Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Purificazione di alto peso molecolare genomico da oidio per lungo-Read Sequencing

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

I funghi oidio sono un gruppo di economicamente importanti patogeni delle piante fungine. Relativamente poco si sa sulla biologia molecolare e genetica di questi agenti patogeni, in parte a causa della mancanza di risorse genetiche e genomiche ben sviluppati. Questi organismi hanno grandi, genomi ripetitivi, che hanno reso il sequenziamento del genoma e l'assemblaggio proibitivo difficile. Qui, descriviamo i metodi per la valutazione raccolta, l'estrazione, la purificazione e controllo di qualità di alto peso molecolare DNA genomico da specie muffa uno polverulente, Golovinomyces cichoracearum. Il protocollo descritto comprende distruzione meccanica delle spore seguiti da un ottimizzato fenolo / cloroformio estrazione di DNA genomico. Una resa tipica era 7 ug di DNA a 150 mg conidi. Il DNA genomico che viene isolato utilizzando questa procedura è adatto per il sequenziamento lungo lettura (cioè,> 48,5 kbp). misure di controllo qualità per garantire la dimensione, la resa e la purezza del DNA genomico sono anchedescritto in questo metodo. Sequenziamento del DNA genomico della qualità descritta qui consentirà per l'assemblaggio e il confronto dei genomi multipli oidio, che a sua volta portare ad una migliore comprensione e un migliore controllo di questo patogeno agricolo.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mal bianco sono un gruppo di piante obbligato fungina biotrofico agenti patogeni che, nel loro insieme, sono la principale causa di malattie delle piante in tutto il mondo 1. Ci sono oltre 900 specie descritte di oidio, che sono stati tassonomico raggruppati in cinque tribù all'interno della famiglia Erisyphaceae 2. Sia per la loro importanza economica e l'intimo rapporto si sviluppano con i loro ospiti, malattie oidio sono stati oggetto di ricerca per> 100 anni. Al momento l'infezione, mal bianco suscitano drastici cambiamenti nella struttura cellulare, il metabolismo e la biologia molecolare dei loro ospiti, a beneficio di questo patogeno. Tuttavia, lo studio di mal bianco è particolarmente difficile a causa della loro vita obbligato, e crescita del fungo in coltura pura non è ancora stato descritto 3, 4, 5,"xref"> 6, 7, 8. Affidabile, stabile trasformazione genetica di mal bianco ha inoltre non è ancora stata compiuta, anche se la trasformazione transitoria è stata riportata in alcune specie 9, 10.

Il sequenziamento e l'assemblaggio di polverulenti genomi muffa ha dimostrato difficile a causa di una serie di caratteristiche del genoma stesso. Genomi oidio sono grandi (120 - 180 Mbp) rispetto ad altri genomi fungini, e consistono 60 - 90% elementi ripetitivi uniformemente distribuiti 11. Questi elementi includono ripetizioni terminali non-lungo, così come gli elementi ripetitivi non categorizzati. Due speciales formae di una singola specie oidio, Blumeria graminis f. sp. hordei e f. sp. tritici (BGH e Bgt, rispettivamente), così come l'uva oidio Erysiphe necator, been sequenziato, e un progetto di genomi per molti altri sono stati completati 12, 13, 14. La ripetitività dei genomi ha reso difficile il montaggio, e il genoma BGH pronto è stato assemblato in 6.989 supercontigs con L50 di 2 Mb 12.

Nonostante il grande genoma, i mal bianco sembrano avere un piccolo numero di geni che codificano proteine, con 5.845 e 6.540 geni predetti in BGH e Bgt, rispettivamente. I oidi sequenziate appaiono anche mancare almeno 99 geni essenziali che sono essenziali in altri funghi, che è coerente con la dipendenza dei funghi sulla loro pianta ospite per la sopravvivenza 11, 12, 13, 14.

sequenze ripetitive vicino telomeri, centromeri, RN ribosomialeUn array e regioni arricchite in elementi trasponibili gene sono scarsamente assemblati dalle strategie di sequenziamento short-letto e sono spesso sottorappresentati negli assiemi genoma 15. Tali regioni sono ritenuti responsabili di molte delle lacune che si verificano in sequenze genomiche, e questo vale per i mal bianco con la loro vasta espansione elementi ripetitivi 16. Altamente regioni del genoma di plastica si trovano spesso in tali regioni ripetitive 3. Essi servono come sito di riarrangiamenti e spesso codificano geni sotto forte pressione selettiva, come i geni che codificano proteine ​​effettrici e geni codificanti enzimi del metabolismo secondario. I progressi nelle tecnologie di sequenziamento di lunga lettura singola molecola di fornire una possibile soluzione per il sequenziamento tra le regioni ripetitive di genomi 15. Ad esempio, Faino et al. (2015) hanno trovato che l'inclusione di lunga sequenza leggi le tecnologie e m otticoANALITICI permesso loro di produrre una sequenza genomica gap-meno due ceppi della pianta fungina patogeni Verticillium dalia, triplicando la proporzione di sequenze di DNA ripetute nel genoma, aumentando il numero di annotazioni geniche (e riducendo il numero di parziale o mancanti annotazioni geniche ) e genoma rivelatrice riarrangiamenti 17.

Impiegare queste tecnologie di sequenziamento lunghe lettura, elevate concentrazioni di DNA genomico di alta qualità, con minime dimensioni> 20 kbp, sono necessari. Qui si descrivono i nostri metodi per la raccolta dei conidi, purificazione del DNA ad alto peso molecolare da conidi e le nostre valutazioni controllo qualità utilizzando le specie oidio Golovinomyces cichoracearum cresciuti su cetriolo 18. Questo protocollo si basa su un protocollo sviluppato nel gruppo laboratorio B. Keller (Università di Zurigo, Zurigo Svizzera) 13, 19e include diverse modifiche che hanno portato a un incremento delle rese di DNA e una maggiore percentuale di DNA> 48,5 kbp dimensioni. Il protocollo include anche misure di controllo di qualità sulla base delle raccomandazioni da parte del Dipartimento dell'energia degli Stati Uniti Joint Genome Institute 20, 21, 22.

La funzione di ciascun reagente inclusa nel tampone di lisi, e la logica per ogni fase di purificazione, sono come descritto in Henry (2008) 23. Protocolli pubblicati disponibili per l'isolamento di alto peso molecolare DNA genomico da tessuti vegetali e microbici sono stati consultati anche durante la progettazione di questo protocollo 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparazione del materiale Fungal

  1. Crescere Oidio
    1. Crescere le piante in camere di crescita con le seguenti condizioni: 22 ° C Temperatura di giorno, temperatura 20 ° C notte, 80% di umidità relativa, 14-h giornata intera e un'intensità luminosa di 125 μE / m 2 / s (fornito da lampade fluorescenti ).
    2. Infettare piante di cetriolo (Cucumis sativa varietà Bush Champion) con Golovinomyces cichoracearum ceppo UCSC1 come descritto 18, 29.
  2. Fare la raccolta Oidio Conidi
    1. Raccolto conidi da piante infette a 7 - 10 giorni dopo l'inoculazione con un piccolo vuoto con un filtro in linea (11 micron) su cui i conidi accumulano. Applicando una leggera pressione, eseguire l'ugello di vuoto lungo la superficie della foglia per raccogliere il conidi.
      NOTA: La resa media di G. cichoracearum è di 20 mg di conidi da un pesantemente infeCTED foglia di cetriolo di circa 130 cm 2 nella zona.
    2. Spazzolare circa 150 mg di conidi (circa 375 volumi mL o conidi di 7-8 foglie cetriolo infetti) dal filtro su un foglio di carta pulita. Da qui, trasferire conidi in 2 mL cryovials con diametro due 5/32-inch pre-raffreddata (in azoto liquido) palle di macinazione in acciaio. ritornare immediatamente tubi di azoto liquido. conservare le provette a -80 ° C.
  3. Rottura aperta Conidi da Ball Milling
    1. Flash congelare piatti di alluminio di mulino a palle in azoto liquido. Carico cryovials in cremagliera mulini a palle. Agitare vigorosamente la cryovials con conidi e acciaio palline in mulino a sfere per 30 s a 30 cicli / s (a temperatura ambiente). ricongelare immediatamente cryovials in azoto liquido.
      NOTA: Inizialmente, accedere ad un campione di conidi mediante microscopia a ingrandimento 100X per l'efficienza di rottura della parete cellulare durante la macinazione. Se necessario, macinare per altri 1 - 2 cicli di 30 s per 30 cicli / s, but mantenere il numero di giri al minimo. La valutazione di routine di rottura conidica al microscopio in questa fase non è necessaria una volta stabilite le condizioni ottimali.

2. Il DNA genomico Purificazione

  1. conidi Lysis
    1. Lavorando in fretta per evitare lo scongelamento conidi, rimuovere le sfere di acciaio da cryovials con un magnete. Aggiungere 700 microlitri 65 ° C tampone di lisi (Tabella 1) e vortex 5 - 10 s fino a formare un impasto liquido.
    2. Aggiungere 300 microlitri pre-riscaldato (65 ° C) 5% (v / v) sarcosilL e capovolgere delicatamente per miscelare (1 inversione per 3 s) cinque volte. Incubare le provette per 30 min a 65 ° C; invertire delicatamente 3 volte a 10, 20 e 30 min. Usando una pipetta ampio tunnel, trasferire l'intera soluzione di nuovo 2 ml provetta. In tutte le fasi successive, mescolare delicatamente, lenta inversione e trasferire le soluzioni di DNA contenenti con punte di pipette ampio tunnel.
  2. DNA Extraction I
    1. Aggiungere 1 volume di cloroforma: alcool isoamilico (24: 1 v / v) alla soluzione di lisi e capovolgendo delicatamente per miscelare cinque volte. Incubare per 10 minuti a temperatura ambiente, delicatamente per miscelare invertendo cinque volte a metà strada e di nuovo alla fine dell'incubazione. Centrifugare a temperatura ambiente per 15 minuti a 14.000 x g. Utilizzando ampio tunnel punta della pipetta, trasferire accuratamente lo strato acquoso al nuovo 2 ml provetta; evitare di includere materiale dall'interfaccia.
  3. DNA Precipitazioni I
    1. Aggiungere 1 volume temperatura ambiente 100% isopropanolo (circa 750 mL) e capovolgere delicatamente per miscelare sei volte. Centrifugare a temperatura ambiente per 15 minuti a 14.000 x g. rimuovere con attenzione il surnatante e gettarlo.
    2. Aggiungere 450 microlitri pre-raffreddata (-20 ° C) 70% di etanolo. Centrifugare per 5 minuti a temperatura ambiente a 14.000 x g. rimuovere con attenzione il surnatante e gettarlo. Centrifugare a 1000 xg per 3 s, rimuovere con attenzione il surnatante con punta fine della pipetta e scartare. Far asciugare il pellet per 15 minuti unat temperatura ambiente. Non asciugare per più di 15 min.
    3. Risospendere il pellet in 300 microlitri TE (10 mM Tris-Cl, 1 mM di acido etilendiammina tetra-acetico, pH 8,0). Incubare per una notte a 4 ° C. Delicatamente flick per sospendere di nuovo il materiale residuo che non è andato in soluzione.
  4. Per eliminare la contaminazione di RNA, aggiungere 10 ml RNasi A (10 mg / mL). Delicatamente capovolgere per mescolare tre volte. Centrifugare a 1000 xg per 3 s. Incubare a 37 ° C per 2 h.
  5. DNA Extraction II
    1. Aggiungere 300 microlitri fenolo: cloroformio: alcool isoamilico (25: 24: 1 v / v) e capovolgere delicatamente per miscelare cinque volte. Incubare 10 minuti a temperatura ambiente, delicatamente invertendo mescolare cinque volte al giro di boa e di nuovo alla fine dell'incubazione. Centrifugare 15 min a temperatura ambiente a 14.000 x g. Usando un puntale ampio tunnel, trasferire il surnatante in nuova 1,5 ml provetta.
  6. DNA Precipitazioni II
    1. Aggiungere 0,01 volume di 3 M acetato di sodio pH 5,2 (approximately 3 ml), capovolgere delicatamente per miscelare cinque volte. Aggiungere 2,5 volumi pre-raffreddata (-20 ° C) 100% di etanolo (circa 750 mL). Delicatamente capovolgere per mescolare cinque volte. Incubare per una notte a -20 ° C.
    2. Centrifugare 30 min a 4 ° C a 14.000 x g. rimuovere con attenzione il surnatante e gettarlo.
    3. Aggiungere 450 microlitri pre-raffreddata (-20 ° C) 70% di etanolo. Centrifugare per 5 minuti a 4 ° C a 14.000 x g. rimuovere con attenzione il surnatante e gettarlo. Centrifugare a 1000 xg per 3 s. rimuovere con attenzione il surnatante con punta fine pipetta e degli scarti.
    4. Far asciugare il pellet per 30-60 minuti a temperatura ambiente. Risospendere il pellet in 27,5 microlitri TE. Incubare per una notte a 4 ° C. Delicatamente flick per sospendere di nuovo il materiale residuo che non è andato in soluzione.
    5. Aliquotare 2,5 ml in 22,5 microlitri TE (volume finale 25 ml) per prove di controllo di qualità (vedi sotto). campioni di DNA Conservare a 4 ° C fino alla presentazione per il sequenziamento. Per lo stoccaggio, conservare i campioni a lungo terminea -80 ° C e ridurre al minimo i cicli di gelo-disgelo per evitare taglio.
      NOTA: Fare attenzione durante la dispensazione in questa fase, come l'elevato peso molecolare DNA genomico possono essere difficili da pipettare correttamente, ed è importante per garantire che "QC aliquota" è una rappresentazione accurata del campione di DNA genomico.

3. Controllo Qualità

  1. Purezza del campione
    1. Utilizzando un TE vuoto, valutare la purezza del campione di DNA caricando 1 ml di QC Aliquotare su uno spettrofotometro piccolo volume. Record A260 / A280 e A260 / A230 letture. DNA puro avrà un rapporto A260 / A280 del rapporto di circa 1,8 e A260 / A230 tra 1,8 e 2,2.
  2. La quantificazione del DNA genomico
    1. Eseguire la quantificazione di QC aliquota utilizzando un kit di analisi quantificazione del DNA a doppio filamento commerciale secondo le istruzioni del produttore.
  3. DNA valutazione della qualità I
    1. Carico di circa 60 ng di DNA genomico eladder DNA su un gel di agarosio 0,7% in TAE 1x (40 mM Tris, 20 mM acido acetico, e 1 mM EDTA, pH 8,0). Apparecchiatura gel funzionare a 70 V per 40 - 45 min fino bande di DNA genomico sono circa 2 cm dal pozzo e banda separazione nella scala è evidente. Queste condizioni possono essere necessario regolare basato su apparato gel elettroforesi disponibili.
  4. DNA valutazione della qualità II
    1. Carico di circa 60 ng di DNA genomico e molecolare elevato peso DNA ladder (adatto per pulsato-field gel electrophoresis) su un gel di agarosio 1% in 0,5x TBE (44.5 mM Tris, 44,5 mM di acido borico, 1 mM EDTA, pH 8,3) e eseguire in 0.5x TBE tampone di corsa con un 5 - campo pulsato protocollo elettroforesi su gel 80 kbp forma d'onda per 16 h.
  5. La valutazione di batteri, funghi e contaminanti vegetali
    1. Eseguire la reazione a catena della polimerasi (PCR) per amplificare le opportune distanziatori interni trascritti (ITS) regioni dei geni ribosomali utilizzando primer e condizioni di amplificazione listacato nella tabella 2. Carico 10 microlitri della reazione risultante su un gel.
      NOTA: Una band che rappresenta l'oidio regione ITS deve essere amplificato con il primer fungine ITS. DNA da questo amplicone e ogni amplicone generata con i primer o vegetali batteriche dovrebbe essere sequenziato per determinare l'origine della contaminazione. Solo oidio sequenze ITS dovrebbe essere trovato nel amplicone fungine.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Un esempio rappresentativo di 60ng purificato DNA genomico da G. cichoracearum eseguito su un gel di agarosio usando elettroforesi su gel e utilizzando campo pulsato elettroforesi su gel sono mostrati nelle Figure 1 e 2 rispettivamente,. preparazioni di DNA genomico che passano, marginalmente accettazione e di rifiuto controllo qualità sono rappresentati. preparazioni di DNA genomico che passano completamente il controllo della qualità sono ideali per il sequenziamento utilizzando approcci di sequenziamento del genoma lungo leggere. Preparazioni che passano marginalmente controllo qualità sono accettabili, ma preparazioni che passano completamente sono preferiti. I preparativi che falliscono il controllo di qualità non sono accettabili per il lungo di lettura approcci di sequenziamento del genoma.

Figura 1
Figura 1: Gel di Agarosio di DNA genomico purificato. Corsia 1: Corsia 2: DNA genomico che passava il controllo della qualità; Corsia 3: DNA genomico che è stato considerato marginale; e Lane 4: DNA genomico che non è riuscito il controllo di qualità. campioni di DNA genomico accettabili e marginali hanno una singola banda che corre sopra 20 kbp con minima spalmatura a <20 kbp. Genomiche campioni di DNA che non superano il controllo di qualità sono sbavature inferiore a 20 kbp, e possono includere frammenti a basso peso molecolare di circa 100 bp (*). Campo pulsato elettroforesi su gel è necessario distinguere tra campioni di DNA accettabili e marginali. Etidio bromuro è stata aggiunta al gel prima dell'elettroforesi per visualizzare il DNA genomico. I campioni sono stati sottoposti ad elettroforesi a 60 V per 50 minuti. Il gel è stato ripreso sotto la luce UV utilizzando un sistema di documentazione gel.

figura 2
figura2: pulsato-field gel electrophoresis (PFGE) di purificata oidio DNA genomico. Corsia 1: standard di peso molecolare, con la più alta banda a 48,5 kbp e il più basso a 8,1 kbp. Corsie 2 e 5: standard di peso molecolare mostrano bande di 20, 10, 7, 5, 4, 3, 2 e 1,5 kbp (nella parte inferiore dell'immagine gel). Corsia 3: un campione di DNA marginale, con la maggior parte del DNA tra 20 e 48,5 kbp dimensioni. Corsia 4: un campione di DNA accettabile, con la maggior parte del DNA> 48,5 kbp (*). I campioni sono stati eseguiti a 75 V per 15 h utilizzando un programma PFGE forma d'onda 5-80 kbp. colorante DNA-colorazione è stata aggiunta al gel dopo elettroforesi e il gel è stato ripreso sotto la luce UV utilizzando un sistema di documentazione gel.

Reagente Concentrazione finale
Metab potassioisulfite (K 2 S 2 O 5) 0,25 M
Tampone Tris pH 7,5 0.2 M
acido etilendiamminotetraacetico (EDTA) 50 mM
Il cloruro di sodio (NaCl) 2 M
Cetyltrimethyl ammonio bromuro (CTAB) 2% v / v

Tabella 1: Preparazione di tampone di lisi. Portare ad un volume di 5 ml con dH 2 O.

Bersaglio Nome Primer Sequenza Primer Tm (° C) Previsto Formato del prodotto (bp)
Fungal ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
Batterica 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Batteriche 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Fungine 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

Tabella 2: Primer per la valutazione della contaminazione.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Per ottenere puro, alto peso molecolare DNA genomico dal obbligato biotrofico funghi oidio, una versione modificata di metodi precedentemente descritti è stato sviluppato 30. La resa media usando questo protocollo ottimizzato è 7 ug di DNA a 150 mg conidi, un raddoppio della resa ottenuta con un protocollo precedente. Inoltre, la dimensione media è aumentata da circa 20 a oltre 48,5 kbp kbp. Questo protocollo è stato ottimizzato nel cucumber- sistema cichoracearum G.. Per ottenere la migliore qualità e la più alta purezza DNA in altre oidio o di obbligare funghi biotrofico, può essere necessaria ulteriore modifica di questo protocollo. In futuro, questo protocollo può essere utilizzato per ottenere DNA ad alto peso molecolare adatti per il sequenziamento lungo lettura DNA da altri funghi biotrofici obbligati, sebbene ulteriore modifica può essere necessaria.

Bilanciamento alto rendimento DNA e ad alto peso molecolare del DNA estratto è stato un problemadurante l'ottimizzazione di questo protocollo. Punti compreso vortex sono stati eliminati al fine di minimizzare taglio del DNA, e sono stati sostituiti mescolando delicatamente per inversione. Questo cambiamento ha aumentato la qualità del DNA estratto senza ridurre significativamente la resa. Inoltre, la rimozione delle sfere di acciaio, all'inizio della fase di lisi delle cellule aumentato significativamente la resa del DNA rispetto a lasciare le palline nella soluzione fino al termine della fase di lisi.

N G. cichoracearum conidi rimasta intatta dopo la procedura di macinazione a palle nella fase 1.3. Per ottenere buone rese di alto peso molecolare DNA genomico, è fondamentale che la parete cellulare fungina è interrotta durante questa fase. integrità conidi può essere valutata al microscopio, e ulteriore macinazione a palle o metodi alternativi di interruzione può essere richiesta per altre specie fungine.

Alcuni conidi fungine, in particolare la sp Blumeria., Contengono pigmenti che possono CONTaminate estrazione e purificazione del DNA tentativi. In questi casi, si consiglia includente la fase di filtrazione DNA come descritto nella Bourras et al. (2015), il protocollo 19 ed una fase di lavaggio supplementare con TE dopo la fase di filtrazione. L'aggiunta della fase di filtrazione ha comportato un piccolo ma significativo aumento degradazione del DNA, e dovrebbe essere incluso solo se eccessiva pigmentazione rimane dopo la seconda fase di precipitazione del DNA. Questi pigmenti, se consentito di rimanere in soluzione, possono interferire con la successiva analisi della qualità e della quantità di DNA e potrebbero potenzialmente interferire con reazioni di sequenziamento.

Questo protocollo include sia una fase di elettroforesi su gel di agarosio tradizionale ed una fase gel elettroforesi campo pulsato. Il primo è una valutazione iniziale della frazione di DNA che è> 20 kbp e la frazione che viene eseguito come una macchia a <20 kb. Ai fini delle reazioni di sequenziamento a valle richiesto per mil farinosagenomi rugiada, la frazione di DNA <20 kbp dovrebbe essere minimo (vedi figura 1, corsia 2 rispetto corsia 4). La valutazione gel elettroforesi in campo pulsato fornisce una migliore stima della dimensione come DNA> 20 kbp possono essere separati per dimensione. DNA di> 48,5 kbp è desiderabile per l'uso in reazioni di sequenziamento successive (vedi figura 2, corsia 4).

Il materiale fungino utilizzato in questi esperimenti è stato propagato in camere di crescita e la contaminazione è stata limitata mediante rigidi protocolli di isolamento e controlli del personale. A causa di questo, la contaminazione con altri, non polverosa patogeni muffa era minimo, e sequenziamento della regione ITS amplificato utilizzando primer specifici funghi recuperati solo G. sequenze cichoracearum. Questo non può essere il caso per un mal bianco raccolti da siti di campo o serre privi gli stessi controlli di isolamento, e la valutazione di contaminazione in queste cases saranno fondamentali per l'assemblaggio dei genomi di alta qualità dal DNA estratto.

Nessuno modifica dei vari protocolli di estrazione del DNA da funghi era unicamente importante. Piuttosto lievi modifiche a molti passi provocato relativamente alte rese di elevato peso molecolare oidio DNA riportata qui.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Purificazione di alto peso molecolare genomico da oidio per lungo-Read Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter