Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

긴 읽기 시퀀싱에 대한 흰가루병에서 높은 분자량의 게놈의 DNA의 정제

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

분체 곰팡이 곰팡이는 경제적으로 중요한 곰팡이 식물 병원균의 그룹입니다. 상대적으로 작은 인해 잘 발달 된 유전자와 게놈 자원의 부족 부분에 분자 생물학 및 병원체의 유전에 대한 알려져있다. 이 생물의 게놈 시퀀싱 및 조립 엄청나게 어려운 만든 대형, 반복적 인 게놈을 가지고있다. 여기서는 하나의 흰가루병 종 Golovinomyces cichoracearum에서 고 분자량의 게놈 DNA의 수집, 추출, 정제 및 품질 관리에 대한 평가 방법을 설명한다. 기술 된 프로토콜은 최적화 된 페놀 / 클로로포름 게놈 DNA를 추출하여 포자의 기계적 파괴를 포함한다. 전형적인 수율은 150 mg을 분생 당 7 μg의 DNA에 있었다. 이 절차를 이용하여 분리 된 게놈 DNA는 긴 판독 순서 (즉,> 48.5 KBP)에 적합하다. 품질 관리 대책이 게놈 DNA의 크기, 수율 및 순도를 보장하기 위해 또한이 방법에 기재된. 여기에 설명 된 품질의 게놈 DNA의 염기 서열은 조립 및 차례로 더 나은 이해로 이어질 것입니다 여러 흰가루병 유전체의 비교를이 농업 병원균의 제어를 개선합니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

흰가루병은 가지 의무적 biotrophic 곰팡이 식물의 그룹이 함께 할 때, 식물 병 전 세계적으로 하나의 가장 큰 원인, 즉 병원균이다. 분류 학적으로 가족 Erisyphaceae 2에서 다섯 개 종족으로 분류 된 흰가루병의 900 설명 종있다. 경제적 중요성과 그들의 호스트와 개발 친밀한 관계를 모두 인해, 흰가루병 질환> 100 년 연구의 대상이되어왔다. 감염시, 흰가루병이 병원균 혜택을, 세포의 구조, 신진 대사와 그 호스트의 분자 생물학의 급격한 변화를 유도. 그러나, 흰가루병의 연구는 그들의 가지 의무적 라이프 스타일, 그리고 순수 문화에 곰팡이의 성장은 아직 5, 4, 3에 설명되지 않은에 특히 도전,"외부 참조"> 6, 7, 8. 과도 변환이 어떤 종 9, 10에보고되었지만 흰가루병의 신뢰성, 안정적인 유전자 변형은 아직 완성되지 않았습니다.

흰가루병 게놈의 염기 서열 및 조립으로 인해 게놈 자체의 기능들이 어려운 입증했다. 다른 진균 유전체로 - (180 MBP 120) 기준으로 60 구성 - 흰가루병 게놈이 크고 90 % 고르게 분포 반복 소자 (11). 이러한 요소는 비 긴 말단 반복뿐만 아니라 분류 중복 요소를 포함한다. 하나의 흰가루병 종, Blumeria 그라 미니 f를formae SPECIALES. SP. hordei 및 F. SP. 소맥 (년 Bgh 각각 BGT)뿐만 아니라 포도 흰가루병에 에리시 페 necator, 꿀벌이N 서열, 및 다른 여러위한 초안 게놈은 12, 13, 14을 완성 하였다. 게놈의 반복적 인 특성은 조립 어렵게 있으며, 완성 된 게놈 년 Bgh 2의 L50 메가 12 6,989 supercontigs로 조립 하였다.

큰 게놈에도 불구하고, 흰가루병은 각각 년 BghBGT 예측 5845 개 및 6540 유전자, 단백질 코딩 유전자의 수가 적은 것으로 보인다. 시퀀싱 흰가루병은 생존 11, 12, 13, 14 그들의 숙주 식물에 진균의 의존성과 일치 다른 진균류에 필수적인 최소한 99 핵심 유전자 결여 보인다.

텔로미어, 중심절 리보솜 RN 근처 반복 서열유전자 배열과 전이 될 풍부한 영역이 제대로 짧은 판독 시퀀싱 전략 조립 및 언더 표현 게놈 어셈블리 (15)에 종종있다. 이러한 영역은 게놈 서열에서 발생하는 공극의 많은 책임을 생각하고, 이것이 반복 요소 (16)의 그 광범위한 팽창으로 흰가루병에 적용된다. 높은 플라스틱 게놈 영역은 종종 반복적 인 지역 3에서 발견된다. 이들은 염색체 재 배열 사이트로서 기능하고 종종 이펙터 단백질을 코딩하는 유전자 및 이차 대사 효소를 코딩하는 유전자와 같은 강력한 선택 압력하에 유전자를 인코딩한다. 단일 분자 긴 읽기 시퀀싱 기술의 발전은 유전체 (15)의 반복적 인 지역에 걸쳐 순서에 대한 잠재적 인 솔루션을 제공합니다. 예를 들어, Faino 등. (2015)을 포함하여 긴 시퀀스 기술과 광 m 읽어 발견apping 유전자 주석 유전자 주석의 수를 증가 (및 일부의 수를 감소 시키거나 누락 게놈의 반복 DNA 서열의 비율 배로 그들을 곰팡이 병원균 Verticillium 달리아 두 균주 갭리스 게놈 시퀀스를 생성하도록 허용 ) 및 계시 게놈 17 재구성.

최소 크기> 20 KBP 이러한 긴 읽기 시퀀싱 기술, 고품질의 게놈 DNA의 높은 농도를 사용하려면 필요하다. 여기에서 우리는 분생 포자로부터 포자 수집, 고 분자량의 DNA의 정제를위한 우리의 방법을 설명하고 흰가루병 종 Golovinomyces cichoracearum를 사용하여 우리의 품질 관리 평가는 오이 (18)에 성장. 이 프로토콜은 켈러 B. 실험 그룹 (쮜리히 대학, 스위스 취리히) (13), (19)에서 개발 된 프로토콜에 기초증가 DNA 수율 주도 여러 변형 및 크기의 DNA> 48.5 KBP의 높은 비율을 포함한다. 이 프로토콜은 또한 연구소 20, 21, 22 에너지 공동 게놈의 미국학과의 추천에 따라 품질 관리 단계를 포함한다.

용해 완충액에 포함 된 각 시약 및 각 정제 단계에 근거하는 기능 등 (2008) 23 헨리에 기재되어있다. 식물과 미생물 조직에서 고 분자량 게놈 DNA의 분리에 사용할 수 게시 된 프로토콜은 또한이 프로토콜 24, 25, 26, 27, 28의 설계시 협의했다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

곰팡이 재료 1. 준비

  1. 흰가루병 성장
    1. 다음의 조건으로 성장 챔버에 식물을 성장 : 22 ° C 일 온도 20 ℃ 밤 온도, 80 % 상대 습도, 14 시간 낮 길이 125 μE / m 2 / s의 광 강도 (형광등에 의해 제공된 ).
    2. 18, 29 설명 Golovinomyces cichoracearum 변형 UCSC1 오이 식물 (쿠쿠 미스 사티의 다양한 부시 챔피언) 감염.
  2. 수확 흰가루병 분생 포자
    1. 생포 축적 된 인 - 라인 필터 (11 μm의)와 작은 진공을 이용하여 접종 10 일 - 7에 감염된 식물을 수확 분생. 부드러운 압력을 적용, 분생 포자를 수집하는 잎의 표면을 따라 진공 노즐을 실행합니다.
      참고 : G.의 cichoracearum의 평균 수익률은 크게 infe에서 분생 포자의 20 밀리그램이다면적이 약 130cm 2 cted 오이 잎.
    2. 깨끗한 종이 상에 필터로부터 (7-8 감염된 오이 잎으로부터 약 375 μL 부피 또는 분생) 분생 포자 약 150 mg의 브러시. 여기에서, (액체 질소)에서 미리 냉각 두 32분의 5 인치 직경의 스틸 밀링 볼 2 mL의 크리오 바이알 (cryovial)의 분생 포자로 옮긴다. 즉시 액체 질소로 튜브를 반환한다. -80 ° C에서 보관 튜브.
  3. 볼 밀링에 의해 속보 열기 분생 포자
    1. 플래시를 액체 질소 중에서 볼밀 알루미늄 판을 고정. 로드는 볼 밀 랙에 크리오 바이알 (cryovial). 격렬 (실온) 30 회 / 초에서 30 초 동안 볼 밀에서 분생 스틸 볼과 크리오 바이알 (cryovial)을 흔들어. 즉시 액체 질소에서 재 냉동을 크리오 바이알 (cryovial).
      참고 : 처음에, 연마하는 동안 세포 벽 파열의 효율을 100 배 배율에서 현미경으로 분생 포자의 샘플을 액세스 할 수 있습니다. 30 회 / 초, B 30의 2 라운드 - 필요한 경우, 추가로 1 갈기유타는 최소로 라운드의 수를 유지한다. 최적의 조건이 성립 된 후,이 단계에서 현미경으로 포자 파손 평가 루틴은 불필요하다.

2. 게놈 DNA 정제

  1. 분생 포자 용해
    1. 빨리 작업, 해동 분생 포자를 방지 자석 크리오 바이알 (cryovial)에서 강구를 제거합니다. 슬러리가 형성 될 때까지 10 초 - 65 μL 700 ° C의 용해 완충액 (표 1) 및 선회 (5)를 추가한다.
    2. 300 μL (65 °의 C) 예열 된 5 % (v / v)의 sarcosyl 추가 부드럽게 섞어 다섯 번 (3 초 당 1 개 반전) 반전. 65 ° C에서 30 분 동안 인큐베이션 튜브; 10, 20, 30 분에서 3 시간 온화하게 반전. 넓은 구멍 피펫 팁을 사용하여, 새로운 2 ML의 마이크로 원심 튜브에 전 용액을 옮긴다. 이후의 모든 단계에서, 부드럽게, 천천히 반전에 의해 혼합 넓은 구멍 피펫 팁으로 DNA 함유 솔루션을 전송합니다.
  2. DNA 추출 I
    1. 클로로의 1 볼륨을 추가성상 : 이소 아밀 알코올 : 부드럽게 용해 용액 (24 1 V / V)과 5 회 혼합 바꾸. 부드럽게 배양의 끝에서 다시 중간 지점에서 다섯 번을 혼합하는 반전, 실온에서 10 분 동안 품어. 14,000 × g에서 15 분 동안 실온에서 원심 분리기. 넓은 구멍 피펫 팁을 사용하여 조심스럽게 새로운 2 ML의 마이크로 원심 튜브에 수성층을 전송; 계면으로부터 재료를 포함하는 피.
  3. DNA 강수량 I
    1. 1 볼륨 실온 100 % 이소프로판올 (약 750 μL)을 추가하고 부드럽게 여섯 번 섞어 반전. 14,000 × g에서 15 분 동안 실온에서 원심 분리기. 조심스럽게 상층 액을 제거하고 폐기합니다.
    2. 450 μL 사전 냉장 (-20 ° C) 70 % 에탄올을 추가합니다. 14,000 × g으로 실온에서 5 분 동안 원심 분리기. 조심스럽게 상층 액을 제거하고 폐기합니다. 조심스럽게 미세 피펫 팁으로 뜨는을 제거하고 폐기, 3 초 동안 1,000 XG에서 원심 분리기. 15 분 A의 펠릿을 공기 - 건조t 실온. 15 분 이상 건조하지 마십시오.
    3. 300 μL TE의 펠릿 (10 mM 트리스 - (CL), 1mM의 에틸렌 디아민 테트라 아세트산의 pH 8.0)에 재현 탁. 4 ℃에서 밤새 인큐베이션. 부드럽게 솔루션에 가지 않았다 잔여 물질을 재 부유 버려.
  4. , RNA 오염 제거 10 μL의 RNase A (10 ㎎ / ㎖)을 첨가한다. 부드럽게 세 번을 섞어 반전. 3 초 동안 1,000 XG에서 원심 분리기. 2 시간 동안 37 ℃에서 인큐베이션.
  5. DNA 추출 II
    1. 300 μL를 페놀 추가 : 클로로포름 : 이소 아밀 알코올 (25 : 24 : 1 v / v)로 부드럽게 다섯 번을 섞어 반전. 부드럽게 배양의 끝에서 다시 중간 마크에서 다섯 번을 혼합하는 반전, 실온에서 10 분을 품어. 14,000 × g으로 실온에서 15 분간 원심 분리기. 넓은 구멍 피펫 팁을 사용하여, 새로운 1.5 ㎖의 마이크로 원심 튜브에 상기 상층 액을 전송.
  6. DNA 강수량 II
    1. 0.01 부피 3 M 아세트산 나트륨 pH를 5.2 (approximatel 추가Y 3 μL), 부드럽게 다섯 번을 섞어 반전. 2.5 볼륨 사전 냉장 (-20 ° C) 100 % 에탄올 (약 750 μL)를 추가합니다. 부드럽게 다섯 번을 섞어 반전. -20 ℃에서 하룻밤 품어
    2. 원심 분리기에서 14,000 × g에서 4 ℃에서 30 분. 조심스럽게 상층 액을 제거하고 폐기합니다.
    3. 450 μL 사전 냉장 (-20 ° C) 70 % 에탄올을 추가합니다. 14,000 × g에서 4 ℃에서 5 분 동안 원심 분리기. 조심스럽게 상층 액을 제거하고 폐기합니다. 3 초 동안 1,000 XG에서 원심 분리기. 조심스럽게 미세 피펫 팁 및 폐기에 뜨는을 제거합니다.
    4. 실온에서 30-60 분 동안 펠렛을 공기 - 건조. 27.5 μL TE의 펠렛을 재현 탁. 4 ℃에서 밤새 인큐베이션. 부드럽게 솔루션에 가지 않았다 잔여 물질을 재 부유 버려.
    5. 분취 품질 관리 시험 22.5 μL TE (최종 부피 25 μL)에 2.5 μL (아래 참조). 시퀀싱을 위해 제출 될 때까지 4 ℃에서 저장 DNA 샘플. 장기 보관, 저장 샘플의 경우및 -80 ° C에서 전단을 방지하기 위해 동결 - 해동 사이클을 최소화 할 수 있습니다.
      참고 : 제대로 피펫 어려울 수있다 고 분자량 게놈 DNA로이 단계에서 피펫 팅 할 때주의하십시오, "QC 나누어은"게놈 DNA 샘플의 정확한 표현인지 확인하는 것이 중요하다.

3. 품질 관리

  1. 샘플 순도
    1. TE에 빈을 사용하여, 작은 볼륨 분광 광도계에 QC 나누어지는 1 μL를로드하여 DNA의 샘플 순도를 평가합니다. 기록 A260 / A280 및 A260 / A230 수치. 순수한 DNA는 1.8과 2.2 사이에 약 1.8 A260 / A230의 비율 A260 / A280 비율을 가질 것이다.
  2. 게놈 DNA의 정량화
    1. 제조업체의 지침에 따라 상업 이중 가닥 DNA 정량 분석 ​​키트를 사용하여 품질 관리 나누어의 정량화를 수행합니다.
  3. DNA 품질 평가 I
    1. 부하 약 60 ng의 게놈 DNA 및1X TAE (40 개 mM 트리스, 20 mM의 아세트산 및 1 mM의 EDTA, pH를 8.0)에 0.7 % 아가 로즈 겔상에서 DNA 사다리. 70 V 40 겔 실행 장치 - 게놈 DNA 밴드까지 45 분 정도 사다리에서 잘 분리 대역에서 2cm이다 명백하다. 이러한 조건은 가능한 겔 전기 영동 장치에 기초하여 조절 될 필요가있다.
  4. DNA 품질 평가 II
    1. 부하는 약 60 0.5X의 TBE (44.5 mM 트리스, 445 mM의 붕산, 1 mM의 EDTA, pH를 8.3) 및 1 % 아가 로스 겔상에서 게놈 DNA 및 (펄스 필드 겔 전기 이동에 적합) 고 분자량 DNA 사다리 겨 16 시간 동안 80 KBP 파형 펄스 필드 겔 전기 프로토콜 - 5을 사용하여 0.5X TBE를 실행하는 버퍼에서 실행.
  5. 세균, 곰팡이 및 공장 오염 물질의 평가
    1. 프라이머 및 증폭 조건을 이용리스트 리보솜 유전자의 적절한 전사 내부 스페이서 (ITS) 영역을 증폭하는 중합 효소 연쇄 반응 (PCR)을 수행표 2에 에드. 겔에서 얻어진 반응 하중 10 μL.
      참고 : ITS 지역 ITS 프라이머 곰팡이로 증폭해야 흰가루병을 나타내는 밴드. 이 앰플 리콘 및 세균 또는 식물 프라이머로부터 생성 된 앰플 리콘 DNA는 오염의 근원을 결정하기 위해 서열화한다. 만 흰가루병은 ITS 시퀀스는 곰팡이의 증폭에서 찾을 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

G.로부터 정제 된 게놈 DNA를 60ng의 대표적인 예는 겔 전기 영동을 사용하여 아가로 오스 겔상에서 실행 cichoracearum 및 펄스 필드 겔 전기 영동을 사용하는 각각도 1 및도 2에 나타낸다. 소폭 통과하고 품질 관리를 실패 패스 게놈 DNA 제제를 나타낸다. 완벽한 품질 관리를 통과 게놈 DNA의 준비는 긴 읽기 게놈 시퀀싱 방법을 사용하여 시퀀싱에 이상적입니다. 가장자리 품질 제어를 전달 제제는 허용하지만, 충분히 전달 제제가 바람직하다. 품질 관리 실패 준비는 긴 읽기 게놈 시퀀싱 방법에 대한 허용되지 않습니다.

그림 1
도 1 : 정제 된 게놈 DNA의 아가 로스 겔 전기 영동. 레인 1 : 레인 2 : 품질 관리를 통과 게놈 DNA; 레인 3 : 한계 간주 게놈 DNA; 및 레인 4 : 게놈 DNA는 품질 관리를 실패한. 허용 가능한 한계 및 게놈 DNA 샘플은 단일 밴드 <20 KBP에서 최소한의 번짐 20 KBP 상기 실행있다. 품질 제어를하지 게놈 DNA 샘플은 20 이하 KBP 번짐 있고, 약 100 bp의 (*) 저 분자량의 단편을 포함 할 수있다. 펄스 필드 겔 전기 영동으로 허용 한계 DNA 샘플을 구별 할 필요가있다. 에티 디움 브로마이드 게놈 DNA를 시각화하기 전에 전기 겔에 첨가 하였다. 샘플을 50 분 동안 60 V에서 전기 영동 하였다. 겔을 겔 문서 시스템을 사용하여 UV 광 하에서 촬상 하였다.

그림 2
그림2, 펄스 필드 겔 전기 이동 흰가루병 정제 게놈 DNA의 (PFGE). 레인 1 : 분자량 표준, 48.5 KBP에서 가장 높은 밴드와 8.1 KBP에서 가장 낮은. 레인 2, 5 (젤 이미지 하단) 20, 10, 7, 5, 4, 3, 2, 1.5 KBP의 대역을 나타내는, 분자량 표준. 레인 3 : 한계 DNA 샘플 크기 (20)와 48.5 KBP 간 DNA의 대다수. 레인 4 : 허용 DNA 샘플은 DNA> KBP 48.5 (*)의 대다수. 샘플을 5-80 KBP PFGE 파형 프로그램을 사용하여 15 시간, 75 V에서 작동시켰다. DNA 염색 염료 전기 영동 후 겔에 첨가하고, 겔은 겔 문서 시스템을 사용하여 UV 광 하에서 촬상 하였다.

시약 최종 농도
칼륨 metabisulfite (K 2 S 2 O 5) 0.25 M
트리스 버퍼 pH 7.5 0.2 M
에틸렌 디아민 테트라 아세트산 (EDTA) 50 mM의
염화나트륨 2 M
세틸 트리메틸 암모늄 브로마이드 (CTAB) 2 % V / V를

표 1 : 용해 완충액의 제조. DH O. 2와 5 ㎖의 부피로 가져와

목표 프라이머 이름 프라이머 시퀀스 TM (° C) 예상 제품 크기 (BP)
곰팡이 ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61.3 (336)
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
세균의 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63.8-66.5 (331)
RV (805R) GGACTACHVGGGTWTCTAAT 46.9-53.8
세균 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60.8-66.5 (450)
RV (926R) CCGYCAATTYMTTTRAGTTT 43.9-53.8
곰팡이 18S V4 FW CCAGCASCYGCGGTAATTCC 58.7-61.5 (431)
RV ACTTTCGTTCTTGATYRA 43.2-48.3
쿠쿠 미스 sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 (750)
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

표 2 : 오염 평가를위한 프라이머.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

가지 의무적 biotrophic 흰가루병 균 순수한 고 분자량의 게놈 DNA를 얻기 위해, 전술 한 방법의 변형 된 버전 (30)를 개발 하였다. 이 최적의 프로토콜을 이용하여 평균 수율은 150 mg의 분생 당 7 μg의 DNA를, 종래의 프로토콜로 얻어진 수율의 두배이다. 또한, 평균 크기는 48.5 KBP에 걸쳐 약 20 KBP에서 증가했다. 이 프로토콜은 cucumber- G.의 cichoracearum 시스템에 최적화되었다. biotrophic 곰팡이를 다른 흰가루병에서 최고의 품질과 높은 순도의 DNA를 얻거나 의무를하기 위해이 프로토콜의 추가 수정이 필요할 수 있습니다. 추가 수정이 요구 될 수 있지만 나중에,이 프로토콜은, 다른 가지 의무적 biotrophic 곰팡이로부터 판독 긴 DNA 서열에 대한 고 분자량의 DNA가 적절한 획득하는데 사용될 수있다.

우려가 높은 수율 DNA 추출 DNA의 높은 분자량을 분산시켰다이 프로토콜의 최적화 동안. 텍싱 포함하는 단계는 DNA의 전단을 최소화하기 위해 생략하고, 부드럽게 역 혼합하여 대체되었다. 이러한 변화는 현저 수율을 저하시키지 않고, 추출 된 DNA의 품질을 증가. 용해 공정이 끝날 때까지 용액에 볼을 이탈에 비해 또한 처음에 강구를 제거하여 세포 용해 단계는 크게 DNA 수율을 증가.

어떤 G.의 cichoracearum의 분생 포자 단계 1.3에서 볼 밀링 절차 후 그대로 유지합니다. 고 분자량 게놈 DNA의 좋은 수율을 얻으려면, 곰팡이 세포벽이 단계에서 중단 될 것이 중요합니다. 포자 무결성 현미경으로 평가 될 수 있으며, 추가로 볼 밀링 또는 중단의 다른 방법은 다른 곰팡이 종 필요할 수 있습니다.

일부 곰팡이 분생 포자, 특히 Blumeria SP에., 계속 할 수 안료를 포함aminate DNA의 추출 및 정제를 시도한다. 이 경우, 우리는 Bourras 등에 설명 된대로 DNA 여과 단계를 포함하는 것을 권장합니다. (2015) 프로토콜 (19) 및 여과 공정 후의 TE로 추가 세척 단계. 여과 공정의 추가 DNA 저하 작지만 상당한 증가를 초래하고 과다 색소 번째 DNA 침전 단계 후에 남아있는 경우에만 포함될 것이다. 용액 상태를 유지하도록 허용 된 경우에는 이러한 안료는 DNA의 양과 질 이후 분석을 방해 할 수있는 잠재적 시퀀싱 반응을 방해 할 수있다.

이 프로토콜은 기존의 아가로 오스 겔 전기 영동 단계와 펄스 필드 겔 전기 영동 단계가 모두 포함됩니다. 첫 번째는> 20 KBP 및 <20 KBP에서 스미어로 실행 분획 인 DNA의 비율의 초기 평가한다. 가루 만 달러에 필요한 하류 시퀀싱 반응의 목적슬 게놈, DNA의 일부는 <20 KBP는 (도 1, 레인 4 레인 2 참조)를 최소화한다. 펄스 필드 겔 전기 영동하여 크기 평가는 분리 될 수있는 DNA> 20 KBP 같은 크기의 더 나은 추정을 제공한다. > 48.5 KBP의 DNA 서열은 후속 반응 (레인 4,도 2 참조)에 사용하는 것이 바람직하다.

이 실험에 사용 된 곰팡이 물질은 성장 챔버에 전파되고 오염은 엄격한 분리 프로토콜과 인사 컨트롤을 사용하여 제한되었다. 이 때문에, 다른 비 흰가루병 병원균 오염을 최소화이고, ITS 영역의 염기 서열은 진균 특이 적 프라이머 만 G. cichoracearum의 서열을 회수하여 증폭. 이것은 이러한 CAS의 필드 사이트 또는 같은 분리 컨트롤을 결여 온실에서 수집 흰가루병에 대한 경우, 오염 평가하지 않을 수 있습니다ES는 추출 된 DNA로부터 고품질 게놈의 조립에 중요 할 것이다.

다양한 곰팡이 DNA 분리 프로토콜 아무도 수정은 유일하게 중요하지 않습니다. 오히려 많은 단계에서 약간의 변형이 여기에보고 고분자 흰가루병 DNA의 비교적 높은 수율의 결과.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
긴 읽기 시퀀싱에 대한 흰가루병에서 높은 분자량의 게놈의 DNA의 정제
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter