך פני השטח של העלים כדי לאסוף את הנבגים.
      הערה: התשואה הממוצעת של G. cichoracearum הוא 20 מ"ג של נבגים מתוך בכבדות infeעלה מלפפון cted של כ 130 ס"מ 2 בתחום.
    2. מברישים על 150 מ"ג של נבגים (כ 375 נפח μL, או נבגים 7-8 עלים מלפפון נגועים) מהמסנן גבי גיליון נייר נקי. מכאן, להעביר נבגים לתוך 2 מ"ל cryovials עם שני 5/32-inch בקוטר טרום צונן (בחנקן נוזלי) כדורי טחינה פלדה. מיד לחזור צינורות חנקן נוזלי. צינורות חנות ב -80 מעלות צלזיוס.
  3. כשפתח נבגים ידי כדור כרסום
    1. פלאש להקפיא צלחות אלומיניום של טחנת כדור בחנקן נוזלי. טען cryovials לתוך מתלה כדור-הטחנה. נמרצות לנער את cryovials עם כדורי נבגים ופלדה בטחנת הכדור עבור 30 שניות על 30 מחזורים / s (בטמפרטורת החדר). מיד refreeze cryovials בחנקן נוזלי.
      הערה: בתחילה, לגשת מדגם של נבגים על ידי מיקרוסקופ בהגדלה 100X ליעילות של קרע בדופן התא במהלך שחיקה. במידת הצורך, לטחון עבור תוספת 1 - 2 סבבים של 30 s עבור 30 מחזורים / s, בUT לשמור על מספר סיבובים עד למינימום. הערכה שגרתית של שבירה הנבגים ידי מיקרוסקופ בשלב זה היא מיותרת פעם הוקמו תנאים אופטימליים.

2. טיהור DNA הגנומי

  1. תמוגה נבגים
    1. עבודה במהירות כדי למנוע הפשרת נבגים, להסיר את כדורי פלדה מ cryovials עם מגנט. הוספת 700 μL 65 ° חיץ תמס C (לוח 1) ו מערבולת 5 - 10 s עד תרחיף נוצר.
    2. הוספת 300 μL מראש התחמם (C 65 °) 5% (v / v) sarcosyl ו להפוך בעדינות לתערובת (1 היפוך לכל 3 ימים) חמש פעמים. דגירת צינורות עבור 30 דקות ב 65 מעלות צלזיוס; להפוך פעמים 3 בעדינות על 10, 20 ו 30 דק '. בעזרת קצה פיפטה רחב נשא, להעביר פתרון שלם צינור 2 מ"ל microcentrifuge חדש. בכל השלבים הבאים, ומערבבים על ידי היפוך עדין, איטי ולהעביר את פתרונות המכילים DNA עם טיפים פיפטה רחב נשא.
  2. הפקת DNA לי
    1. להוסיף 1 נפח של כלורוטופס: אלכוהול isoamyl (24: 1 v / v) לפתרון תמוגה להפוך בעדינות לתערובת חמש פעמים. דגירה של 10 דקות בטמפרטורת החדר, היפוך בעדינות לתערובת חמש פעמים בנקודת אמצע הדרך ואז שוב בסוף הדגירה. צנטריפוגה בטמפרטורת החדר למשך 15 דקות ב 14,000 x ז. באמצעות קצה פיפטה רחב נשא, להעביר את השכבה המימית בזהירות 2 צינור microcentrifuge חדש מ"ל; להימנע כולל חומר מהממשק.
  3. DNA משקעים לי
    1. להוסיף 1 נפח בטמפרטורת החדר 100% isopropanol (כ 750 μL) ו להפוך בעדינות לתערובת שש פעמים. צנטריפוגה בטמפרטורת החדר למשך 15 דקות ב 14,000 x ז. מוציאים בזהירות את supernatant וזורקים.
    2. הוספת 450 μL מראש מצונן (-20 ° C) אתנול 70%. צנטריפוגה 5 דקות בטמפרטורת החדר בבית g 14,000 x. מוציאים בזהירות את supernatant וזורקים. צנטריפוגה ב 1000 XG במשך 3 ים, להסיר את supernatant בזהירות עם קצה פיפטה בסדר וזורקים. אוויר יבש גלולה במשך 15 דק 'טמפרטורת T בחדר. אין לייבש יותר מ 15 דקות.
    3. Resuspend גלולה 300 μL TE (10 מ"מ טריס-Cl, 1 מ"מ חומצה אצטית טטרה diamine אתילן, pH 8.0). דגירה לילה בשעה 4 ° C. בעדינות קפיצי להשעות כל חומר שיורית שלא להיכנס פתרון.
  4. כדי להסיר זיהום RNA, להוסיף 10 μL RNase A (10 מ"ג / מ"ל). בעדינות להפוך לערבב שלוש פעמים. צנטריפוגה XG ב 1000 עבור 3 s. לדגור על 37 מעלות צלזיוס למשך 2 h.
  5. הפקת DNA II
    1. הוספת 300 μL פנול: כלורופורם: אלכוהול isoamyl (25: 24: 1 v / v) ו להפוך בעדינות לתערובת חמש פעמים. דגירה 10 דקות בטמפרטורת החדר, היפוך בעדינות לתערובת חמש פעמים על מחציתו ושוב בסוף הדגירה. צנטריפוגה 15 דקות בטמפרטורת החדר ב 14,000 x ז. בעזרת קצה פיפטה רחב נשא, להעביר את supernatant צינור 1.5 מ"ל microcentrifuge חדש.
  6. DNA משקעים II
    1. להוסיף 5.2 pH אצטט 0.01 נפח 3 M נתרן (approximately 3 μL), להפוך בעדינות לתערובת חמש פעמים. הוספת 2.5 כרכים טרום צונן (-20 ° C) 100 אתנול% (כ 750 μL). בעדינות להפוך לערבב חמש פעמים. דגירת הלילה בשעה -20 ° C.
    2. צנטריפוגה 30 דקות ב 4 ° C ב 14,000 x ז. מוציאים בזהירות את supernatant וזורקים.
    3. הוספת 450 μL מראש מצונן (-20 ° C) אתנול 70%. צנטריפוגה 5 דקות ב 4 ° C ב 14,000 x ז. מוציאים בזהירות את supernatant וזורקים. צנטריפוגה XG ב 1000 עבור 3 s. מוציאים בזהירות את supernatant עם טיפ מחק פיפטה בסדר.
    4. אוויר יבש גלולה במשך 30-60 דקות בטמפרטורת החדר. Resuspend גלולה 27.5 μL TE. דגירה לילה בשעה 4 ° C. בעדינות קפיצי להשעות כל חומר שיורית שלא להיכנס פתרון.
    5. Aliquot 2.5 μL לתוך 22.5 μL TE (25 נפח סופי μL) עבור בדיקות בקרת איכות (ראו להלן). חנות ה- DNA דגימות ב 4 מעלות צלזיוס עד הגשת רצף. עבור אחסון לטווח ארוך, דגימות חנותב -80 ° C ו למזער להקפיא להפשיר מחזורים כדי למנוע מריחה.
      הערה: נזהרת בעת pipetting בשלב הזה כמו ה- DNA הגנומי המשקל המולקולרי הגבוה יכול להיות קשה פיפטה כראוי, וזה חשוב כדי להבטיח כי "QC Aliquot" הוא ייצוג מדויק של דגימת DNA הגנומי.

3. בקרת איכות

  1. טוהר מדגם
    1. בעזרת ריק TE, להעריך את טוהר מדגם של DNA על ידי טעינת 1 μL של QC Aliquot על ספקטרופוטומטר קטן-נפח. קריאות שיא A260 / A280 ו- A260 / A230. דנ"א טהור יהיה יחס A260 / A280 של יחס כ 1.8 ו A260 / A230 בין 1.8 לבין 2.2.
  2. כימות של הדנ"א הגנומי
    1. בצע כימות של aliquot QC באמצעות ערכת assay כימות מסחרי פעמיים תקועים DNA על פי הוראות היצרן.
  3. להערכת איכות DNA לי
    1. כ טען 60 הדנ"א הגנומי ng וסולם DNA על ג'ל agarose 0.7% ב 1x טה (40 מ"מ טריס, 20 mM חומצה אצטית, ו 1 mM EDTA, pH 8.0). מנגנון ג'ל לרוץ לעבר 70 V עבור 40 - 45 דקות עד להקות הדנ"א הגנומי כ 2 סנטימטר מן ההפרדה היטב להקת הסולם ניכר. תנאים אלה עשויים צריכים להיות מותאמים המבוססים על מנגנון ג'ל אלקטרופורזה זמין.
  4. DNA איכות הערכת II
    1. טען כ 60 ng DNA גנומי סולם DNA משקל מולקולרי גבוה (מתאים ג'ל אלקטרופורזה פעמו שדה) על ג'ל agarose 1% ב TBE 0.5x (44.5 מ"מ טריס, 44.5 מ"מ חומצה בורית, 1 מ"מ EDTA, pH 8.3) ו לרוץ למאגר פועל TBE 0.5x באמצעות 5 - פרוטוקול ג'ל אלקטרופורזה פעם שדה צורת גל KBP 80 עבור 16 h.
  5. הערכת חיידקים, פטריות, צמחים ומזהמים
    1. בצע תגובת שרשרת פולימראז (PCR) כדי להגביר את המפרידים עבדו הפנימיים המתאימים האזורים (ITS) של גני ריבוזומלי באמצעות פריימרים ותנאי הגברת רשימהed בטבלה 2. טען 10 μL של התגובה הנובעת מהם על ג'ל.
      הערה: להקה המייצגת את הטחב אבק באזור שלה צריך להיות מוגבר עם פריימרים ITS פטרייתיים. דנ"א amplicon זה וכל amplicon שנוצר עם פריימרים החיידקים, או הצמח צריך להיות רצף כדי לקבוע את מקור הזיהום. טחב אבק רק רצפי ITS צריך להימצא amplicon פטרייתיים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

דוגמה מייצגת של 60ng הדנ"א הגנומי מטוהרים מן G. cichoracearum להריץ על ג'ל agarose באמצעות ג'ל אלקטרופורזה ושימוש ג'ל אלקטרופורזה פעמו שדה מוצגים איורים 1 ו 2, בהתאמה. הכנות DNA הגנומי שעוברים, שולי לעבור להיכשל בקרת איכות מיוצגות. הכנות DNA הגנומי שעוברות בקרת איכות באופן מלא הם אידיאליים עבור סידור באמצעות גישות רצף הגנום ארוך לקרוא. הכנות כי שולי לעבור בקרת איכות כשרים, אך הכנות שעוברות מלא עדיפות. הכנות שאינן מצליחות בקרת איכות אינן מקובלות גישות רצף הגנום ארוכה לקריאה.

איור 1
איור 1: Agarose ג'ל אלקטרופורזה של מטוהרים הדנ"א הגנומי. ליין 1: ליין 2: הדנ"א הגנומי כי עבר בקרת איכות; ליין 3: הדנ"א הגנומי כי נחשב שולי; וליין 4: הדנ"א הגנומי כי נכשל בקרת איכות. יש דוגמאות דנ"א גנומי קבילות ושוליות להקה אחת פועלת מעל 20 KBP עם מריחות מינימאליות בבית <20 KBP. דגימות הדנ"א הגנומי כי להיכשל בקרת איכות יש למרוח מתחת 20 KBP, והוא עשוי לכלול שברי משקל מולקולרי נמוך בכ 100 נ"ב (*). ג'ל אלקטרופורזה פעם שדה נדרשה להבחין בין דגימות DNA מקובל שוליות. Ethidium ברומיד נוספה ג'ל אלקטרופורזה לפני לדמיין את ה- DNA הגנומי. דוגמאות היו electrophoresed ב 60 V עבור 50 דקות. הג'ל היה צלם תחת אור UV באמצעות מערכת תיעוד ג'ל.

איור 2
דמות2: ג'ל אלקטרופורזה פעם-שדה (PFGE) של הדנ"א הגנומי טחב אבקה מטוהרים. ליין 1: סטנדרטים משקל מולקולרי, עם הלהקה הגבוהה ביותר 48.5 KBP ואת הנמוך ביותר ב 8.1 KBP. Lanes 2 ו 5: סטנדרטי משקל מולקולריים מראים להקות של 20, 10, 7, 5, 4, 3, 2 ו 1.5 KBP (בתחתית תמונת ג'ל). ליין 3: דגימת DNA שולית, עם רוב ה- DNA בין 20 לבין 48.5 KBP בגודלם. ליין 4: דגימת DNA מקובלת, עם רוב KBP 48.5 DNA> (*). דוגמאות היו לרוץ 75 V עבור 15 h באמצעות תוכנית waveform PFGE 5-80 KBP. צבע DNA המכתים נוסף ג'ל לאחר אלקטרופורזה בג'ל היה צלם תחת אור UV באמצעות מערכת תיעוד ג'ל.

מֵגִיב ריכוז סופי
אשלגן metabisulfite (K 2 S 2 O 5) 0.25 M
טריס חיץ pH 7.5 0.2 M
חומצת Ethylenediaminetetraacetic (EDTA) 50 מ"מ
נתרן כלורי (NaCl) 2 M
ברומיד אמוניום Cetyltrimethyl (CTAB) v 2% / v

טבלה 1: הכנת הצפת תמוגה. מביאים נפח של 5 מ"ל עם DH 2 O.

יַעַד שם Primer רצף פריימר TM (° C) גודל תוצר צפוי (נ"ב)
פטרייתיים ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61.3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
בקטריאלי 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63.8-66.5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46.9-53.8
בקטריאלי 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60.8-66.5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43.9-53.8
פטרייתיים 18S V4 FW CCAGCASCYGCGGTAATTCC 58.7-61.5 431
RV ACTTTCGTTCTTGATYRA 43.2-48.3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

טבלה 2: צבעי יסוד הערכת זיהום.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

על מנת לקבל טהור, הדנ"א הגנומי משקל מולקולרי גבוה מן פטריות וטחב אבקתי biotrophic לחייב, גרסה שונה של השיטות שתוארו קודם לכן פותחה 30. התשואה הממוצעת באמצעות פרוטוקול מותאם זה DNA 7 מיקרוגרם לכל 150 מ"ג נבגים, הכפלה של התשואה המתקבלת עם פרוטוקול מוקדם. כמו כן, את הגודל הממוצע גדל מכ 20 KBP למעל 48.5 KBP. פרוטוקול זה מותאם במערכת cichoracearum ג cucumber-. על מנת לקבל את האיכות הטובה ביותר ואת DNA הטוהר הגבוה ביותר טחב אבקה אחר או לחייב פטריות biotrophic, שינוי נוסף של פרוטוקול זה עשוי להידרש. בעתיד, פרוטוקול זה יכול לשמש כדי להשיג DNA משקל מולקולרי גבוה מתאים רצפי DNA ארוכים לקרוא פטריות biotrophic לחייב אחרות, אם כי שינוי נוסף שיידרש.

איזון תשואת DNA גבוהה-משקל מולקולרי גבוה של DNA שחולץ היה חששבמהלך אופטימיזציה של פרוטוקול זה. שלבים כולל vortexing בוטלו על מנת למזער מריחה של DNA, והוחלפו על ידי ערבוב בעדינות על ידי היפוך. שינוי זה הגדיל את איכות ה- DNA שחולץ ללא צמצום משמעותי את התשואה. בנוסף, הסרת כדורי הפלדה בתחילת צעד התא ימס גדל באופן משמעותי תשואת DNA בהשוואה עוזב את הכדורים בתמיסה עד תום השלב ימס.

אין G. cichoracearum נבגים נותר ללא פגע לאחר הליך טחינה הכדור בשלב 1.3. כדי להשיג תשואות טובות של הדנ"א הגנומי משקל מולקולרי גבוה, זה קריטי, כי את דופן התא פטרייתיים מופרת במהלך שלב זה. שלמויות נבגים ניתן להעריך מיקרוסקופית, כרסום כדור נוסף או שיטות חלופיות של שיבוש עשוי להידרש מיני פטרייתיים אחרים.

כמה נבגים פטרייתיים, בעיקר sp Blumeria., מכילים פיגמנטים שיכולים המשךניסיונות החילוץ וטיהור DNA aminate. במקרים אלה, אנו ממליצים לכלול את הצעד סינון DNA כפי שמתואר ואח Bourras. (2015) פרוטוקול 19 ו צעד לשטוף נוסף עם TE אחרי צעד הסינון. התוספת של צעד סינון הביאה לעלייה קטנה אך משמעותית שפלת DNA, וצריכה להיכלל רק אם פיגמנטציה מופרזת נשארת אחרי הצעד המשקע DNA השני. פיגמנטים אלו, אם מותר להישאר פתרון, עלולים להפריע ניתוח מאוחר של איכות וכמות ה- DNA ועלול להפריע לתגובות רצף.

פרוטוקול זה כולל הוא צעד ג'ל אלקטרופורזה מסורתי agarose ו צעד ג'ל אלקטרופורזה פעם שדה. הראשון הוא הערכה ראשונית של שבריר של DNA כי הוא> 20 KBP ואת השבר שיוצא כמו למרוח על <20 KBP. לצורך תגובות הסידור במורד הזרם הנדרש mil אבקהגנום מטל, בשבריר של דנ"א <20 KBP צריך להיות מינימלי (ראה איור 1, נתיב 2 מול נתיב 4). הערכת ג'ל אלקטרופורזה פעם השדה מספקת הערכה טובה יותר של הגודל כמו ה- DNA> 20 KBP ניתן להפריד לפי גודל. ה- DNA של> 48.5 KBP רצוי לשימוש תגובות סידור עקב (ראה איור 2, מסלול 4).

החומר פטרייתיים השתמש בניסויים אלה הופץ ב תאי גידול וזיהום הוגבל באמצעות פרוטוקולי בידוד מחמירים ובקרות אדם. מסיבה זו, זיהום עם פתוגנים טחב אחרים, שאינם אבקתי היה מינימלי, ואת רצף של האזור ITS מוגבר באמצעות פריימרים ספציפיים פטריות התאושש רק רצפים ג cichoracearum. זה לא יכול להיות במקרה של קימחון שנאסף מאתרי שדה או חממות החסרות אותו שולטת הבידוד, והערכת זיהום ב- CAS אלהes יהיה קריטי עבור ההרכבה של הגנום באיכות גבוהה מ- DNA החילוץ.

שום שינוי באחד פרוטוקולי בידוד DNA השונים פטרייתיים היה חשוב באופן ייחודי. במקום זאת שינויים קלים ב צעדים רבים הביאו את התשואות הגבוהות יחסית של דנ"א טחב אבקתי משקל מולקולרי גבוה דיווחו כאן.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
טיהור של ה- DNA הגנומי משקל מולקולרי גבוה מ אבקתי טחב על רצף ארוך לקריאה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter