Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Purificação de DNA de alto peso molecular genômico de oídio de longo Read Sequencing

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

Os fungos de oídio são um grupo de economicamente importantes agentes patogénicos fúngicos de plantas. Relativamente pouco se sabe sobre a biologia molecular e genética de estes agentes patogénicos, em parte devido à falta de recursos genéticos e genómicos bem desenvolvidos. Estes organismos possuem grandes genomas, repetitivas, que fizeram a sequenciação e montagem do genoma proibitivamente difícil. Aqui, nós descrevemos métodos para a avaliação de recolha, a extracção, purificação e controle de qualidade de ADN genómico de elevado peso molecular a partir de espécies de míldio em pó, um Golovinomyces cichoracearum. O protocolo descrito inclui ruptura mecânica de esporos seguido por uma extracção de ADN genómico optimizado fenol / clorofórmio. Um rendimento típico foi de 7 g de ADN por 150 mg de conídios. O ADN genómico que é isolado utilizando este procedimento é adequado para a sequenciação de leitura longa (isto é,> 48,5 kpb). medidas de controlo de qualidade para assegurar o tamanho, rendimento e a pureza do ADN genómico são igualmentedescrito neste método. A sequenciação do ADN genómico da qualidade descrito aqui vai permitir a montagem e a comparação dos múltiplos genomas de oídio, que por sua vez irá conduzir a uma melhor compreensão e uma melhor controle deste patogénio agrícola.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Oídios são um grupo de obrigatório planta fúngico biotrófica agentes patogénicos que, quando tomados em conjunto, são a maior causa de doenças de plantas em todo o mundo 1. Existem mais de 900 espécies descritas de oídio, que foram taxonomicamente agrupadas em cinco tribos dentro da família Erisyphaceae 2. Devido tanto à sua importância econômica e a íntima relação que desenvolvem com seus anfitriões, doenças de oídio foram objecto de investigação por> 100 anos. Após a infecção, oídio provocar mudanças drásticas na estrutura celular, metabolismo e biologia molecular de seus hospedeiros, para beneficiar deste patógeno. No entanto, o estudo de oídios é particularmente difícil devido ao seu estilo de vida obrigatória, e o crescimento do fungo em cultura pura ainda não foi descrito 3, 4, 5,"xref"> 6, 7, 8. Reliable transformação, estável genética de oídios ainda não foi também conseguida, embora a expressão transiente tem sido relatada em algumas espécies 9, 10.

O sequenciamento e montagem de genomas oídio tem sido difícil devido a uma série de características do próprio genoma. Genomas oídio são grandes (120-180 MBP) em relação a outros genomas de fungos, e consistem em 60 - 90% de elementos repetitivos uniformemente distribuídas 11. Estes elementos incluem repeties terminais longas não, bem como elementos repetitivos não classificadas. Dois speciales formae de uma única espécie de oídio, Blumeria graminis f. sp. hordei e f. sp. tritici (BGH e Bgt, respectivamente), bem como o míldio pulverulento da uva Erysiphe necator, têm abelhan sequenciado, e os projectos de genomas de vários outros foram concluídos 12, 13, 14. A natureza repetitiva dos genomas fez montagem difícil, e o genoma Bgh completada foi montado em 6.989 supercontigs com um L50 de 2 Mb 12.

Apesar do grande genoma, os míldios pulverulentos parecem ter um pequeno número de genes que codificam proteínas, com 5.845 e 6.540 genes previstos em Bgh e Bgt, respectivamente. Os oídios sequenciados também parecem carecer de pelo menos 99 genes principais que são essenciais em outros fungos, o que é consistente com a dependência dos fungos na sua planta hospedeira para a sobrevivência de 11, 12, 13, 14.

seqüências repetitivas perto telômeros, centrômeros, RN ribossomalA matrizes e as regiões enriquecidas em elementos transponíveis de genes são mal montada a partir de estratégias de sequenciação de curto-ler e são frequentemente sub-representados em conjuntos de 15 genoma. Tais regiões são pensados para ser responsável por muitas das lacunas que ocorrem em sequências do genoma, e isto aplica-se aos míldios pulverulentos, com o seu grande expansão de elementos repetitivos 16. Altamente regiões do genoma de plástico são freqüentemente encontrados nessas regiões repetitivas 3. Eles servem como um local de rearranjos de cromossomas e muitas vezes codificam genes sob forte pressão selectiva, tais como os genes que codificam para proteínas efectoras e os genes que codificam as enzimas do metabolismo secundário. Advances in única molécula de tecnologias de sequenciação de leitura longa fornecer uma solução potencial para a sequenciação através das regiões repetitivas de genomas 15. Por exemplo, Faino et al. (2015) verificaram que a inclusão de sequência de leitura longa e tecnologias m ópticoapping lhes permitiu produzir uma sequência de genoma lacuna-menos para duas estirpes de planta fúngico patógeno dália Verticillium, triplicando a proporção de sequências repetitivas de ADN no genoma, aumentando o número de notas de genes (e a redução do número de parcial ou ausente anotações gene ) e revelador genoma rearranjos 17.

Para empregar estas tecnologias de sequenciamento de leitura longa, altas concentrações de DNA genômico de alta qualidade, com o mínimo de tamanhos> 20 kbp, são necessários. Descrevemos aqui os nossos métodos para a recolha de conídios, purificação de DNA de alto peso molecular a partir de conídios e nossas avaliações de controlo de qualidade utilizando as espécies de oídio Golovinomyces cichoracearum cultivadas em pepino 18. Este protocolo baseia-se num protocolo desenvolvido no laboratório grupo B. Keller (Universidade de Zurique, Zurique Suíça) 13, 19e inclui várias modificações que levaram ao aumento da produção de ADN e uma proporção mais elevada de ADN de> 48,5 kpb em tamanho. O protocolo também inclui etapas de controle de qualidade com base nas recomendações do Departamento de Estados Unidos da Joint Genome Institute Energia 20, 21, 22.

A função de cada um dos reagentes incluídos no tampão de lise, e a razão para cada passo de purificação, são como descrito em Henry (2008) 23. Disponíveis protocolos publicados para o isolamento de DNA de alto peso molecular genómico a partir de tecidos de plantas e microbianas foram também consultados durante a concepção deste protocolo 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparação do material Fúngica

  1. Crescer Oídio
    1. Cultivar plantas em câmaras de crescimento com as seguintes condições: 22 ° C dia temperatura, 20 ° C Temperatura de noite, 80% de humidade relativa, 14 h duração do dia e uma intensidade de luz de 125 μE / m 2 / s (fornecida pela iluminação fluorescente ).
    2. Infectar plantas de pepino (Cucumis sativa variedade de Bush Champion) com Golovinomyces cichoracearum UCSC1 estirpe como descrito 18, 29.
  2. Colheita Oídio conídios
    1. Colheita conídios de plantas infectadas em 7 - 10 dias após a inoculação com um pequeno vácuo com um filtro em linha (11? M) na qual os conídios acumular. Aplicando uma pressão suave, executar a tubeira de vácuo ao longo da superfície da folha de recolher os conídios.
      NOTA: O rendimento médio de G. cichoracearum é de 20 mg de conídios de um fortemente INFECTED folha de pepino de cerca de 130 cm2 de área.
    2. Escova de cerca de 150 mg do conídios (aproximadamente uL de volume 375, ou conídios de 7-8 folhas de pepino infectadas) a partir do filtro sobre uma folha de papel limpa. A partir daqui, transferir conídios em 2 mL criotubos com diâmetro dois 5/32 polegadas pré-arrefecida (em azoto líquido) bolas de moagem aço. voltar imediatamente para tubos de azoto líquido. tubos de armazenar a -80 ° C.
  3. Breaking Open conídios por moagem
    1. Flash congelar placas de alumínio de moinho de esferas em azoto líquido. Carga criotubos em rack de moinho de bolas. Agitar vigorosamente os criotubos com bolas de aço e conídios em moinho de bolas durante 30 s a 30 ciclos / s (à temperatura ambiente). recongelar imediatamente criotubos em azoto líquido.
      NOTA: Inicialmente, acesso a uma amostra de conídios por microscopia uma ampliação de 100X para a eficiência de ruptura da parede celular durante a moagem. Se necessário, para moer um adicional de 1 - 2 ciclos de 30 s durante 30 ciclos / s, but manter o número de rodadas a um mínimo. A avaliação de rotina de quebra de conídios por microscopia nesta fase é desnecessária uma vez que foram estabelecidas condições ideais.

2. Purificao de ADN genómico

  1. conídios de lise
    1. Trabalhar rapidamente para evitar o descongelamento conídios, remover as bolas de aço de criotubos com um ímã. Adicionar 700 uL de 65 ° C, tampão de lise (Tabela 1) e vórtice 5 - 10 s até uma suspensão é formada.
    2. Adicionar 300? L pré-aquecido (65 ° C) 5% (v / v) de sarcosil e inverter cuidadosamente para misturar (uma inversão por 3 s) cinco vezes. Incubar os tubos durante 30 min a 65 ° C; invertido suavemente 3 vezes em 10, 20 e 30 min. Utilizando uma ponta de pipeta de amplo calibre, transferir a solução inteira para novo tubo de microcentrifugação de 2 ml. Em todos os passos subsequentes, misturar por inversão suave, lento e transferir as soluções contendo ADN com pontas de pipeta de grande calibre.
  2. Extração de DNA I
    1. Adicionar um volume de cloroforma: álcool isoamílico (24: 1 v / v) para a soluo de lise e inverter cuidadosamente para misturar cinco vezes. Incubar durante 10 minutos à temperatura ambiente, invertendo suavemente para misturar cinco vezes no ponto a meio caminho e novamente no final da incubação. Centrifuga-se a temperatura ambiente durante 15 min a 14.000 x g. Usando ampla-furo ponta de pipeta, transferir cuidadosamente a fase aquosa para um novo tubo de microcentrifugação de 2 ml; evitar a inclusão do material da interface.
  3. DNA Precipitation I
    1. Adicionar um volume de temperatura ambiente a 100% de isopropanol (cerca de 750 mL) e inverter cuidadosamente para misturar seis vezes. Centrifuga-se a temperatura ambiente durante 15 min a 14.000 x g. Remova cuidadosamente o sobrenadante e descartar.
    2. Adicionar 450 mL de pré-refrigerada% de etanol (-20 ° C) 70. Centrifugar durante 5 min à temperatura ambiente a 14000 x g. Remova cuidadosamente o sobrenadante e descartar. Centrifugar a 1.000 xg durante 3 s, remover cuidadosamente o sobrenadante com uma pipeta de ponta fina e descartar. Secar o sedimento durante 15 minutos, umatemperatura ambiente t. Não secar por mais de 15 min.
    3. Ressuspender o sedimento em 300 ul de TE (10 mM Tris-Cl, ácido etilenodiaminotetra-acético 1 mM, pH 8,0). Incubar durante a noite a 4 ° C. Agite suavemente para voltar a suspender qualquer material residual que não entrar em solução.
  4. Para eliminar a contaminação de ARN, adicionam-se 10 ul de ARNase A (10 mg / mL). Inverta suavemente para misturar três vezes. Centrifugar a 1.000 xg durante 3 s. Incubar a 37 ° C durante 2 h.
  5. Extracção de DNA II
    1. Adicionar 300 ul de fenol: clorofórmio: álcool isoamílico (25: 24: 1 v / v) e inverter cuidadosamente para misturar cinco vezes. Incubar 10 min a temperatura ambiente, invertendo suavemente para misturar cinco vezes a meio caminho e novamente no final da incubação. Centrifugar 15 min a temperatura ambiente a 14000 x g. Utilizando uma ponta de pipeta de amplo calibre, transferir o sobrenadante para um novo tubo de microcentrifugação de 1,5 mL.
  6. ADN Precipitation II
    1. Adicionar 0,01 volume de 3 M de acetato de sódio pH 5,2 (approximately 3 mL), inverter cuidadosamente para misturar cinco vezes. Adicionar 2,5 volumes de pré-arrefecida (-20 ° C) de 100% de etanol (cerca de 750 mL). Inverta suavemente para misturar cinco vezes. Incubar durante a noite a -20 ° C.
    2. Centrifugar 30 min a 4 ° C a 14000 x g. Remova cuidadosamente o sobrenadante e descartar.
    3. Adicionar 450 mL de pré-refrigerada% de etanol (-20 ° C) 70. Centrifugar durante 5 minutos a 4 ° C a 14000 x g. Remova cuidadosamente o sobrenadante e descartar. Centrifugar a 1.000 xg durante 3 s. Remova cuidadosamente o sobrenadante com ponteira fina e descarte.
    4. Secar o sedimento durante 30-60 min à temperatura ambiente. Ressuspender o pellet em 27,5 ul de TE. Incubar durante a noite a 4 ° C. Agite suavemente para voltar a suspender qualquer material residual que não entrar em solução.
    5. Alíquota de 2,5 mL em 22,5 ul de TE (volume final 25 mL) para ensaios de controlo de qualidade (ver abaixo). As amostras de ADN armazenar a 4 ° C até à apresentação para a sequenciação. Para o armazenamento, armazenar amostras a longo prazoa -80 ° C e minimizar a ciclos de congelação-descongelação para evitar distorção.
      NOTA: Tome cuidado ao pipetar nesta etapa como o ADN genómico de elevado peso molecular podem ser difíceis de pipetar adequadamente, e é importante para assegurar que "QC Alíquota" é uma representação precisa da amostra de DNA genómico.

3. Controle de Qualidade

  1. Pureza amostra
    1. Usando um TE em branco, avaliar a pureza da amostra de ADN por carregamento de 1 mL da alíquota QC em um espectrofotômetro de pequeno volume. Registro A260 / A280 e A260 / A230 leituras. ADN puro terá uma razão A260 / A280 de cerca de 1,8 e A260 / A230 razão entre 1,8 e 2,2.
  2. Quantificação do ADN genómico
    1. Realizar a quantificação da alíquota QC usando um kit comercial de cadeia dupla do ADN de ensaio de quantificação de acordo com as instruções do fabricante.
  3. DNA Quality Assessment I
    1. Carga de aproximadamente 60 ng de ADN genómico e umaescada de DNA em um gel de agarose a 0,7% em 1x TAE (Tris 40 mM, ácido acético 20 mM, e EDTA 1 mM, pH 8,0). aparelho de gel executar a 70 V durante 40 - 45 minutos até as bandas de ADN genómico são aproximadamente 2 cm da separação bem e banda na escada é aparente. Estas condições podem necessitar de ser ajustada com base no aparelho de electroforese em gel disponível.
  4. DNA Quality Assessment II
    1. Carga de aproximadamente 60 ng de ADN genómico e uma escada de DNA de peso molecular elevado (adequado para electroforese em gel de campo pulsado) sobre um gel de agarose a 1% em TBE 0,5x (Tris 44,5 mM, ido bico 44,5 mM, EDTA 1 mM, pH 8,3) e executado em tampão de corrida 0,5x TBE usando um 5 - de campo pulsado protocolo de electroforese em gel de 80 kpb da forma de onda durante 16 h.
  5. Avaliação de bactérias, fungos e Contaminantes de plantas
    1. Realizar a reacção em cadeia da polimerase (PCR) para amplificar os espaçadores internos transcritos (ITS) apropriados regiões dos genes ribossomais, utilizando os iniciadores e as condições de amplificação listaed na Tabela 2. Carga de 10 pL da reacção resultante num gel.
      NOTA: Uma banda que representava o oídio região ITS deve ser amplificado com o fúngica SEUS iniciadores. ADN a partir deste amplicão e qualquer amplic gerado com os iniciadores, ou de plantas bacterianas deve ser sequenciado para determinar a origem da contaminação. Apenas oídio sequências ITS deve ser encontrada no amplicon fúngica.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Um exemplo representativo de 60 ng de ADN genómico purificado de G. cichoracearum passado em gel de agarose, utilizando electroforese em gel e usando electroforese em gel de campo pulsado são mostrados nas Figuras 1 e 2, respectivamente. preparações de ADN genómico que passam, marginalmente passam e falham o controlo de qualidade são representados. preparações de ADN genómico que passam completamente o controlo de qualidade são ideais para a sequenciação utilizando abordagens de sequenciação do genoma de leitura longa. Preparações que marginalmente passar o controlo de qualidade são aceitáveis, mas preparações que passam inteiramente são preferidos. Preparações que não controle de qualidade não são aceitáveis ​​por muito tempo de leitura abordagens sequenciação do genoma.

figura 1
Figura 1: Electroforese em gel de agarose de ADN genico purificado. Pista 1: Pista 2: O ADN genómico que passou de controlo de qualidade; Pista 3: ADN genómico que foi considerado marginal; e pista 4: ADN genómico que falhou o controlo de qualidade. amostras de ADN genómico aceitáveis ​​e marginais têm uma única banda de execução acima de 20 kpb com manchas mínima a <20 kpb. As amostras de DNA genómico que não têm controlo de qualidade manchando abaixo de 20 Kpb, e pode incluir fragmentos de baixo peso molecular a cerca de 100 pb (*). electroforese em gel de campo pulsado é necessária para distinguir entre amostras de DNA aceitáveis ​​e marginais. O brometo de etídio foi adicionado ao gel antes da electroforese para visualizar o DNA genómico. As amostras foram sujeitas a electroforese a 60 V durante 50 min. O gel foi fotografado sob luz UV utilizando um sistema de documentação de gel.

Figura 2
Figura2: Gel de Campo Pulsado-(PFGE) de Purificada Oídio de ADN genómico. Pista 1: padrões de peso molecular, com a maior banda a 48,5 kpb e o mais baixo de 8,1 kpb. As pistas 2 e 5: padrões de pesos moleculares, mostrando bandas de 20, 10, 7, 5, 4, 3, 2 e 1,5 kpb (na parte inferior da imagem do gel). Pista 3: uma amostra de ADN marginal, com a maioria do ADN entre 20 e 48,5 kpb em tamanho. Pista 4: uma amostra de ADN aceitável, com a maioria do ADN de> 48,5 kpb (*). As amostras foram corridas a 75 V durante 15 h, utilizando um programa de PFGE forma de onda 5-80 kpb. corante de ADN-coloração foi adicionada ao gel após electroforese e o gel foi fotografado sob luz UV utilizando um sistema de documentação de gel.

Reagente concentração final
metab de potássioisulfite (K 2 S 2 O 5) 0,25 M
Tampão Tris pH 7,5 0,2 M
ácido etilenodiaminotetracético (EDTA) 50 mM
cloreto de sódio (NaCl) 2 M
brometo de cetiltrimetil amónio (CTAB) 2% v / v

Tabela 1: Preparação de um tampão de lise. Levar o volume de 5 mL com dH2O

Alvo Nome Primer Sequence Primer Tm (° C) Espera Tamanho do produto (pb)
fúngica ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52,1
16S bacteriano V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
16S bacterianas V4 V5- FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Fúngica 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63,8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66,6

Tabela 2: Primers para Avaliação de Contaminação.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A fim de se obter alta ADN genómico puro, de peso molecular a partir do obrigatório biotrófica fungos de oídio, uma versão modificada dos métodos anteriormente descritos foi desenvolvido 30. O rendimento médio usando este protocolo optimizado é de 7 g de ADN por 150 mg de conídios, uma duplicação do rendimento obtido com um protocolo anterior. Além disso, o tamanho médio aumentou de cerca de 20 kpb a mais de 48,5 kpb. Este protocolo foi optimizado no sistema cichoracearum G. cucumber-. A fim de obter a melhor qualidade e maior pureza do ADN em outros oídio ou obrigar fungos biotrófica, pode ser necessário modificação adicional deste protocolo. No futuro, este protocolo pode ser utilizado para se obter ADN de elevado peso molecular adequados para a sequenciação de ADN de leitura longa a partir de outros fungos biotróficos obrigatórios, embora modificação adicional pode ser exigido.

Equilibrando rendimento elevado de DNA e alto peso molecular de DNA extraído foi uma preocupaçãodurante a optimização deste protocolo. Passos incluindo vórtex foram eliminados de forma a minimizar o cisalhamento do ADN, e foram substituídos por misturando suavemente por inversão. Esta mudança aumentou a qualidade do DNA extraído sem reduzir significativamente o rendimento. Além disso, a remoção das esferas de aço no início do passo de lise de células aumentou significativamente o rendimento do ADN quando comparado com as esferas deixando na solução até que o fim do passo de lise.

Sem G. cichoracearum conídios permaneceu intacto após o procedimento moagem na etapa 1.3. Para se obter bons rendimentos de ADN genómico de elevado peso molecular, é crucial que a parede da célula fúngica é interrompida durante este passo. integridade conídios pode ser avaliado microscopicamente, e a moagem com esferas adicionais ou métodos alternativos de interrupção pode ser necessário para outras espécies de fungos.

Alguns conídios, nomeadamente o sp Blumeria., Contêm pigmentos que podem CONTaminar de extracção de ADN e de purificação de tentativas. Nestes casos, é recomendável que inclui o passo de filtração de DNA tal como foi apresentado no Bourras et al. (2015) protocolo de 19 e um passo de lavagem adicional com TE após o passo de filtração. A adição da etapa de filtração resultou em um aumento pequeno mas significativo na degradação do ADN, e só deve ser incluído se pigmentação excessiva permanece após o segundo passo de precipitação do ADN. Estes pigmentos, se permitida a permanecer em solução, podem interferir com a análise posterior da qualidade e quantidade de ADN e poderia, potencialmente, interferir com as reacções de sequenciação.

Este protocolo inclui tanto um passo de electroforese em gel de agarose tradicional e um passo de electroforese em gel de campo pulsado. A primeira é uma avaliação inicial da fracção de ADN que é> 20 kpb e a fracção que corre como uma mancha a <20 kpb. Para o propósito das reacções de sequenciação a jusante necessário para mil pulverulentogenomas de orvalho, a fracção de DNA <20 kpb deve ser mínima (ver Figura 1, pista 2 versus pista 4). A avaliação de electroforese em gel de campo pulsado fornece uma melhor estimativa do tamanho como ADN> 20 kpb podem ser separados por tamanho. ADN de> 48,5 kpb é desejável para utilização em reacções de sequenciação subsequentes (ver Figura 2, pista 4).

O material fúngico utilizado nestas experiências foi propagado em câmaras de crescimento e contaminação foi limitado utilizando protocolos de isolamento e controlos rigorosos pessoal. Devido a isso, a contaminação com agentes patogénicos míldio outro, não pulverulentos foi mínima, e a sequenciação da região ITS amplificada utilizando iniciadores específicos de fungos recuperada apenas sequências cichoracearum G.. Isto pode não ser o caso para oídios recolhidos a partir de locais de campo ou em estufas que faltam os mesmos controlos de isolamento, e a avaliação contaminação nestes cases serão críticos para a montagem de genomas de alta qualidade a partir do ADN extraído.

Sem uma modificação dos vários protocolos de isolamento de ADN de fungos foi excepcionalmente importante. Em vez ligeiras modificações em vários passos resultou nos rendimentos relativamente elevados de ADN de elevado peso molecular míldio pulverulento relatados aqui.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Purificação de DNA de alto peso molecular genômico de oídio de longo Read Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter