Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Induktion af Mesenchymale-Epithelial Overgange i sarkomceller

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Vi præsenterer her en cellekultur fremgangsmåde til induktion mesenchymale-epitel overgange (MET) i sarkomceller fra kombinerede ektopisk ekspression af microRNA-200 familiemedlemmer og grainyhead-lignende 2 (GRHL2). Denne metode er velegnet til en bedre forståelse af den biologiske virkning af fænotypisk plasticitet på kræft aggressivitet og behandlinger.

Abstract

Fænotypisk plasticitet refererer til et fænomen, hvor celler transient få træk af en anden slægt. Under karcinom progression, fænotypisk plasticitet driver invasion, formidling og metastaser. Faktisk, mens de fleste af de undersøgelser af fænotypisk plasticitet har været i forbindelse med epitel-afledte carcinomer, viser det sig sarkomer, som er mesenchymal oprindelse, også udviser fænotypisk plasticitet, med en delmængde af sarkomer undergår et fænomen, der ligner en mesenchymal- epithelial overgang (MET). Her udviklede vi en fremgangsmåde, der omfatter miR-200 familie og grainyhead-lignende 2 (GRHL2) at efterligne dette MET-lignende fænomen observeret i sarkom patient samples.We sekventielt udtrykker GRHL2 og miR-200 familie ved hjælp celle transduktion og transfektion, henholdsvis , bedre at forstå de molekylære fundament for disse fænotypiske overgange i sarcomceller. Sarkomceller udtrykker MIR-200s og GRHL2 vist bedre epitel characteristics i cellemorfologi og ændring af epitel- og mesenchymale biomarkører. Fremtidige undersøgelser under anvendelse af disse fremgangsmåder kan anvendes til bedre at forstå de fænotypiske konsekvenser af MET-lignende processer på sarcomceller, såsom migration, invasion, metastatisk tilbøjelighed, og terapi modstand.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fænotypisk plasticitet refererer til en reversibel overgang mellem cellulære fænotyper, og er almindeligt opdeles i to typer, epitel-til-mesenchymale (EMT) overgange og mesenchymale-til-epitel overgange (MET). Denne fænotypisk plasticitet spiller en vigtig rolle i normale processer i flercellede organismer, såsom udvikling og sårheling 1; imidlertid kan disse samme veje og genekspression programmer også føre til sygdom, såsom fibrose (revideret i 2, 3, 4) og carcinommetastase (gennemgået i referencerne 5, 6, 7, 8). Under metastase, f.eks EMT forstyrrer cellepolaritet, celle-celle-interaktioner, og fremmer invasion 9, 10. Sammen EMT bidrages til en fænotypisk tilstand, der letter udbredelsen kræftcelle. Derudover EMT fører også til en masse andre fænotypiske ændringer, der driver en aggressiv fænotype, herunder deregulering af cancer cellemetabolisme 6, udvikling af lægemiddelresistens 11, 12, øget tumor-initiering evne 13, 14 og vært immune unddragelse 15.

Fænotypisk plasticitet er blevet godt undersøgt i carcinoma progression; imidlertid sarkomer udviser også fænotypisk plasticitet. Interessant, ser det ud som om nogle af de samme førere af fænotypisk plasticitet i karcinomer også bidrage til sarkom plasticitet og aggressivitet. For eksempel har cirkulerende tumorceller (CTCs) fra patienter med sarkom blevet vist at udtrykke EpCAM, et celleoverfladeprotein, der typisk findes på epithelceller 16. Additionelt blev 250 Bløddelssarkom prøver kategoriseret som epitellignende eller mesenchymal-lignende baseret på genekspression. Patienter i epitel-lignende biomarkør signatur havde en bedre prognose end patienter med mesenchymale-lignende biomarkør signatur 17. Dette er i overensstemmelse med mange carcinomer, hvor patienter med flere epitel-lignende carcinomer har bedre resultater sammenlignet med patienter med flere mesenchymale-lignende tumorer 18.

Mens nogle sarkomer vise biomarkører og genekspression veje i overensstemmelse med MET, forbliver de molekylære fundament for denne fænotypisk plasticitet dårligt forstået. For at undersøge de mekanismer og førere af MET i sarkom vi udviklet en model af MET induktion ved hjælp af to epitel-specifikke faktorer, den microRNA (miR) -200 familie og grainyhead-lignende 2 (GRHL2). MIR-200s er en familie af små ikke-kodende RNA'er, der regulerer genekspression ved binding til de 3 UTR'er af messenger RNA og forhindre translation til protein. MIR-200 familien består af to undergrupper - en, der indeholder miR-141 og miR-200a, og den anden, herunder miR-200b, miR-200c, og miR-429. Medlemmer af miR-200 familien er beriget i epitelvæv, og tabet af MIR-200s er forbundet med metastase i carcinomer 19. MIR-200 familien er også nedreguleret i bløddelssarkomer sammenlignet med normalt væv 20. Svarende til MIR-200s, GRHL2 er en vigtig regulator, som er vigtigt for epitheludvikling 21. Den GRHL2 transskriptionsfaktoren virker på to måder at opregulere epiteliale gener såsom Ecadherin: 1) I epitelceller, GRHL2 direkte undertrykker EMT hovedregulator, ZEB1 22; og 2) GRHL2 direkte aktiverer transkription af epiteliale gener 23. Vores tidligere undersøgelser har vist, at kombineret ekspression af MIR-200s og GRHL2 i sarkomcellerinducerer en MET-lignende fænotype 24. Her præsenteres en detaljeret protokol til at skabe en in vitro model af MET induktion i sarkomceller anvendelse ektopisk ekspression af MIR-200s og GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Fremstilling af reagenser

  1. Forberede DMEM i cellekultur ved tilsætning af 50 ml føtalt bovint serum (FBS) og 5 ml penicillin-streptomycin (5000 U / ml) til 500 ml DMEM. Dette medium kan opbevares ved 4 ° C i op til seks måneder.
  2. Opblande frysetørrede primere i nuclease-frit vand til en slutkoncentration på 10 uM. Store resuspenderet primere ved -20 ° C.
  3. Forberede radioimmunpræcipitationsanalyse (RIPA) buffer (150 mM NaCl, 0,5% natriumdeoxycholat, 0,1% SDS, 50 mM Tris, pH 8,0). Supplere med protease inhibitor cocktail før brug og holde puffer på is under brug. Opbevares ved 4 ° C.
  4. Forbered 10 mg / ml polybren (hexadimethrinbromid) i vand og sprøjte filter til at sterilisere ved anvendelse af en 0,45 um polyethersulfon filter. Opløsning kan opbevares ved 4 ° C i op til seks måneder.
  5. Fremstilling af en 1 mg / ml arbejdsopløsning af nitro tetrazoliumchlorid ved at opløse 10 mg i 10 ml PBS. Opbevares ved 4 ° C.

2. Lentiviral Transduktion af GRHL2

Dag 1

  1. Plade 3 x 10 5 HEK293T celler pr brønd i en 6-brønds plade i 2 ml suppleret DMEM. Kvantificere celler under anvendelse af en automatiseret celletæller. Celler være 40 - 60% sammenflydende efter dyrkning natten over ved 37 ° C med 5% CO2.

Dag 2

  1. Fortynd 2 ug tom vektor (pCMV-UBC-EGFP) eller 2 ug pCMV-GRHL2-UBC-EGFP 24, 25 i 200 pi serumfrit medium sammen med 1,8 ug pΔ8.9 og 0,2 ug pCMV-VSV -G hjælper-plasmider. I et separat rør, fortyndes 4 pi af en lipidbaseret transfektionsreagens i 200 pi serumfrit medium pr transfektion (8 pi i 400 pi for to prøver). Tilsæt 200 pi af transfektionsblandingen reagens til hvert plasmid opløsning og inkuberes i 20 minutter ved stuetemperatur.
  2. Under INCUBAtion, vask HEK293T celler ved fjernelse af mediet ved vakuum aspiration og skylning celler med 1 ml PBS. Erstatte PBS med 800 pi serum-fri medier. Efter 20 min tilsættes 200 pi transfektionsreagens: plasmid blandingen fra trin 2.2 dråbevis til hver brønd og inkuberes celler i 2 timer ved 37 ° C i 5% CO2.
  3. Fjern forsigtigt transfektion medium ved vakuumaspiration og erstatte med 2 ml suppleret DMEM. Retur cellerne til inkubatoren i natten over kultur.
    BEMÆRK: HEK293T celler er løstsiddende. Udskiftning af medier skal udføres med forsigtighed for at begrænse fjernelse af celler fra bunden af ​​skålen eller kolben.

Dag 3

  1. Genopfriske medier på transficerede HEK293T celler og plade 3 x 10 5 RD-celler pr brønd i en 6-brønds plade i 2 ml suppleret DMEM. Kulturceller natten over. RD-celler er en kommercielt tilgængelig human rhabdomyosarcoma cellelinie.

Dag 4

  • Indsamle viral medier fra HEK293T celler. Pipette DMEM medier fra HEK293T celler og sted i en ny 15 ml konisk. Omhyggeligt erstatte med nye DMEM medier og sted HEK293T celler tilbage i inkubatoren til næste dag.
  • Tilsæt 2 pi 10 mg / ml polybren pr ml af virale medier i to nye 50 ml koniske rør (et for tom vektor transfektion og en anden for GRHL2 transfektion). Sprøjtefilter viral medier ved at fjerne stemplet fra en 3 ml sprøjte og vedlægge en 0,45 um polyethersulfon filter til spidsen.
    1. Tilsæt virale medier opsamlet i trin 2.6 i sprøjtens cylinder, og styrte medier i nye 50 ml, koniske rør indeholdende polybren. Fjern medier fra RD-celler ved vakuum aspiration og tilføje filtreret viral medier til RD-celler.
  • Dag 5

    1. Gentag Dag 4. HEK293T celler kan kasseres efter den virale medier er blevet opsamlet.

    Dag 7

    1. Vask RD-celler med 1 mL PBS, og der tilsættes 200 pi af 0,05% trypsin pr. Der inkuberes ved 37 ° C i 5 minutter tilsættes 2 ml supplerede medier, og flytte cellesuspensionen til en ny 15 ml konisk. Centrifuger cellerne ved 250 xg i 5 minutter ved stuetemperatur, og der opsuges medier. Resuspender i 1 ml DMEM (suppleret med 5% FBS og 1% penicillin-streptomycin).
      BEMÆRK: Ved anvendelse af en højere procentdel af FBS kan forårsage tilstopning under flowcytometri
      1. Filterceller for flowcytometri. Anvend en pipette for at anvende 1 ml RD cellesuspensionen gennem en 30 um filter i flowcytometri rør og placere rør på is.
      2. Sorter EGFP + celler 26 i 1,5 ml mikrocentrifugerør indeholdende 0,5 ml DMEM suppleret med 10% FBS og 1% penicillin-streptomycin og anbring på is. Plade EGFP + sorteret celler i alt 1 ml suppleret DMEM i en enkelt brønd i en plade med 12 brønde og sted i inkubatoren i kultur.
        Note: Udbyttet af EGFP + -celler fra flowcytometri efter denne transduktion sædvanligvis lav (50.000-100.000 celler). Celler kan være nødvendigt at dyrket i 10 - 14 dage før man går videre til trin 3.

    3. bagside Transfektion af MIR-200s

    1. Forbered 50 pM lagre af miR-200 efterligner under anvendelse nukleasefri H 2 O. Alikvote lagre og opbevares ved -20 ° C for at undgå gentagne fryse / optøningscykler.
    2. Tilsæt 3 pi hver 50 uM miR-200 mimic (miR-200a, miR-200b, og miR-200c) til 300 pi serumfrit medium eller 9 pi 50 pM negativ kontrol miRNA til 300 pi serumfrit medium.
    3. Tilsæt 6 pi siRNA-specifik transfektionsreagens til 600 pi serumfrit medium og dividere 300 pi af denne blanding i to rør, en for hver af de to MIR blandinger fra trin 3.2. Kombiner de 300 pi af hver miR blandingen fra trin 3.2 med en blanding af 300 pi af transfektionsreagens. Inkuber i 20 minutter ved stue temperature.
    4. Mens inkubation, fremstille en cellesuspension på 600.000 EGFP + RD-celler udtrykker EV eller GRHL2 skabt i afsnit 2 i 2,4 ml (250 celler / pl) af serum-fri medier per behandling.
    5. I en 24-brønds plade, tilsættes 100 pi per brønd af miR-200 mix eller negativ kontrolblanding fra trin 3.3 i seks brønde, og derefter tilsættes 400 pi af hver cellesuspension i tre brønde i hver miR mix.
    6. Cellerne inkuberes ved 37 ° C i 5% CO2 natten over og ændre medie til fuldt suppleret DMEM den følgende dag. Indsamle celler 2 dage senere for analyse ved anvendelse af passende buffer (se nedenfor). Time-lapse billeddannelse af RD sarkom celler undergår behandling er tilgængelig som supplerende materiale. Billede hver brønd hver 2 timer med en 10X objektiv ved hjælp af en automatiseret live-cell imager 27.

    4. RNA-ekstraktion, revers transkription og qPCR

    1. Uddrag RNA i henhold til producentens anvisninger ved hjælp af en standard-RNAekstraktionskit 24. Ekstraherede RNA kan opbevares ved -80 ° C.
    2. Kvantificere RNA-koncentration. Optø og arbejde med RNA på is. At kvantificere RNA koncentrationer måle UV-absorbans ved 260 nm med en pladelæser Spektrofotometer ifølge fabrikantens protokol. Fortynd alle prøver til den laveste koncentration med nuclease-frit vand.
    3. Udføre revers transkription af totalt RNA til komplementært DNA (cDNA). Kombiner ikke mindre end 100 ng af total RNA med PCR-buffer, dNTP mix (100 mM), vilkårlige hexamer-primere, revers transkriptase og nuclease-frit vand i et 20 pi reaktionsvolumen 24. Køre RT cyklusser ifølge producentens protokol. cDNA kan opbevares langsigtet ved -20 ° C.
    4. Fortynd 20 pi reaktioner på 100 pi med 80 pi nukleasefri H2O
    5. Bland 5 pi af en fluorescens-baseret indlejringsfarvestof 2x qPCR masterblanding, 0,06 pi af hver 10 pM primer, ennd 2 pi fortyndet RT-reaktionen per prøve.
    6. Kør qPCR henhold til producentens protokol for fluorescens-baserede mester mix.
    7. Kvantificere relative mængder af mRNA ved delta CT fremgangsmåde og normalisere til GAPDH. Plotte middelværdien mRNA-ekspression af biologiske replikater ± standardafvigelse for hver behandlingsgruppe.
      BEMÆRK: Der bør tages særlige forholdsregler ved arbejde med RNA for at undgå kontakt med RNaser, såsom at bruge RNase-fri plast og reagenser. Genbrugsudstyr skal behandles før brug for at fjerne RNaser.

    5. Immunfluorescensfarvning

    1. Efter trin 3.6, aspirere medier ved vakuumaspiration fra RD-celler i 24-brønds format.
    2. Fix celler ved tilsætning af 500 pi 4% paraformaldehyd (PFA) pr brønd og inkuberes i 15 minutter ved stuetemperatur (RT). Efter fiksering sted celler i phosphatbufret saltvand (PBS) og opbevares ved 4 ° C natten over om nødvendigt.
    3. permeabilisereceller ved tilsætning af 500 pi PBS + 0,2% Triton-X100 og inkuber 30 minutter ved stuetemperatur. Ved vakuum aspiration tages permeabiliseringspuffer og vaskes tre gange med PBS.
    4. Blok i 500 pi 5% bovint serumalbumin (BSA) / PBS og inkuberes celler i 30 minutter ved stuetemperatur. Celler kan opbevares ved 4 ° C natten over om nødvendigt.
    5. Forberede primært antistof fortynding. Pipetter 200 pi 5% BSA / PBS per brønd i en 15 ml konisk (12 brønde = 2,4 ml), og 1 pi af primært antistof pr ml 5% BSA / PBS nødvendigt. Fjerne blokerende buffer ved vakuum aspiration og dispensere 200 pi fortyndet primært antistof til hver brønd.
      1. Cellerne inkuberes i 1: 1.000 fortyndet primære antistoffer i 5% BSA / PBS i 1 time ved stuetemperatur eller natten over ved 4 ° C. Efter inkubation vaskes cellerne to gange med PBS.
    6. Forberede det sekundære antistof fortynding i det samme volumen 5% BSA / PBS som ovenfor. Tilsæt langtrækkende røde farvestof-konjugeret sekundært antistof ved anvendelse af en 1: 2.000 fortynding. Derudover tilføjer1 pg / ml Hoechst farvestof til mix. Fjern PBS og tilsæt 200 ul mix til hver brønd.
      1. Inkuber ved RT i 1 time i mørke. Vask 3 gange med PBS, efterlader cellerne i PBS, og beskytte celler mod lys ved anvendelse af folie. Celler kan opbevares ved 4 ° C om nødvendigt.
    7. Billeddata celler ved 400x total forstørrelse på en inverteret epifluorescensmikroskop med excitationsbølgelængde 594 - 650 nm.

    6. Western Blotting

    1. Vask cellerne fra 3,6 to gange med iskoldt PBS. På is, buffer lyserer celler med 50 pi 1x RIPA suppleret med 1x protease inhibitor cocktail.
    2. Rock lysater ved 4 ° C i 15 min, indsamle lysater i 1,5 ml rør og centrifugeres ved høj hastighed (20.000 xg) i 5 min at afklare prøver. Cellelysater kan opbevares langsigtet ved -80 ° C om nødvendigt.
    3. Kvantificere totalt protein under anvendelse af et Bradford-assay udportionerer samme mængde protein i nye 1,5 ml mikrocentrifugerør. Bring prøver til tilsvarende volumen ved anvendelse af RIPA-buffer og 3x Laemmli loading buffer suppleret med 2-mercaptoethanol.
    4. Inkuber prøver i 1x Laemmli prøvepåsætningsbuffer i 5 minutter ved 95 ° C og køre SDS-PAGE under anvendelse af en 4-12% Tris-glycin gel ved 200 V i 45 minutter. Mængden af ​​protein belastet intervaller afhængigt af cellelinjen. I nogle tilfælde er 50-100 ug totalt protein er nødvendig for at påvise Ecadherin i mesenkymale cellelinjer.
    5. Overførsel proteiner på en nitrocellulosemembran i 2 timer ved 50 V i 1 x Tris-glycin overførselsbuffer.
    6. Blok membran i 1 time ved stuetemperatur eller natten over ved 4 ° C i en BSA-baserede blokeringsbuffer.
    7. Fortynd primære antistoffer ved 1: 1.000 koncentration i 5 ml blokeringsbuffer, tilføje fortynding til membranen, og inkuberes under forsigtig rystning i 1 time ved stuetemperatur eller natten over ved 4 ° C. Vask membran 3 gange i PBS med 0,05% Tween-20.
    8. Inkuber membraner til 1 time ved stuetemperatur med infrarødt fluorescerende koblet secondary-antistof ved 1: 20.000 fortynding i blokerende buffer som ovenfor.
    9. Vask membran to gange i PBS med 0,05% Tween-20 og derefter en gang i PBS.
    10. Billede membran under anvendelse af standard infrarøde fluorescens detektion.

    7. Anchorage-uafhængig Vækst Analyser

    BEMÆRK: For en detaljeret blød agar assay-protokol, se 28.

    1. Varm steril 2x DMEM medier til 42 ° C i varmt vandbad. I løbet af denne tid, varmeforbehandlingen autoklaveret 1% agarose i mikrobølgeovnen i 3 min. Mikroovn i yderligere 30 s ad gangen efter behov eller indtil den er helt smeltet. Flytte agarose til en 42 ° C vandbad.
    2. Placer en 50 ml konisk rør i et bæger med 42 ° C vand i en steril hætte og blandes 1% agarose og 2x DMEM medier i et 1: 1 forhold tegner sig for 1,5 ml blanding pr brønd i en 6-brønds plade. Altid forberede ekstra DMEM / agarose at redegøre for pipetteringsfejl og for at undgå bobler.
    3. Tilføje blandingen tilsider af brønden, som sikrer ingen bobler dannes og lad stå i 30 minutter ved stuetemperatur.
    4. Mens bundlaget størkner, forberede hver gruppe af RD-celler transficeret i trin 3 ved at aspirere medier og vask en gang med 1 ml PBS. Aspirer PBS og tilsæt 0,2 ml 0,05% trypsin og inkuberes ved 37 ° C i 5 minutter.
    5. Neutralisere trypsin i 0,8 ml medier og Mal celler til dannelse af en enkelt-cellesuspension. Overførsel cellesuspension til en 15 ml konisk rør.
    6. Tæl celler og beregn volumen kræves til 10.000 celler per brønd cellesuspension.
    7. Opvarme 0,6% agarose i mikrobølgeovnen i 3 minutter efterfulgt af 30 s ad gangen, indtil den er helt smeltet. Flytte agarose til 42 ° C vandbad.
    8. Placer en 50 ml konisk rør i et bæger med 42 ° C vand i en steril hætte. Bland 0,6% agarose og fortyndet cellesuspension i et 1: 1 forhold til fremstilling af 1,5 ml blanding pr brønd i en 6-brønds plade. forberede altid ekstra cellesuspension / agarose mix at redegøre for pipetteringsfejl ogfor at undgå bobler.
      BEMÆRK: Det er vigtigt at arbejde ved 42 ° C her. Hvis temperaturen er for lav vil blandingen størkne før udpladning og temperaturer over 42 ° C vil påvirke cellernes levedygtighed.
    9. Bland godt ved triturering celler flere gange og tilføje celleblanding til brøndene, hvilket sikrer ingen bobler form og lad størkne i 20 minutter ved stuetemperatur.
    10. Tilsæt 2 ml supplerede medier til hver brønd og flytte pladerne til inkubatoren.
      1. Skift medier en gang om ugen i 3-4 uger eller indtil flercellede kolonier dannes. Vær omhyggelig med at undgå at røre agaren, når du fjerner medier ved hjælp af vakuum aspiration. Alternativt, brug en P1000 til at fjerne det øverste lag af flydende medier.
      2. Farv bløde agarplader ved tilsætning af 200 pi nitroblåtetrazolium chloridopløsning (1 mg / ml i PBS) og inkuberes pladen natten over ved 37 ° C. Udskift medier den næste dag med PBS til billeddannelse.
      3. Billeddata brønde ved 40X total forstørrelse på et omvendt mikroskop.
      4. Udfør analyse på ImageJ for koloni område og nummer. Plot betyder koloni antal biologiske replikater ± standardafvigelse.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Skemaet for MET induktion i sarkomceller

    En generel tidslinje for induktion af MET-lignende ændringer i sarkomceller er vist i figur 1. Protokollen begynder ved at transducere GRHL2 (figur 1A), efterfulgt af transfektion af miR-200 familien (figur 1B). GRHL2 eller miR-200 familiemedlemmerne ikke i stand til at påvirke udseendet af RD-celler, når det udtrykkes alene, men ektopisk ekspression af GRHL2 og MIR-200s sammen resulterer i epitel-lignende morfologiske ændringer i RD-celler. Celler overgang fra en spindel-formet form til en mere afrundet udseende med forøget celle-celle-kontakt (figur 1C).

    Induktion af MET-lignende forandringer i sarcomceller

    Den morfologiske ændring i RD-celler ved GRHL2 og miR-200overekspression blev ledsaget af opregulering af epitel markør Ecadherin (figur 2A). Tilsætning af MIR-200s opreguleret Ecadherin alene, men kombineres MIR-200s og GRHL2 overekspression synergistisk Ecadherin ekspression (figur 2A, ikke logge skala). Derudover var der en stigning i celle-celle forbindelserne af epitelial adhæsionsmolekyler, EpCAM og TJP1, hvide pile (også kendt som zona occludens 1, ZO-1) (Figur 2B).

    MET induktion formindsker kolonidannelse evne sarkomceller

    Opregulering af epiteliale proteiner blev ledsaget af nedregulering af mesenchymale gener Zeb1 og Notch1 (figur 3A), som er kendte mål for miR-200. Induktion af MET reducerede forankringsuafhængig vækst af RD-celler som målt ved antallet af kolonier (figur 3B). Denne groGJ inhibering skyldtes alene MIR-200s; som overekspression af GRHL2 førte til en stigning i forankringsuafhængig vækst (figur 3). Dette er i overensstemmelse med tidligere rapporter, der viser GRHL2 udtryk fremkalder forankringsuafhængig vækst 22.

    figur 1
    Figur 1: Tidslinje for MET Induktion med GRHL2 Overekspression og miR-200 Transfektion. (A) Tidslinje for ektopisk overekspression af GRHL2 i målceller. (B) Tidslinje for MET induktion via revers transfektion af miR-200 familiemedlemmer i målceller. (C) GRHL2 og miR-200 overekspression ført til ændringer i morfologi af målceller overensstemmelse med MET. Skala bar = 75 um venligst klik herfor at se en større version af dette tal.

    figur 2
    Figur 2: Concurrent Overekspression af GRHL2 og MIR-200s Led til MET i målceller. (A) Ekspression af MIR-200s førte til forhøjede E-cadherinekspression mens kombineret ekspression af GRHL2 og MIR-200s produceret en synergistisk virkning på E-cadherinekspression på både mRNA (middelværdier ± standardafvigelse) og proteinniveauer. (B) Kombineret ekspression af GRHL2 og MIR-200s førte til forøget ekspression af EpCAM og TJP1 ved celle-celle-kontakter (pile). Målestokken = 20 um. * Indikerer p <0,05 ANOVA er anvendt med Tukey post-hoc correction.This tal er modificeret fra henvisningen 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volumen 36, Issue 19, 2503-2513, 2016. Klik her for at se en større version af dette tal.

    figur 3
    Figur 3: Ekspression af MIR-200S undertrykker mesenchvmal Markører og formindsker forankringsuafhængig vækst i sarcomceller. (A) Over - ekspression af MIR-200s men ikke GRHL2 inhiberede Zeb1 og Notch1 mRNA-ekspression (middelværdier ± standardafvigelse). (B) Over-ekspression af MIR-200s men ikke GRHL2 inhiberede anoikis resistens i sarkomceller. Repræsentative billeder af farvede kolonier (Scale bar = 200 um) og kvantificering af antallet af kolonier (middelværdier ± standardafvigelse) er vist. * Indikerer p <0,05 ANOVA er anvendt med Tukey post-hoc correction.This figur er blevet modificeret fra ræs 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volumen 36, Issue 19, 2503-2513, 2016. Klik her for at se en større version af dette tal.

    figur 3
    Supplerende Video: RD celler, der udtrykker tom vektor og negativ kontrol miRNA. Videoer blev samlet fra billeder af RD-celler transficeret med tom vektor og negativ kontrol miRNA erhvervede hver to timer ved hjælp af en automatiseret live-cell imager. Klik her for at se denne video. (Højreklik for at downloade.)

    figur 3 />
    Supplerende Video 2: RD celler, der udtrykker GRHL2-EGFP og negativ kontrol miRNA. Videoer blev samlet fra billeder af RD-celler transficeret med GRHL2-EGFP og negativ kontrol miRNA erhvervede hver to timer ved hjælp af en automatiseret live-cell imager. Klik her for at se denne video. (Højreklik for at downloade.)

    figur 3
    Supplerende Video 3: RD celler, der udtrykker Tøm Vektor og miR200 miRNA. Videoer blev samlet fra billeder af RD-celler transficeret med tom vektor og miR200 miRNA erhvervede hver to timer ved hjælp af en automatiseret live-cell imager. Klik her for at se denne video. (Højreklik for at downloade.)

    nt" fo: keep-together.within-side = "1"> figur 3
    Supplerende Video 4: RD celler, der udtrykker GRHL2-EGFP og miR200 miRNA. Videoer blev indsamlet fra billeder af RD-celler transficeret med GRHL2-EGFP og miR200 miRNA erhvervede hver to timer ved hjælp af en automatiseret live-cell imager. Klik her for at se denne video. (Højreklik for at downloade.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Sarkomer er sjældne, men meget aggressive kræft i en mesenkymal afstamning. Trods deres mesenkym-slægt, en delmængde af sarkomer synes at undergå en fænotypisk overgang til en mere epitel-lignende tilstand. Denne MET-lignende kontakt har prognostisk relevans, som patienter med flere epiteliale-lignende tumorer er mindre aggressive 24. På trods af deres kliniske relevans, er der kun få undersøgelser vedrørende de molekylære mekanismer, der driver disse fænotypiske overgange i sarkomer.

    At undersøge MET-lignende overgange i sarkomceller, har vi udviklet en MET-induktion model ved at kombinere ekspression af epiteliale faktorer GRHL2 og miR-200-familien. Denne fremgangsmåde inducerer hurtigt sarcomaceller at blive mere epitellignende som målt ved ændringer i morfologi og genekspression. Ved hjælp af denne protokol til at fremkalde MET i sarkomceller letter undersøgelse af virkningen af ​​disse overgange på fænotyper, der driver sarkom aggression, sådansom migration, invasion, spredning og død modstand og hvordan hver af disse ændringer i biologi kan påvirke resistens.

    I forbindelse med epitel-afledte carcinomer, ekspression af en mesenchymal faktor er ofte tilstrækkelig til at inducere EMT 14. Men i denne sarcom-afledte model af MET ekspressionen af ​​to epitheliale faktorer, GRHL2 og MIR-200s, er påkrævet. Interessant nok MIR-200s alene havde en stærkere virkning på de fleste biomarkører for MET end GRHL2, mens GRHL2 kunne robust aktivere epiteliale gener kun i nærvær af miR-200-baseret undertrykkelse af epiteliale gen repressorer, såsom ZEB1 24. Det er muligt, at for nogle mesenchymale celletyper epiteliale gener skal være både de-represseres (fx via MIR-200s) og aktiveret (fx via GRHL2) til at drive MET.

    Vi har oplevet variation i niveauet af GRHL2 udtryk på tværs af forskellige cell linjer. For at overvinde dette, anvendte vi en GRHL2 ekspressionsplasmid, der også udtrykker EGFP 25 at sortere ved flowcytometri EGFP positive celler forud for eksperimenter. Det er også afgørende at validere funktionaliteten af ​​MIR-200s og GRHL2 i forskellige celletyper. EMT ses som et spektrum baseret på ekspression af epitel og mesenkym-associerede gener, som kan have kontekstafhængig variation baseret på cellelinie, cancer type behandling, etc. Derfor analyserede vi fem gener reguleret af miR-200 eller GRHL2 til tegner sig for celle kontekstafhængige ændringer. En anden advarsel af dette assay er afhængigheden af ​​en transient transfektion af MIR-200s for MET induktion. Således kan langtidsforsøg blive dyrt og kompliceret, når flere gentagne transfektioner blive nødvendig. Dette kan overvindes ved anvendelse af miR-200 ekspressionsplasmider.

    Andre undersøgelser har også rapporteret tegn på MET i sarkomer. For eksempel blev MET observeret i en undergruppe af leiomyosarcomas og var forbundet med bedre overlevelse for patienter. Mekanistisk, Yang et al. fandt, at i en leiomyosarkom-cellelinje inhibering af Slug med siRNA var tilstrækkelig til at inducere MET-lignende ændringer 29. Ligeledes, udtømning af endnu en anden mesenchymal faktor, snail, i mesenkymale stamceller reduceret sarkom dannelse i mus 30. Det er således klart af litteraturen, at der er flere veje til en MET-lignende fænotype, som kan variere efter celletype. Selvom dette ikke er den eneste måde at fremkalde behandling, har vi brugt vores metode til at inducere MET i to sarkom undertyper, herunder rhabdomyosarcoma (RD celler) og osteosarkom (143B celler). I fremtiden vil det være interessant at sammenligne disse forskellige metoder i en bredere vifte af sarkom celler. For eksempel har visse sarkom undertyper har underliggende genetiske eller epigenetiske ændringer, der gør dem mere eller mindre modtagelige for MET induktion?

    Identificering af virkningen af ​​METpå en række biologiske output i sarcomer celler kunne give en bedre forståelse af, hvorfor patienter med flere epitel-lignende sarkomer har en forbedret prognose. Hertil kommer, at forstå effekten af ​​behandlingen på at køre de fænotypiske overgange mellem stater ville uddybe vores biologiske forståelse og informere på svar på nuværende behandlinger i patienter med sarkom.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Forfatterne har intet at afsløre.

    Acknowledgments

    JAS anerkender støtte fra hertugen Cancer Institute, The Duke University Urogenitale Onkologi Laboratory, og Duke University Ortopædkirurgisk Afdeling. HL blev støttet af National Science Foundation (NSF) Center for Teoretisk Biologisk Fysik (NSF PHY-1.427.654) og NSF DMS-1.361.411, og som en CPRIT (Forebyggelse Cancer og Research Institute of Texas) Scholar i Cancer Research i staten Texas ved Rice University. KEW blev understøttet af NIH F32 CA192630 MKJ og HL nydt godt nyttige diskussioner med Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, og Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Induktion af Mesenchymale-Epithelial Overgange i sarkomceller
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter