Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Rening av hög molekylvikt Genomiskt DNA från mjöldagg för lång Läs Sequencing

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

Mjöldaggssvampar är en grupp av ekonomiskt viktiga växtsvamppatogener. Relativt lite är känt om den molekylära biologi och genetik för dessa patogener, delvis på grund av brist på välutvecklade genetiska och genomiska resurser. Dessa organismer har stora, repetitiva genom, som har gjort genomsekvensering och montering oöverkomligt svårt. Här beskriver vi metoder för insamling, extraktion, rening och kvalitetskontroll bedömning av högmolekylärt genomiskt DNA från en mjöldagg arter, Golovinomyces cichoracearum. Det protokoll som beskrivs innefattar mekanisk sönderdelning av sporer följt av en optimerad fenol / kloroform genom-DNA-extraktion. Ett typiskt utbyte var 7 ^ g DNA per 150 mg konidier. Det genomiska DNA som isoleras med användning av detta förfarande är lämplig för lång-läs sekvensering (dvs> 48,5 kbp). Kvalitetskontroll åtgärder för att säkerställa storleken, utbyte och renhet av det genomiska DNA är ocksåbeskrivs i denna metod. Sekvensering av det genomiska DNA: t av den kvalitet som angivits här kommer att möjliggöra montering och jämförelse av multipla mjöldaggs genom, som i sin tur kommer att leda till en bättre förståelse och förbättrad kontroll av denna jordbruks patogen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mjöldagg är en grupp av obligat biotrophic växtsvamppatogener att när de tas tillsammans, är den största orsaken till växtsjukdomar i hela världen en. Det finns över 900 beskrivna arter av mjöldagg, som har taxonomiskt grupperade i fem stammar inom familjen Erisyphaceae 2. På grund av både deras ekonomiska betydelse och intim relation de utvecklar sina värdar har mjöldaggssjukdomar varit föremål för forskning för> 100 år. Vid infektion, mjöldagg framkallar drastiska förändringar i cellstrukturen, metabolism och molekylärbiologi för sina värdar, för att gynna denna patogen. Dock är studiet av mjöldagg särskilt utmanande på grund av deras obligat livsstil och tillväxt av svampen i ren kultur har ännu inte beskrivits 3, 4, 5,"xref"> 6, 7, 8. Tillförlitlig, stabil genetisk transformation av mjöldagg har inte heller ännu gjorts, även om övergående transformation har rapporterats i vissa arter 9, 10.

Den sekvensering och montering av mjöldagg genomen har visat sig vara svårt på grund av ett antal funktioner av genomet själv. Mjöldagg genomen är stora (120-180 Mbp) i förhållande till andra svamp genomen, och består vara 60 - 90% jämnt fördelade repetitiva element 11. Dessa element innefattar icke-långa terminala upprepningar, liksom okategoriserade repetitiva element. Två formae Speciales av en enstaka mjöldaggsarter, gräsmjöldagg f. sp. hordei och f. sp. tritici (bGH och BGT, respektive) liksom den druv mjöldagg Erysiphe necator, har been sekvenseras och utkast-genom för flera andra har avslutats 12, 13, 14. Den repetitiva naturen hos genomen har gjort montering svår, och den färdiga BGH-genomet samman till 6,989 supercontigs med en L50 av 2 Mb 12.

Trots det stora genomet, de mjöldagg verkar ha ett litet antal protein kodande generna, med 5.845 och 6,540 gener förutsagda i bGH och BGT, respektive. De sekvenserade mjöldagg verkar också saknar åtminstone 99 kärn gener som är väsentliga i andra svampar, vilket är förenligt med beroendet av de svampar på sin värdväxt för överlevnad 11, 12, 13, 14.

Repetitiva sekvenser nära telomerer, centromerer, ribosomal RNEn gen arrayer och områden berikade i omflyttbara element är dåligt ihop från kort läs sekvensestrategier och är ofta underrepresenterade i genomet aggregaten 15. Sådana regioner tros vara ansvarig för många av de luckor som förekommer i genomsekvenser, och detta gäller för de mjöldagg med deras omfattande expansion av repetitiva element 16. Mycket av plast genom regioner ofta i sådana repetitiva regionerna 3. De tjänar som ett område av kromosomomarrangemang och ofta kodar gener under starkt selektivt tryck, såsom de gener som kodar effektorproteiner och generna som kodar för enzymer av sekundär metabolism. Framsteg inom enda molekyl lång läsa sekvenseringsteknologier ger en möjlig lösning för sekvensering över repetitiva regioner av genom 15. Exempelvis Faino et al. (2015) fann att inbegripet lång sekvensen läsa teknik och optisk mapping tillät dem att producera ett gap-mindre genomsekvens för två stammar av svampväxt patogen Verticillium dahlia, tredubbling andelen repetitiva DNA-sekvenser i genomet, vilket ökar antalet gen annoteringar (och minska antalet partiella eller saknas gen annoteringar ) och avslöjande genomet omarrangemang 17.

Att utnyttja dessa långa-läs sekvenseringsteknologier, höga koncentrationer av hög kvalitet genom-DNA, med minimal storlekar> 20 kbp, behövs. Här beskriver vi våra metoder för konidial insamling, rening av högmolekylärt DNA från konidier och våra kvalitetskontrollbedömningar med hjälp av mjöldagg arter Golovinomyces cichoracearum odlas på gurka 18. Detta protokoll är baserat på ett protokoll som utvecklats i B. Keller laboratoriegrupp (University of Zurich, Zurich Schweiz) 13, 19och inkluderar flera modifieringar som ledde till ökade DNA-utbyten och en högre andel av DNA> 48,5 kbp i storlek. Protokollet innehåller även kontrollsteg kvalitet baserade på rekommendationer från Förenta staternas Department of Energy Joint Genome Institute 20, 21, 22.

Funktionen hos varje reagens som ingår i lysbuffert, och den logiska grunden för varje reningssteg, är såsom beskrivs i Henry (2008) 23. Tillgängliga publicerade protokoll för isolering av högmolekylärt genomiskt DNA från växt- och mikrobiella vävnader rådfrågades också under utformningen av detta protokoll 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Framställning av svampmaterial

  1. Växande Mjöldagg
    1. Odla växter i odlingskammare med följande villkor: 22 ° C dagtemperatur, 20 ° C nattemperatur, 80% relativ fuktighet, 14-h dag-längd och en ljusintensitet av 125 uE / m2 / s (tillhandahålls av lysrör ).
    2. Infektera gurkväxter (Cucumis sativa sort Bush Champion) med Golovinomyces cichoracearum stam UCSC1 såsom beskrivits 18, 29.
  2. Skörd Mjöldagg Konidier
    1. Skörd konidier från infekterade växter på 7 - 10 dagar efter inokulering med en liten vakuum med en in-line-filter (11 pm), på vilken de konidier ackumuleras. Ett lätt tryck, köra vakuummunstycket längs ytan av bladet för att samla upp konidier.
      OBS: Det genomsnittliga utbytet av G. cichoracearum är 20 mg av konidier från en tungt infected gurka blad av ca 130 cm 2 i området.
    2. Borsta ca 150 mg av konidier (cirka 375 mikroliter volym, eller konidier från 7-8 infekterade gurka blad) från filtret på ett ark av rent papper. Härifrån, överföra konidier i 2 ml kryokärl med två 5/32 tums diameter för-kyld (i flytande kväve) stålmalningskulor. Omedelbart returrören till flytande kväve. Lagra rören vid -80 ° C.
  3. Breaking Open Conidia genom kulmalning
    1. Flash frysa aluminiumplattor av kulkvarn i flytande kväve. Belastning kryokärl i kulkvarn rack. Kraftigt skaka cryovials med konidier och stålkulor i kulkvarnen under 30 s vid 30 cykler / s (vid rumstemperatur). Omedelbart refreeze kryokärl i flytande kväve.
      OBS: Initialt åtkomst ett prov av konidier genom mikroskopi vid 100 gångers förstoring för effektiviteten av cellväggen bristning under slipning. Om det behövs, slipa under ytterligare 1 - 2 omgångar av 30 s under 30 cykler / s, bUT hålla antalet omgångar till ett minimum. Rutin bedömning av konidial brott genom mikroskopi i detta skede är onödigt när optimala förhållanden har fastställts.

2. Genomiskt DNA Purification

  1. konidier Lysis
    1. Att arbeta snabbt för att undvika upptining konidier, ta bort stålkulorna från kryokärl med en magnet. Lägga 700 mikroliter 65 ° C lysbuffert (tabell 1) och vortexblanda 5 - 10 s tills en uppslamning bildas.
    2. Tillsätt 300 | il förvärmd (65 ° C) 5% (volym / volym) sarkosyl och vänd försiktigt för att blanda (1 inversion per 3 s) fem gånger. Inkubera rör för 30 min vid 65 ° C; invertera försiktigt 3 gånger vid 10, 20 och 30 min. Med användning av en bred borrning pipettspets, överföra hela lösningen till nya 2 ml mikrocentrifugrör. Vid alla efterföljande steg, blanda genom försiktig, långsam inversion och överföra DNA-lösningar som innehåller med bred borrade pipettspetsar.
  2. DNA-extraktion I
    1. Lägga en volym av klorForm: isoamylalkohol (24: 1 v / v) till lyseringslösningen och vänd försiktigt för att blanda fem gånger. Inkubera i 10 minuter vid rumstemperatur, försiktigt vända att blanda fem gånger vid halvvägs och igen vid slutet av inkubationen. Centrifug vid rumstemperatur under 15 min vid 14 tusen x g. Med användning av bred-borrning pipettspets, noggrant överföra det vattenhaltiga skiktet till ett nytt 2 ml mikrocentrifugrör; undvika inklusive material från gränssnittet.
  3. DNA utfällning I
    1. Lägga en volym rumstemperatur 100% isopropanol (cirka 750 | il) och vänd försiktigt för att blanda sex gånger. Centrifug vid rumstemperatur under 15 min vid 14 tusen x g. Försiktigt bort supernatanten och kasta.
    2. Tillsätt 450 | il för-kyld (-20 ° C) 70% etanol. Centrifugera i 5 minuter vid rumstemperatur vid 14 tusen x g. Försiktigt bort supernatanten och kasta. Centrifugera vid 1000 xg under 3 s, försiktigt bort supernatanten med fin pipettspets och kasta. Lufttorka pelleten för 15 min tillsattes ent rumstemperatur. Torka inte längre än 15 minuter.
    3. Återsuspendera pelleten i 300 mikroliter TE (10 mM Tris-Cl, 1 mM etylendiamin-tetraättiksyra, pH 8,0). Inkubera över natten vid 4 ° C. flick försiktigt för att resuspendera något restmaterial som inte gick i lösning.
  4. För att avlägsna kontamine RNA, tillsätt 10 | il RNas A (10 mg / ml). Vänd försiktigt för att blanda tre gånger. Centrifugera vid 1000 xg under 3 s. Inkubera vid 37 ° C under 2 h.
  5. DNA-extraktion II
    1. Tillsätt 300 | il fenol: kloroform: isoamylalkohol (25: 24: 1 volym / volym) och vänd försiktigt för att blanda fem gånger. Inkubera 10 minuter vid rumstemperatur, försiktigt vända att blanda fem gånger vid halvvägs och igen vid slutet av inkubationen. Centrifug 15 min vid rumstemperatur vid 14 tusen x g. Med användning av en bred borrning pipettspets, överföra supernatanten till nya 1,5 ml mikrocentrifugrör.
  6. DNA utfällning II
    1. Lägga 0,01 volym 3 M natriumacetat pH 5,2 (approximately 3 | il), vänd försiktigt för att blanda fem gånger. Tillsätt 2,5 volymer för-kyld (-20 ° C) 100% etanol (ca 750 | il). Vänd försiktigt för att blanda fem gånger. Inkubera över natten vid -20 ° C.
    2. Centrifug 30 min vid 4 ° C vid 14 tusen x g. Försiktigt bort supernatanten och kasta.
    3. Tillsätt 450 | il för-kyld (-20 ° C) 70% etanol. Centrifugera i 5 minuter vid 4 ° C vid 14 tusen x g. Försiktigt bort supernatanten och kasta. Centrifugera vid 1000 xg under 3 s. Ta försiktigt bort supernatanten med fin pipettspets och kasta.
    4. Lufttorka pelleten under 30-60 min vid rumstemperatur. Resuspendera pelleten i 27,5 mikroliter TE. Inkubera över natten vid 4 ° C. flick försiktigt för att resuspendera något restmaterial som inte gick i lösning.
    5. Alikvot 2,5 mikroliter in i 22,5 | il TE (slutlig volym 25 | il) för tester för kvalitetskontroll (se nedan). Lagra DNA-prover vid 4 ° C tills inlämning för sekvensering. För långtidslagring, lagra provervid -80 ° C och minimera frysnings-upptiningscykler för att förhindra skjuvning.
      OBS: Var försiktig vid pipettering i detta steg som den högmolekylära iskt DNA kan vara svårt att pipettera ordentligt, och det är viktigt att se till att "QC Alikvotera" är en korrekt representation av genomiskt DNA-prov.

3. Kvalitetskontroll

  1. prov renhet
    1. Med användning av en TE tom, bedöma prov renhet av DNA genom att ladda 1 mikroliter av QC Aliquot på en liten volym spektrofotometer. Record A260 / A280 och A260 / A230 avläsningar. Rent DNA kommer att ha en A260 / A280-förhållande av ungefär 1,8 och A260 / A230-förhållande mellan 1,8 och 2,2.
  2. Kvantifiering av genomiskt DNA
    1. Utför kvantifiering av QC alikvot med användning av en kommersiell dubbelsträngat DNA kvantifiering analyssats enligt tillverkarens instruktioner.
  3. DNA Quality Assessment I
    1. Belastning ca 60 ng genomiskt DNA och enDNA-stege på en 0,7% agarosgel i 1 x TAE (40 mM Tris, 20 mM ättiksyra och 1 mM EDTA, pH 8,0). Köra gel apparat vid 70 V under 40 - 45 min till dess genomiska DNA-banden är ungefär 2 cm från brunn och bandseparation i stegen är uppenbar. Dessa villkor kan behöva justeras baserat på tillgänglig gelelektrofores apparat.
  4. DNA Quality Assessment II
    1. Belastning ca 60 ng genomiskt DNA och en högmolekylär DNA-stege (lämplig för pulsad-fält-gelelektrofores) på en 1% agarosgel i 0,5x TBE (44,5 mM Tris, 44,5 mM borsyra, 1 mM EDTA, pH 8,3) och köras i 0,5x TBE rinnande buffert med användning av en 5-80 kbp vågform pulsad-fält-gelelektrofores protokoll för 16 h.
  5. Bedömning av bakterier, svampar och växt Föroreningar
    1. Utföra polymeraskedjereaktion (PCR) för att amplifiera de lämpliga interna transkriberade distansorgan (ITS) regioner av de ribosomala gener med användning av primrar och amplifieringsbetingelser Listaed i tabell 2. Belastning 10 mikroliter av den resulterande reaktions på en gel.
      OBS: Ett band representerande mjöldagg ITS regionen bör amplifieras med svamp ITS primrar. DNA från denna amplikon och varje amplikon som genererats med de bakteriella, eller växt Primrarna bör sekvenseras för att fastställa ursprunget för föroreningen. Endast mjöldagg ITS sekvenser bör finnas i svamp amplicon.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ett representativt exempel på 60 ng renat genomiskt DNA från G. cichoracearum kördes på en agarosgel med användning av gelelektrofores och med användning pulsad-fält-gelelektrofores är visade i fig 1 och 2, respektive. Iska DNA-beredningar som passerar, marginellt passerar och misslyckas kvalitetskontroll är representerade. Genomiska DNA-preparat som helt passerar kvalitetskontroll är idealiska för sekvensering med lång lästa genomsekvense metoder. Preparat som marginellt passerar kvalitetskontroll är acceptabla, men preparat som fullt passera föredras. Preparat som misslyckas kvalitetskontroll är inte acceptabelt för lång lästa genomet sekvense metoder.

Figur 1
Figur 1: agarosgelelektrofores av renat genomiskt DNA. Lane 1: Lane 2: genomiskt DNA som passerade kvalitetskontroll; Lane 3: genomiskt DNA som ansågs marginell; och Lane 4: genomiskt DNA som misslyckades kvalitetskontroll. Godtagbara och marginella genomiska DNA-prover har ett enda band som kör över 20 kbp med minimal utsmetning vid <20 kbp. Genomiska DNA-prover som inte kvalitetskontroll har smetning under 20 kbp, och kan inkludera lågmolekylära fragment vid ca 100 bp (*). Pulsad-fält-gelelektrofores krävs för att skilja mellan acceptabla och marginella DNA-prover. Etidiumbromid tillsattes till gelén före elektrofores för att visualisera det genomiska DNA. Proverna elektrofores vid 60 V under 50 min. Gelén avbildades under UV-ljus med användning av en gel dokumentationssystem.

figur 2
Figur2: Pulsed-Field Gel Electrophoresis (PFGE) av renad mjöldagg Genomiskt DNA. Lane 1: molekylviktsstandarder, med den högsta bandet vid 48,5 kbp och den lägsta vid 8,1 kbp. Banorna 2 och 5: molekylviktsstandarder visar band av 20, 10, 7, 5, 4, 3, 2 och 1,5 kbp (vid botten av gelén bilden). Lane 3: en marginell DNA-prov, med majoriteten av DNA mellan 20 och 48,5 kbp i storlek. Lane 4: en acceptabel DNA-prov, med majoriteten av DNA> 48,5 kbp (*). Prover kördes vid 75 V under 15 timmar med användning av en 5-80 kbp program PFGE vågform. DNA-färgningsfärgämne tillsattes till gelén efter elektrofores och gelén avbildades under UV-ljus med användning av en gel dokumentationssystem.

Reagens slutlig koncentration
kalium Metabisulfite (K 2 S 2 O 5) 0,25 M
Tris-buffert pH 7,5 0,2 M
Etylendiamintetraättiksyra (EDTA) 50 mM
Natriumklorid (NaCl) 2 M
Cetyltrimetylammoniumbromid (CTAB) 2% volym / volym

Tabell 1: Framställning av lyseringsbuffert. Få en volym av 5 ml med dH 2 O.

Mål primer Namn primer sekvens Tm (° C) Förväntad Produkt Storlek (bp)
svamp~~POS=TRUNC ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52,1
Bakteriell 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Bakterie 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Svamp 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63,8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66,6

Tabell 2: Primrar för Förorening Assessment.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I syfte att erhålla ren, med hög molekylvikt genomiskt DNA från den obligata biotrophic mjöldagg svampar, var en modifierad version av tidigare beskrivna metoder utvecklats 30. Den genomsnittliga avkastningen använder denna optimerade protokollet är 7 | ig DNA per 150 mg konidier, en fördubbling av utbyte som erhålles med ett tidigare protokoll. Också, ökade den genomsnittliga storleken från approximativt 20 kbp till över 48,5 kbp. Detta protokoll har optimerats i cucumber- G. cichoracearum system. I syfte att erhålla bästa kvalitet och högsta renhet DNA i andra mjöldagg eller obligata biotrophic svampar, kan ytterligare modifiering av detta protokoll att krävas. I framtiden, kan detta protokoll användas för att erhålla hög molekylvikt DNA lämplig för lång läsa DNA-sekvensering från andra obligata biotrophic svampar, även om ytterligare modifiering kan krävas.

Balansera högt DNA-utbyte och hög molekylvikt av extraherat DNA ett bekymmerunder optimering av detta protokoll. Steg inkluderande vortexning eliminerades för att minimera skjuvning av DNA, och ersattes genom att försiktigt blanda genom inversion. Denna förändring ökade kvaliteten på det extraherade DNA utan att signifikant reducera avkastningen. Dessutom, avlägsnande av stålkulorna vid början cell lyssteget ökade signifikant DNA-utbytet i jämförelse med de lämnar kulorna i lösningen fram till slutet av den lyseringssteget.

Ingen G. cichoracearum konidier förblev intakt efter kulmalning proceduren i steg 1,3. Att erhålla goda utbyten av högmolekylärt genomiskt DNA, är det avgörande att svampens cellvägg avbryts under detta steg. Konidial integritet kan bedömas mikroskopiskt, och ytterligare kulmalning eller alternativa metoder för störningar kan krävas för andra svamparter.

Vissa svamp conidia, särskilt Blumeria sp., Innehålla pigment som kan fortsaminera DNA extraktions- och reningsförsök. I dessa fall rekommenderar vi inklusive DNA filtreringssteget som beskrivs i Bourras et al. (2015) protokoll 19 och ett ytterligare tvättsteg med TE efter filtreringssteget. Tillsatsen av filtreringssteget resulterade i en liten men signifikant ökning av DNA-nedbrytning, och bör endast inkluderas om överdriven pigmentering kvarstår efter den andra DNA-fällningssteget. Dessa pigment, om det lämnas kvar i lösning, kan störa senare analys av kvaliteten och kvantiteten av DNA och kan potentiellt interferera med sekvenseringsreaktioner.

Detta protokoll inkluderar både en traditionell agarosgelelektrofores steg och en pulsad-fält-gelelektrofores steget. Den första är en första bedömning av den del av DNA som är> 20 kbp och fraktionen som körs som ett utstryk vid <20 kbp. När det gäller de efterföljande sekvenseringsreaktioner som krävs för pulver mildagg genomen, den fraktion av DNA <20 kbp bör vara minimal (se figur 1, bana 2 versus lane 4). Den pulsade-fältet gelelektrofores bedömning ger en bättre uppskattning av storleken som DNA> 20 kbp kan separeras efter storlek. DNA av> 48,5 kbp är önskvärd för användning vid efterföljande sekvenseringsreaktioner (se Figur 2, spår 4).

Svampmaterial som används i dessa experiment förökades i odlingskammare och förorening var begränsad användning strikta isoleringsprotokoll och personal kontroller. På grund av detta, kontaminering med andra, icke-mjöldagg patogener var minimal, och sekvensering av ITS-regionen amplifierades med användning svampar specifika primrar utvanns endast G. cichoracearum sekvenser. Detta kan inte vara fallet för mjöldagg som samlats in från fält webbplatser eller växthus saknar samma isolerings kontroller och bedömning förorening i dessa cases kommer att vara avgörande för sammansättningen av högkvalitativa genomen från den extraherade DNA.

Ingen modifiering av olika svamp DNA isoleringsprotokoll var unikt viktigt. Ganska små modifieringar vid många steg resulterade i de relativt höga utbyten av hög molekylvikt mjöldagg DNA redovisas här.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Rening av hög molekylvikt Genomiskt DNA från mjöldagg för lång Läs Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter